Starting /dee2/code/volunteer_pipeline.sh SRR12666466 current disk space = 1542931558400 free memory = 1592484660 SRR12666466 SRAfilesize 00f0047f6e7fe141d8dfbe74e10b853e SRR12666466.sra SRR12666466.sra file validated SRR12666466 is paired end SRR12666466 is conventional basespace SRR12666466 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666466_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.439 37.0 37.0 37.0 37.0 37.0 2 36.16675 37.0 37.0 37.0 37.0 37.0 3 36.464 37.0 37.0 37.0 37.0 37.0 4 36.4555 37.0 37.0 37.0 37.0 37.0 5 36.506 37.0 37.0 37.0 37.0 37.0 6 36.573 37.0 37.0 37.0 37.0 37.0 7 36.4625 37.0 37.0 37.0 37.0 37.0 8 36.5095 37.0 37.0 37.0 37.0 37.0 9 36.5245 37.0 37.0 37.0 37.0 37.0 10-14 36.5187 37.0 37.0 37.0 37.0 37.0 15-19 36.5381 37.0 37.0 37.0 37.0 37.0 20-24 36.4793 37.0 37.0 37.0 37.0 37.0 25-29 36.4568 37.0 37.0 37.0 37.0 37.0 30-34 36.441500000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.410799999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.393299999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.343399999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.3775 37.0 37.0 37.0 37.0 37.0 55-59 36.303399999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.339000000000006 37.0 37.0 37.0 37.0 37.0 65-69 36.248900000000006 37.0 37.0 37.0 37.0 37.0 70-74 36.246900000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.2294 37.0 37.0 37.0 37.0 37.0 80-84 36.2106 37.0 37.0 37.0 37.0 37.0 85-89 36.2123 37.0 37.0 37.0 37.0 37.0 90-94 36.1298 37.0 37.0 37.0 37.0 37.0 95-99 36.05329999999999 37.0 37.0 37.0 37.0 37.0 100-104 36.0422 37.0 37.0 37.0 37.0 37.0 105-109 36.0893 37.0 37.0 37.0 37.0 37.0 110-114 36.0259 37.0 37.0 37.0 37.0 37.0 115-119 35.947799999999994 37.0 37.0 37.0 37.0 37.0 120-124 35.933800000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.9341 37.0 37.0 37.0 37.0 37.0 130-134 35.9139 37.0 37.0 37.0 37.0 37.0 135-139 35.926300000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.7657 37.0 37.0 37.0 37.0 37.0 145-149 35.6614 37.0 37.0 37.0 37.0 37.0 150-151 35.433 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 1.0 24 5.0 25 5.0 26 8.0 27 8.0 28 12.0 29 19.0 30 25.0 31 45.0 32 63.0 33 95.0 34 140.0 35 304.0 36 2755.0 37 514.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 51.075 13.075000000000001 6.7250000000000005 29.125 2 24.030037546933666 15.219023779724655 34.44305381727159 26.307884856070086 3 21.075 23.674999999999997 26.25 28.999999999999996 4 25.825 29.849999999999998 21.275 23.05 5 25.025 33.2 21.425 20.349999999999998 6 22.725 32.375 23.05 21.85 7 19.325 20.424999999999997 40.625 19.625 8 20.825 21.2 25.924999999999997 32.05 9 20.575 19.7 31.324999999999996 28.4 10-14 23.974999999999998 25.245 24.654999999999998 26.125 15-19 24.044999999999998 24.865000000000002 24.87 26.22 20-24 23.49 24.795 25.869999999999997 25.845000000000002 25-29 24.58 25.36 24.38 25.679999999999996 30-34 24.23 24.505 25.0 26.265 35-39 23.66 24.959999999999997 24.945 26.435 40-44 23.674999999999997 24.755 25.39 26.179999999999996 45-49 23.89 25.035 24.5 26.575 50-54 23.9 24.33 25.025 26.745 55-59 24.03 24.46 25.15 26.36 60-64 24.36 25.045 24.41 26.185000000000002 65-69 24.525 24.279999999999998 24.79 26.405 70-74 25.165 24.779999999999998 24.39 25.665 75-79 24.465 24.615000000000002 24.98 25.94 80-84 24.29 24.62 24.545 26.545 85-89 25.295 24.495 24.455 25.755 90-94 24.63 24.240000000000002 24.785 26.345000000000002 95-99 24.775 23.9 25.240000000000002 26.085 100-104 24.205 24.740000000000002 24.474999999999998 26.58 105-109 24.565 24.63 24.65 26.155 110-114 24.44 24.905 24.0 26.655 115-119 24.51 24.355 24.759999999999998 26.375 120-124 25.135 24.375 24.395 26.095000000000002 125-129 25.28 24.485 24.63 25.605 130-134 25.319999999999997 25.1 23.71 25.869999999999997 135-139 25.115 24.45 23.885 26.55 140-144 25.255 24.610000000000003 23.93 26.205000000000002 145-149 24.42 24.495 24.25 26.834999999999997 150-151 25.7875 23.8875 23.7125 26.6125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 1.0 27 1.0 28 5.0 29 7.0 30 4.5 31 8.5 32 12.5 33 14.5 34 22.5 35 30.0 36 45.0 37 56.5 38 74.0 39 93.5 40 109.5 41 131.0 42 152.0 43 177.0 44 179.0 45 176.0 46 178.0 47 177.0 48 171.0 49 168.5 50 155.5 51 129.5 52 131.5 53 130.5 54 120.5 55 113.5 56 102.0 57 89.0 58 88.5 59 94.0 60 96.5 61 93.5 62 73.5 63 69.0 64 76.5 65 68.5 66 57.0 67 54.0 68 51.0 69 48.5 70 39.5 71 32.0 72 30.0 73 21.0 74 14.0 75 11.5 76 7.0 77 2.0 78 1.5 79 2.0 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.125 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 90.30286190608501 81.25 2 8.530147263128647 15.35 3 1.0002778549597109 2.7 4 0.08335648791330925 0.3 5 0.05557099194220616 0.25 6 0.02778549597110308 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AATCGGAGAAGCAGTGCTGTCATTAGTCGCTGCCTCAGATTTACAGTACG 6 0.15 No Hit ATATGATCTCACTAGCCTCAAAGATAACGTCATAAGAGAATACAACATAT 5 0.125 No Hit GTCGAAGCTGCCGCCGGGGTAGAGAGGGTCGACGATCTCACCGAGCGGAC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.42500000000000004 0.0 0.0 0.0 0.0 90-91 0.5249999999999999 0.0 0.0 0.0 0.0 92-93 0.65 0.0 0.0 0.0 0.0 94-95 0.7749999999999999 0.0 0.0 0.0 0.0 96-97 0.9125 0.0 0.0 0.0 0.0 98-99 1.075 0.0 0.0 0.0 0.0 100-101 1.15 0.0 0.0 0.0 0.0 102-103 1.3250000000000002 0.0 0.0 0.0 0.0 104-105 1.5875 0.0 0.0 0.0 0.0 106-107 1.7875 0.0 0.0 0.0 0.0 108-109 1.9375 0.0 0.0 0.0 0.0 110-111 2.175 0.0 0.0 0.0 0.0 112-113 2.425 0.0 0.0 0.0 0.0 114-115 2.6625 0.0 0.0 0.0 0.0 116-117 2.8625 0.0 0.0 0.0 0.0 118-119 3.1375 0.0 0.0 0.0 0.0 120-121 3.55 0.0 0.0 0.0 0.0 122-123 4.1 0.0 0.0 0.0 0.0 124-125 4.6125 0.0 0.0 0.0 0.0 126-127 5.125 0.0 0.0 0.0 0.0 128-129 5.5625 0.0 0.0 0.0 0.0 130-131 6.075 0.0 0.0 0.0 0.0 132-133 6.5875 0.0 0.0 0.0 0.0 134-135 7.1375 0.0 0.0 0.0 0.0 136-137 7.7625 0.0 0.0 0.0 0.0 138-139 8.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12666466 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666466_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.9485 37.0 37.0 37.0 37.0 37.0 2 35.9825 37.0 37.0 37.0 37.0 37.0 3 36.2595 37.0 37.0 37.0 37.0 37.0 4 36.2175 37.0 37.0 37.0 37.0 37.0 5 36.264 37.0 37.0 37.0 37.0 37.0 6 36.023 37.0 37.0 37.0 37.0 37.0 7 36.1405 37.0 37.0 37.0 37.0 37.0 8 36.239 37.0 37.0 37.0 37.0 37.0 9 36.2325 37.0 37.0 37.0 37.0 37.0 10-14 36.1942 37.0 37.0 37.0 37.0 37.0 15-19 36.1288 37.0 37.0 37.0 37.0 37.0 20-24 36.132400000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.0783 37.0 37.0 37.0 37.0 37.0 30-34 36.0536 37.0 37.0 37.0 37.0 37.0 35-39 36.0072 37.0 37.0 37.0 37.0 37.0 40-44 35.9989 37.0 37.0 37.0 37.0 37.0 45-49 35.9919 37.0 37.0 37.0 37.0 37.0 50-54 35.9515 37.0 37.0 37.0 37.0 37.0 55-59 35.9226 37.0 37.0 37.0 37.0 37.0 60-64 35.8943 37.0 37.0 37.0 37.0 37.0 65-69 35.9085 37.0 37.0 37.0 37.0 37.0 70-74 35.8593 37.0 37.0 37.0 37.0 37.0 75-79 35.8148 37.0 37.0 37.0 37.0 37.0 80-84 35.8099 37.0 37.0 37.0 37.0 37.0 85-89 35.8005 37.0 37.0 37.0 37.0 37.0 90-94 35.829100000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.781 37.0 37.0 37.0 37.0 37.0 100-104 35.8014 37.0 37.0 37.0 37.0 37.0 105-109 35.6986 37.0 37.0 37.0 37.0 37.0 110-114 35.695 37.0 37.0 37.0 37.0 37.0 115-119 35.691199999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.759299999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.6866 37.0 37.0 37.0 37.0 37.0 130-134 35.627199999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.426500000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.4046 37.0 37.0 37.0 37.0 37.0 145-149 35.3962 37.0 37.0 37.0 37.0 37.0 150-151 35.116 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 9.0 14 6.0 15 6.0 16 7.0 17 3.0 18 1.0 19 5.0 20 4.0 21 11.0 22 1.0 23 11.0 24 4.0 25 12.0 26 7.0 27 12.0 28 12.0 29 15.0 30 19.0 31 19.0 32 55.0 33 95.0 34 161.0 35 476.0 36 2576.0 37 471.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 51.075 17.675 7.5249999999999995 23.724999999999998 2 30.349999999999998 19.45 27.125 23.075000000000003 3 26.400000000000002 22.775000000000002 26.75 24.075 4 28.375 30.425 18.725 22.475 5 27.900000000000002 33.300000000000004 18.0 20.8 6 24.25 33.25 17.5 25.0 7 22.45 17.599999999999998 34.4 25.55 8 22.3 19.825 23.150000000000002 34.725 9 25.874999999999996 19.25 24.825 30.049999999999997 10-14 27.089999999999996 23.865 22.759999999999998 26.284999999999997 15-19 26.590000000000003 24.7 23.145 25.564999999999998 20-24 26.005 25.555 23.095 25.345000000000002 25-29 26.69 24.745 22.88 25.685000000000002 30-34 26.405 25.019999999999996 23.044999999999998 25.53 35-39 26.435 25.205 22.825 25.535000000000004 40-44 26.255 24.385 23.400000000000002 25.96 45-49 26.584999999999997 24.654999999999998 22.939999999999998 25.82 50-54 26.58 24.515 23.494999999999997 25.41 55-59 26.91 23.965 23.485 25.64 60-64 26.665 25.055 23.45 24.83 65-69 26.565 24.735 23.380000000000003 25.319999999999997 70-74 26.63 24.355 23.655 25.36 75-79 26.445 24.815 23.64 25.1 80-84 26.685 24.125 23.86 25.330000000000002 85-89 26.56 25.105 23.025000000000002 25.31 90-94 26.655 24.55 23.89 24.905 95-99 26.565 24.505 23.72 25.21 100-104 26.479999999999997 25.835 22.805 24.88 105-109 26.655 25.380000000000003 23.119999999999997 24.845 110-114 26.810000000000002 25.35 23.265 24.575 115-119 26.19 25.45 23.325000000000003 25.035 120-124 27.1 25.34 22.905 24.654999999999998 125-129 27.765 25.705 22.63 23.9 130-134 27.700000000000003 25.28 23.345 23.674999999999997 135-139 27.725 25.665 23.265 23.345 140-144 28.16 25.645 22.88 23.315 145-149 29.03 25.865 22.345000000000002 22.759999999999998 150-151 28.5625 26.137500000000003 22.6375 22.662499999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 1.0 5 1.5 6 0.5 7 1.0 8 1.5 9 0.5 10 0.0 11 1.0 12 1.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.0 24 0.5 25 0.5 26 1.5 27 1.5 28 3.5 29 4.5 30 4.0 31 6.5 32 8.0 33 14.0 34 21.0 35 31.0 36 40.5 37 44.5 38 50.0 39 72.5 40 91.5 41 102.5 42 118.0 43 134.5 44 155.5 45 162.0 46 166.0 47 172.5 48 179.0 49 159.5 50 122.0 51 123.0 52 125.0 53 115.5 54 115.0 55 110.0 56 104.0 57 105.5 58 110.0 59 105.0 60 103.0 61 107.5 62 101.5 63 103.0 64 93.0 65 80.0 66 78.5 67 75.5 68 73.0 69 64.5 70 61.5 71 46.5 72 30.5 73 23.0 74 17.5 75 11.5 76 6.0 77 4.0 78 3.5 79 3.0 80 1.0 81 0.0 82 1.0 83 2.0 84 1.5 85 1.0 86 1.0 87 1.5 88 2.0 89 1.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 1.0 97 1.5 98 0.5 99 2.0 100 3.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.85 #Duplication Level Percentage of deduplicated Percentage of total 1 90.40066777963273 81.22500000000001 2 8.375069560378408 15.049999999999999 3 1.001669449081803 2.7 4 0.11129660545353368 0.4 5 0.02782415136338342 0.125 6 0.05564830272676684 0.3 7 0.0 0.0 8 0.02782415136338342 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 8 0.2 No Hit GTCCAAGTGAAGTGAGCACCACTGCTGCAGAGAGAGAGATCGAGATGGCA 6 0.15 No Hit AACAAGTTTATGACCCCATCAGCATTCATTTTTTTGTATGAGAACAATCT 6 0.15 No Hit TGTTGGCTTCCATGTGATTCCTAGCAGCATTAAGCATGAATATGGTGCCT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.44999999999999996 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.675 0.0 0.0 0.0 0.0 94-95 0.8 0.0 0.0 0.0 0.0 96-97 0.9125 0.0 0.0 0.0 0.0 98-99 1.075 0.0 0.0 0.0 0.0 100-101 1.15 0.0 0.0 0.0 0.0 102-103 1.3250000000000002 0.0 0.0 0.0 0.0 104-105 1.5875 0.0 0.0 0.0 0.0 106-107 1.7875 0.0 0.0 0.0 0.0 108-109 1.9375 0.0 0.0 0.0 0.0 110-111 2.175 0.0 0.0 0.0 0.0 112-113 2.425 0.0 0.0 0.0 0.0 114-115 2.6625 0.0 0.0 0.0 0.0 116-117 2.8625 0.0 0.0 0.0 0.0 118-119 3.15 0.0 0.0 0.0 0.0 120-121 3.55 0.0 0.0 0.0 0.0 122-123 4.1125 0.0 0.0 0.0 0.0 124-125 4.6625 0.0 0.0 0.0 0.0 126-127 5.2 0.0 0.0 0.0 0.0 128-129 5.65 0.0 0.0 0.0 0.0 130-131 6.2 0.0 0.0 0.0 0.0 132-133 6.725 0.0 0.0 0.0 0.0 134-135 7.275 0.0 0.0 0.0 0.0 136-137 7.925 0.0 0.0 0.0 0.0 138-139 8.537500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGAAAT 10 0.006830828 145.0 6 CTTGACC 10 0.006830828 145.0 1 >>END_MODULE Read 1940467 spots for SRR12666466.sra Written 1940467 spots for SRR12666466.sra Read 1940467 spots for SRR12666466.sra Written 1940467 spots for SRR12666466.sra Read 1940467 spots for SRR12666466.sra Written 1940467 spots for SRR12666466.sra Read 1940467 spots for SRR12666466.sra Written 1940467 spots for SRR12666466.sra Read 1940467 spots for SRR12666466.sra Written 1940467 spots for SRR12666466.sra Read 1940467 spots for SRR12666466.sra Written 1940467 spots for SRR12666466.sra Read 1940467 spots for SRR12666466.sra Written 1940467 spots for SRR12666466.sra Read 1940480 spots for SRR12666466.sra Written 1940480 spots for SRR12666466.sra Read 1940467 spots for SRR12666466.sra Written 1940467 spots for SRR12666466.sra Read 1940467 spots for SRR12666466.sra Written 1940467 spots for SRR12666466.sra Read 1940467 spots for SRR12666466.sra Written 1940467 spots for SRR12666466.sra Read 1940467 spots for SRR12666466.sra Written 1940467 spots for SRR12666466.sra Read 1940467 spots for SRR12666466.sra Written 1940467 spots for SRR12666466.sra Read 1940467 spots for SRR12666466.sra Written 1940467 spots for SRR12666466.sra Read 1940467 spots for SRR12666466.sra Written 1940467 spots for SRR12666466.sra Read 1940467 spots for SRR12666466.sra Written 1940467 spots for SRR12666466.sra Read 1940467 spots for SRR12666466.sra Written 1940467 spots for SRR12666466.sra Read 1940467 spots for SRR12666466.sra Written 1940467 spots for SRR12666466.sra Read 1940467 spots for SRR12666466.sra Written 1940467 spots for SRR12666466.sra Read 1940467 spots for SRR12666466.sra Written 1940467 spots for SRR12666466.sra SRR ids: ['SRR12666466.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tmekodek SRR12666466.sra spots: 38809353 blocks: [[1, 1940467], [1940468, 3880934], [3880935, 5821401], [5821402, 7761868], [7761869, 9702335], [9702336, 11642802], [11642803, 13583269], [13583270, 15523736], [15523737, 17464203], [17464204, 19404670], [19404671, 21345137], [21345138, 23285604], [23285605, 25226071], [25226072, 27166538], [27166539, 29107005], [29107006, 31047472], [31047473, 32987939], [32987940, 34928406], [34928407, 36868873], [36868874, 38809353]] SRR12666466 file size 13167415 SRR12666466 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12666466 SRR12666466_1.fastq SRR12666466_2.fastq Input file: SRR12666466_1.fastq Paired file: SRR12666466_2.fastq trimmed: SRR12666466-trimmed-pair1.fastq, SRR12666466-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 13:47:01 2024 >> started Sat Dec 7 13:47:40 2024 >> done (39.777s) 38809353 read pairs processed; of these: 154 ( 0.00%) short read pairs filtered out after trimming by size control 53915 ( 0.14%) empty read pairs filtered out after trimming by size control 38755284 (99.86%) read pairs available; of these: 4354290 (11.24%) trimmed read pairs available after processing 34400994 (88.76%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 16 0.00% 20 27 0.00% 21 24 0.00% 22 35 0.00% 23 23 0.00% 24 24 0.00% 25 38 0.00% 26 44 0.00% 27 30 0.00% 28 39 0.00% 29 45 0.00% 30 38 0.00% 31 75 0.00% 32 89 0.00% 33 60 0.00% 34 57 0.00% 35 61 0.00% 36 55 0.00% 37 64 0.00% 38 89 0.00% 39 75 0.00% 40 71 0.00% 41 85 0.00% 42 93 0.00% 43 80 0.00% 44 100 0.00% 45 129 0.00% 46 122 0.00% 47 152 0.00% 48 164 0.00% 49 184 0.00% 50 193 0.00% 51 179 0.00% 52 275 0.00% 53 247 0.00% 54 276 0.00% 55 300 0.00% 56 296 0.00% 57 355 0.00% 58 417 0.00% 59 452 0.00% 60 510 0.00% 61 540 0.00% 62 674 0.00% 63 689 0.00% 64 743 0.00% 65 767 0.00% 66 871 0.00% 67 972 0.00% 68 1143 0.00% 69 1326 0.00% 70 1635 0.00% 71 1741 0.00% 72 2141 0.01% 73 2453 0.01% 74 2588 0.01% 75 2844 0.01% 76 3188 0.01% 77 3468 0.01% 78 3877 0.01% 79 4342 0.01% 80 4916 0.01% 81 5835 0.02% 82 6719 0.02% 83 7739 0.02% 84 8557 0.02% 85 9074 0.02% 86 9928 0.03% 87 10484 0.03% 88 11423 0.03% 89 12376 0.03% 90 14031 0.04% 91 15341 0.04% 92 17337 0.04% 93 18805 0.05% 94 20925 0.05% 95 22136 0.06% 96 23276 0.06% 97 24289 0.06% 98 25276 0.07% 99 27338 0.07% 100 28954 0.07% 101 31365 0.08% 102 34666 0.09% 103 36445 0.09% 104 39159 0.10% 105 40584 0.10% 106 42318 0.11% 107 43076 0.11% 108 44727 0.12% 109 46176 0.12% 110 47408 0.12% 111 51147 0.13% 112 54032 0.14% 113 55920 0.14% 114 59832 0.15% 115 61727 0.16% 116 62749 0.16% 117 65578 0.17% 118 65110 0.17% 119 65295 0.17% 120 66985 0.17% 121 69693 0.18% 122 71450 0.18% 123 77284 0.20% 124 80828 0.21% 125 82960 0.21% 126 84511 0.22% 127 84308 0.22% 128 84743 0.22% 129 86512 0.22% 130 86414 0.22% 131 88266 0.23% 132 91720 0.24% 133 95248 0.25% 134 97363 0.25% 135 102836 0.27% 136 103111 0.27% 137 103755 0.27% 138 105141 0.27% 139 105582 0.27% 140 105346 0.27% 141 107592 0.28% 142 109195 0.28% 143 111192 0.29% 144 115096 0.30% 145 119538 0.31% 146 119734 0.31% 147 121657 0.31% 148 121074 0.31% 149 120307 0.31% 150 121071 0.31% 151 34400994 88.76% 38755284 reads passed initial QC criterion=sequence-density sequence-density=0.83 sequence-density-rank=1 fanout-score=3.17 fanout-score-rank=19 prefix-density=0.90 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.12 sequence-density-rank=28 fanout-score=10.17 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=3.3 sequence=AGCTTGAGGGTGTAGCTGGCGACTTGCTCAGGGGTGGCCCGCTCCTTGCACTCGGCGCCGGGTGTCACCATGCTGGGCTTGAGGAGGATGCCCTCGAACAAGACGTTGTTCTGGGCCATGTAGTAGAAAGTCTCCGCCCACACCTTCTGCGCCACCTCGAAGGTCCTGTCGATGCCGTGCTCGCCGTCCAGCAGGATCTCCGGCTCCACAATCGGCACCAGACCGTTGTCCTGAGAGATGGCAGCGTAACGGGCAAGACCCCATGCAGCTTCCTTGACAGCAAGCTCAGATGGGCCGTTGGGGATGCTGACGACAGTGCGCCACTTGGCGAAGCGGGCGCCTTGCTGGTAGTAGGCTGCCTCACGGGAGGCAAGGCCATCAAGACCTTGGCACCATGACTCGTCGTTGGAACCAACGAGTGGCACAAGACCCTTGTCAACCTTGATGCCGGGAACG criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=2.52 fanout-score-rank=25 prefix-density=0.60 prefix-fanout=2.2 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=84.35 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=6.5 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTTGGTTC SRR12666466 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 13:48:22 Started mapping on | Dec 07 13:48:22 Finished on | Dec 07 13:52:26 Mapping speed, Million of reads per hour | 571.80 Number of input reads | 38755284 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 36300387 Uniquely mapped reads % | 93.67% Average mapped length | 295.40 Number of splices: Total | 38972086 Number of splices: Annotated (sjdb) | 36770605 Number of splices: GT/AG | 38384082 Number of splices: GC/AG | 488564 Number of splices: AT/AC | 12700 Number of splices: Non-canonical | 86740 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 674405 % of reads mapped to multiple loci | 1.74% Number of reads mapped to too many loci | 68383 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.46% % of reads unmapped: other | 0.96% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1780492 1780492 1780492 N_multimapping 674405 674405 674405 N_noFeature 1352803 35179046 1641592 N_ambiguous 976742 4983 146204 UnstrandedReadsAssigned:33970842 PositiveStrandReadsAssigned:1116358 NegativeStrandReadsAssigned:34512591 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12666466 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12666466-trimmed-pair1.fastq SRR12666466-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 38,755,284 reads, 35,033,191 reads pseudoaligned [quant] estimated average fragment length: 282.255 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,213 rounds 52973 SRR12666466.ke.tsv 35125 SRR12666466.se.tsv 88098 total ==> SRR12666466.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 655.778 0 0 PNS24247 1044 762.745 71.1576 3.75355 PNS24249 1928 1646.75 47.2072 1.15341 PNS24246 1044 762.745 71.1576 3.75355 PNS24248 1044 762.745 71.1576 3.75355 PNS24244 1471 1189.75 150.32 5.0835 PNS24243 293 97.5023 1 0.412653 KQK14069 1603 1321.75 2863.53 87.1673 KQK14071 474 231.66 104.031 18.068 ==> SRR12666466.se.tsv <== BRADI_1g14170v3 3332 BRADI_1g53295v3 1566 BRADI_1g59795v3 244 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 587 BRADI_1g74790v3 246 BRADI_1g09890v3 0 BRADI_1g77505v3 319 BRADI_1g48960v3 0 SRR12666466 completed mapping pipeline successfully