Starting /dee2/code/volunteer_pipeline.sh SRR12666467 current disk space = 1542925983744 free memory = 1598588608 SRR12666467 SRAfilesize 9b846d34517955d141df9810378853df SRR12666467.sra SRR12666467.sra file validated SRR12666467 is paired end SRR12666467 is conventional basespace SRR12666467 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666467_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4995 37.0 37.0 37.0 37.0 37.0 2 36.1825 37.0 37.0 37.0 37.0 37.0 3 36.4225 37.0 37.0 37.0 37.0 37.0 4 36.4575 37.0 37.0 37.0 37.0 37.0 5 36.5355 37.0 37.0 37.0 37.0 37.0 6 36.526 37.0 37.0 37.0 37.0 37.0 7 36.5315 37.0 37.0 37.0 37.0 37.0 8 36.5505 37.0 37.0 37.0 37.0 37.0 9 36.5155 37.0 37.0 37.0 37.0 37.0 10-14 36.527699999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.560700000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.489999999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.452999999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.4468 37.0 37.0 37.0 37.0 37.0 35-39 36.4145 37.0 37.0 37.0 37.0 37.0 40-44 36.344100000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.3173 37.0 37.0 37.0 37.0 37.0 50-54 36.304899999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.2484 37.0 37.0 37.0 37.0 37.0 60-64 36.2893 37.0 37.0 37.0 37.0 37.0 65-69 36.2504 37.0 37.0 37.0 37.0 37.0 70-74 36.21319999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.2264 37.0 37.0 37.0 37.0 37.0 80-84 36.2217 37.0 37.0 37.0 37.0 37.0 85-89 36.1323 37.0 37.0 37.0 37.0 37.0 90-94 36.16189999999999 37.0 37.0 37.0 37.0 37.0 95-99 36.090599999999995 37.0 37.0 37.0 37.0 37.0 100-104 36.11409999999999 37.0 37.0 37.0 37.0 37.0 105-109 36.1272 37.0 37.0 37.0 37.0 37.0 110-114 36.0259 37.0 37.0 37.0 37.0 37.0 115-119 36.0065 37.0 37.0 37.0 37.0 37.0 120-124 36.0201 37.0 37.0 37.0 37.0 37.0 125-129 35.948600000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.9867 37.0 37.0 37.0 37.0 37.0 135-139 35.9723 37.0 37.0 37.0 37.0 37.0 140-144 35.789 37.0 37.0 37.0 37.0 37.0 145-149 35.658100000000005 37.0 37.0 37.0 37.0 37.0 150-151 35.46125 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 2.0 23 1.0 24 9.0 25 3.0 26 4.0 27 8.0 28 16.0 29 25.0 30 32.0 31 29.0 32 44.0 33 98.0 34 143.0 35 296.0 36 2761.0 37 527.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.349999999999994 12.7 7.7 32.25 2 24.3114672008012 15.348022033049574 33.65047571357035 26.69003505257887 3 19.900000000000002 24.099999999999998 26.900000000000002 29.099999999999998 4 27.200000000000003 28.000000000000004 22.05 22.75 5 26.55 31.25 22.325 19.875 6 22.425 33.85 22.900000000000002 20.825 7 18.6 18.925 40.949999999999996 21.525 8 21.0 19.75 27.975 31.275 9 20.674999999999997 19.675 31.5 28.15 10-14 23.77 25.019999999999996 24.755 26.455000000000002 15-19 23.695 24.565 25.295 26.445 20-24 23.79 25.515 24.895 25.8 25-29 23.810000000000002 25.34 24.33 26.52 30-34 23.51 24.375 25.380000000000003 26.735 35-39 23.645 24.81 25.115 26.43 40-44 23.435 24.22 25.88 26.465 45-49 23.974999999999998 24.725 24.91 26.39 50-54 23.93 24.765 25.235000000000003 26.07 55-59 24.025 24.43 24.92 26.625 60-64 24.335 24.87 24.615000000000002 26.179999999999996 65-69 23.75 25.275 24.265 26.71 70-74 24.335 23.895 24.959999999999997 26.810000000000002 75-79 24.525 23.895 25.39 26.19 80-84 24.51 24.39 24.834999999999997 26.265 85-89 24.355 24.32 24.805 26.52 90-94 24.765 23.955000000000002 24.91 26.369999999999997 95-99 24.425 23.974999999999998 24.95 26.650000000000002 100-104 24.88 24.38 25.005 25.735000000000003 105-109 24.895 24.834999999999997 24.21 26.06 110-114 24.72 24.575 24.474999999999998 26.229999999999997 115-119 25.424999999999997 24.365000000000002 24.404999999999998 25.805 120-124 24.86 24.67 24.03 26.44 125-129 25.095 24.779999999999998 23.655 26.47 130-134 25.055 24.62 23.845 26.479999999999997 135-139 24.54 24.515 24.21 26.735 140-144 25.319999999999997 24.349999999999998 23.845 26.484999999999996 145-149 25.335 24.75 23.549999999999997 26.365 150-151 26.025 24.0125 23.875 26.087500000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.5 22 1.5 23 0.5 24 0.5 25 0.5 26 2.0 27 1.5 28 3.5 29 4.5 30 5.5 31 8.0 32 9.0 33 16.5 34 23.5 35 24.5 36 32.5 37 54.5 38 81.0 39 97.5 40 101.5 41 120.5 42 150.5 43 169.5 44 176.0 45 172.5 46 194.0 47 204.0 48 182.0 49 170.5 50 157.5 51 142.0 52 132.0 53 116.0 54 109.0 55 111.0 56 104.0 57 99.5 58 82.5 59 76.5 60 95.5 61 93.5 62 78.5 63 73.0 64 76.5 65 71.0 66 68.5 67 67.5 68 51.5 69 43.0 70 38.0 71 32.0 72 26.0 73 16.0 74 9.5 75 8.0 76 5.5 77 3.0 78 1.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.15 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.85 #Duplication Level Percentage of deduplicated Percentage of total 1 91.24931205283434 82.89999999999999 2 7.59493670886076 13.8 3 1.0181618051733627 2.775 4 0.1100715465052284 0.4 5 0.0275178866263071 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGACCTCTTCCTGGACGCTCTAAGCGTTGGCAGCATCGCCATGGATGAC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.45 0.0 0.0 0.0 0.0 98-99 0.575 0.0 0.0 0.0 0.0 100-101 0.7749999999999999 0.0 0.0 0.0 0.0 102-103 0.9750000000000001 0.0 0.0 0.0 0.0 104-105 1.1125 0.0 0.0 0.0 0.0 106-107 1.225 0.0 0.0 0.0 0.0 108-109 1.3875000000000002 0.0 0.0 0.0 0.0 110-111 1.625 0.0 0.0 0.0 0.0 112-113 1.875 0.0 0.0 0.0 0.0 114-115 2.2750000000000004 0.0 0.0 0.0 0.0 116-117 2.5625 0.0 0.0 0.0 0.0 118-119 3.0375 0.0 0.0 0.0 0.0 120-121 3.25 0.0 0.0 0.0 0.0 122-123 3.5625 0.0 0.0 0.0 0.0 124-125 3.85 0.0 0.0 0.0 0.0 126-127 4.1875 0.0 0.0 0.0 0.0 128-129 4.4 0.0 0.0 0.0 0.0 130-131 4.75 0.0 0.0 0.0 0.0 132-133 5.300000000000001 0.0 0.0 0.0 0.0 134-135 5.800000000000001 0.0 0.0 0.0 0.0 136-137 6.1625 0.0 0.0 0.0 0.0 138-139 6.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12666467 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666467_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.975 37.0 37.0 37.0 37.0 37.0 2 35.9975 37.0 37.0 37.0 37.0 37.0 3 36.091 37.0 37.0 37.0 37.0 37.0 4 36.262 37.0 37.0 37.0 37.0 37.0 5 36.3145 37.0 37.0 37.0 37.0 37.0 6 36.103 37.0 37.0 37.0 37.0 37.0 7 36.0795 37.0 37.0 37.0 37.0 37.0 8 36.242 37.0 37.0 37.0 37.0 37.0 9 36.18 37.0 37.0 37.0 37.0 37.0 10-14 36.188900000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.1592 37.0 37.0 37.0 37.0 37.0 20-24 36.1787 37.0 37.0 37.0 37.0 37.0 25-29 36.148199999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.1069 37.0 37.0 37.0 37.0 37.0 35-39 36.0028 37.0 37.0 37.0 37.0 37.0 40-44 36.028200000000005 37.0 37.0 37.0 37.0 37.0 45-49 35.9677 37.0 37.0 37.0 37.0 37.0 50-54 35.9528 37.0 37.0 37.0 37.0 37.0 55-59 35.950300000000006 37.0 37.0 37.0 37.0 37.0 60-64 35.915 37.0 37.0 37.0 37.0 37.0 65-69 35.9403 37.0 37.0 37.0 37.0 37.0 70-74 35.9405 37.0 37.0 37.0 37.0 37.0 75-79 35.9602 37.0 37.0 37.0 37.0 37.0 80-84 35.9165 37.0 37.0 37.0 37.0 37.0 85-89 35.8503 37.0 37.0 37.0 37.0 37.0 90-94 35.8437 37.0 37.0 37.0 37.0 37.0 95-99 35.797399999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.897 37.0 37.0 37.0 37.0 37.0 105-109 35.8244 37.0 37.0 37.0 37.0 37.0 110-114 35.7198 37.0 37.0 37.0 37.0 37.0 115-119 35.7122 37.0 37.0 37.0 37.0 37.0 120-124 35.787 37.0 37.0 37.0 37.0 37.0 125-129 35.7379 37.0 37.0 37.0 37.0 37.0 130-134 35.6888 37.0 37.0 37.0 37.0 37.0 135-139 35.5464 37.0 37.0 37.0 37.0 37.0 140-144 35.4354 37.0 37.0 37.0 37.0 37.0 145-149 35.355 37.0 37.0 37.0 37.0 37.0 150-151 35.010000000000005 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 4.0 13 8.0 14 7.0 15 5.0 16 4.0 17 2.0 18 1.0 19 0.0 20 5.0 21 2.0 22 6.0 23 9.0 24 10.0 25 15.0 26 5.0 27 14.0 28 7.0 29 19.0 30 19.0 31 42.0 32 48.0 33 74.0 34 146.0 35 459.0 36 2603.0 37 486.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 50.575 16.775000000000002 8.325000000000001 24.325 2 28.675 20.45 27.474999999999998 23.400000000000002 3 26.35 22.900000000000002 26.224999999999998 24.525 4 30.099999999999998 31.4 16.925 21.575 5 26.950000000000003 34.675 17.849999999999998 20.525 6 22.875 35.199999999999996 18.099999999999998 23.825 7 24.0 15.125 36.15 24.725 8 23.1 20.95 22.6 33.35 9 25.174999999999997 19.625 24.95 30.25 10-14 27.224999999999998 24.32 22.02 26.435 15-19 26.740000000000002 24.25 23.494999999999997 25.515 20-24 26.435 24.445 23.59 25.53 25-29 26.655 24.745 22.99 25.61 30-34 26.25 24.44 23.76 25.55 35-39 27.134999999999998 24.93 22.3 25.635 40-44 26.93 24.395 23.49 25.185000000000002 45-49 27.310000000000002 24.015 23.155 25.52 50-54 27.315 24.36 22.96 25.365 55-59 26.775 24.41 23.485 25.330000000000002 60-64 26.72 24.52 23.465 25.295 65-69 26.99 24.465 23.47 25.074999999999996 70-74 26.625 24.615000000000002 23.485 25.275 75-79 26.790000000000003 24.93 22.99 25.290000000000003 80-84 27.250000000000004 24.365000000000002 23.385 25.0 85-89 26.61 24.490000000000002 23.565 25.335 90-94 26.735 24.34 23.3 25.624999999999996 95-99 26.57 24.795 23.41 25.224999999999998 100-104 27.279999999999998 24.715 23.01 24.995 105-109 26.915 24.935 23.849999999999998 24.3 110-114 27.034999999999997 25.874999999999996 22.925 24.165 115-119 27.49 25.53 22.625 24.355 120-124 27.939999999999998 25.305 22.79 23.965 125-129 27.950000000000003 25.380000000000003 23.064999999999998 23.605 130-134 27.935 24.585 23.93 23.549999999999997 135-139 27.994999999999997 24.485 23.515 24.005000000000003 140-144 28.389999999999997 25.580000000000002 23.169999999999998 22.86 145-149 28.595 24.945 23.365 23.095 150-151 29.625 24.825 22.9875 22.5625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.5 4 1.0 5 0.5 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 2.5 22 2.0 23 1.0 24 2.5 25 2.5 26 1.5 27 2.0 28 4.0 29 6.5 30 8.0 31 10.0 32 9.5 33 8.5 34 18.0 35 25.5 36 23.0 37 32.5 38 47.5 39 63.5 40 89.0 41 112.5 42 130.0 43 144.0 44 151.0 45 156.0 46 162.5 47 153.5 48 153.0 49 158.5 50 143.0 51 138.5 52 131.0 53 121.0 54 129.5 55 122.0 56 101.0 57 105.0 58 109.5 59 111.5 60 108.5 61 94.0 62 104.5 63 104.0 64 87.5 65 83.5 66 80.0 67 72.0 68 72.0 69 65.0 70 51.5 71 41.0 72 34.0 73 30.0 74 18.0 75 10.0 76 9.0 77 6.0 78 2.5 79 2.0 80 1.5 81 1.5 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.5 90 1.5 91 1.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.5 98 2.0 99 2.0 100 6.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.025 #Duplication Level Percentage of deduplicated Percentage of total 1 90.97472924187726 81.89999999999999 2 7.553457372951958 13.600000000000001 3 1.3051930019439044 3.5249999999999995 4 0.11108025548458762 0.4 5 0.0 0.0 6 0.027770063871146906 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027770063871146906 0.42500000000000004 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 17 0.42500000000000004 No Hit GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.65 0.0 0.0 0.0 0.0 100-101 0.8500000000000001 0.0 0.0 0.0 0.0 102-103 1.05 0.0 0.0 0.0 0.0 104-105 1.1875 0.0 0.0 0.0 0.0 106-107 1.2999999999999998 0.0 0.0 0.0 0.0 108-109 1.4625 0.0 0.0 0.0 0.0 110-111 1.7 0.0 0.0 0.0 0.0 112-113 1.9625 0.0 0.0 0.0 0.0 114-115 2.375 0.0 0.0 0.0 0.0 116-117 2.6624999999999996 0.0 0.0 0.0 0.0 118-119 3.1375 0.0 0.0 0.0 0.0 120-121 3.3499999999999996 0.0 0.0 0.0 0.0 122-123 3.675 0.0 0.0 0.0 0.0 124-125 3.975 0.0 0.0 0.0 0.0 126-127 4.3125 0.0 0.0 0.0 0.0 128-129 4.525 0.0 0.0 0.0 0.0 130-131 4.875 0.0 0.0 0.0 0.0 132-133 5.425000000000001 0.0 0.0 0.0 0.0 134-135 5.9375 0.0 0.0 0.0 0.0 136-137 6.3375 0.0 0.0 0.0 0.0 138-139 6.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1884850 spots for SRR12666467.sra Written 1884850 spots for SRR12666467.sra Read 1884850 spots for SRR12666467.sra Written 1884850 spots for SRR12666467.sra Read 1884850 spots for SRR12666467.sra Written 1884850 spots for SRR12666467.sra Read 1884850 spots for SRR12666467.sra Written 1884850 spots for SRR12666467.sra Read 1884850 spots for SRR12666467.sra Written 1884850 spots for SRR12666467.sra Read 1884850 spots for SRR12666467.sra Written 1884850 spots for SRR12666467.sra Read 1884850 spots for SRR12666467.sra Written 1884850 spots for SRR12666467.sra Read 1884850 spots for SRR12666467.sra Written 1884850 spots for SRR12666467.sra Read 1884850 spots for SRR12666467.sra Written 1884850 spots for SRR12666467.sra Read 1884850 spots for SRR12666467.sra Written 1884850 spots for SRR12666467.sra Read 1884850 spots for SRR12666467.sra Written 1884850 spots for SRR12666467.sra Read 1884850 spots for SRR12666467.sra Written 1884850 spots for SRR12666467.sra Read 1884850 spots for SRR12666467.sra Written 1884850 spots for SRR12666467.sra Read 1884859 spots for SRR12666467.sra Written 1884859 spots for SRR12666467.sra Read 1884850 spots for SRR12666467.sra Written 1884850 spots for SRR12666467.sra Read 1884850 spots for SRR12666467.sra Written 1884850 spots for SRR12666467.sra Read 1884850 spots for SRR12666467.sra Written 1884850 spots for SRR12666467.sra Read 1884850 spots for SRR12666467.sra Written 1884850 spots for SRR12666467.sra Read 1884850 spots for SRR12666467.sra Written 1884850 spots for SRR12666467.sra Read 1884850 spots for SRR12666467.sra Written 1884850 spots for SRR12666467.sra SRR ids: ['SRR12666467.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gywkt89r SRR12666467.sra spots: 37697009 blocks: [[1, 1884850], [1884851, 3769700], [3769701, 5654550], [5654551, 7539400], [7539401, 9424250], [9424251, 11309100], [11309101, 13193950], [13193951, 15078800], [15078801, 16963650], [16963651, 18848500], [18848501, 20733350], [20733351, 22618200], [22618201, 24503050], [24503051, 26387900], [26387901, 28272750], [28272751, 30157600], [30157601, 32042450], [32042451, 33927300], [33927301, 35812150], [35812151, 37697009]] SRR12666467 file size 12789392 SRR12666467 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12666467 SRR12666467_1.fastq SRR12666467_2.fastq Input file: SRR12666467_1.fastq Paired file: SRR12666467_2.fastq trimmed: SRR12666467-trimmed-pair1.fastq, SRR12666467-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 13:48:53 2024 >> started Sat Dec 7 13:49:33 2024 >> done (40.263s) 37697009 read pairs processed; of these: 115 ( 0.00%) short read pairs filtered out after trimming by size control 48497 ( 0.13%) empty read pairs filtered out after trimming by size control 37648397 (99.87%) read pairs available; of these: 3850242 (10.23%) trimmed read pairs available after processing 33798155 (89.77%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 13 0.00% 20 12 0.00% 21 21 0.00% 22 13 0.00% 23 21 0.00% 24 31 0.00% 25 20 0.00% 26 24 0.00% 27 27 0.00% 28 27 0.00% 29 41 0.00% 30 40 0.00% 31 35 0.00% 32 48 0.00% 33 37 0.00% 34 40 0.00% 35 45 0.00% 36 39 0.00% 37 61 0.00% 38 63 0.00% 39 49 0.00% 40 54 0.00% 41 55 0.00% 42 71 0.00% 43 62 0.00% 44 71 0.00% 45 75 0.00% 46 83 0.00% 47 90 0.00% 48 118 0.00% 49 120 0.00% 50 149 0.00% 51 163 0.00% 52 158 0.00% 53 170 0.00% 54 168 0.00% 55 229 0.00% 56 251 0.00% 57 241 0.00% 58 303 0.00% 59 355 0.00% 60 392 0.00% 61 485 0.00% 62 556 0.00% 63 570 0.00% 64 639 0.00% 65 653 0.00% 66 743 0.00% 67 846 0.00% 68 964 0.00% 69 1088 0.00% 70 1256 0.00% 71 1481 0.00% 72 1687 0.00% 73 1866 0.00% 74 2084 0.01% 75 2439 0.01% 76 2602 0.01% 77 2985 0.01% 78 3297 0.01% 79 3805 0.01% 80 4315 0.01% 81 4842 0.01% 82 5437 0.01% 83 6175 0.02% 84 6847 0.02% 85 7662 0.02% 86 8087 0.02% 87 9003 0.02% 88 9876 0.03% 89 10690 0.03% 90 11963 0.03% 91 13130 0.03% 92 14656 0.04% 93 16008 0.04% 94 17526 0.05% 95 18374 0.05% 96 19815 0.05% 97 20785 0.06% 98 21974 0.06% 99 23767 0.06% 100 24712 0.07% 101 27219 0.07% 102 29078 0.08% 103 31240 0.08% 104 32886 0.09% 105 34779 0.09% 106 36405 0.10% 107 36823 0.10% 108 38941 0.10% 109 40495 0.11% 110 41399 0.11% 111 44199 0.12% 112 46368 0.12% 113 48337 0.13% 114 51619 0.14% 115 53388 0.14% 116 54065 0.14% 117 56196 0.15% 118 56431 0.15% 119 58034 0.15% 120 59817 0.16% 121 61472 0.16% 122 63597 0.17% 123 67087 0.18% 124 71017 0.19% 125 71289 0.19% 126 74066 0.20% 127 74605 0.20% 128 75212 0.20% 129 76600 0.20% 130 76379 0.20% 131 78589 0.21% 132 82454 0.22% 133 84462 0.22% 134 86024 0.23% 135 90631 0.24% 136 91627 0.24% 137 91704 0.24% 138 94135 0.25% 139 94685 0.25% 140 95926 0.25% 141 97278 0.26% 142 99286 0.26% 143 100671 0.27% 144 104894 0.28% 145 108315 0.29% 146 108571 0.29% 147 110216 0.29% 148 110951 0.29% 149 109301 0.29% 150 111698 0.30% 151 33798155 89.77% 37648397 reads passed initial QC criterion=sequence-density sequence-density=0.95 sequence-density-rank=1 fanout-score=3.51 fanout-score-rank=11 prefix-density=1.04 prefix-fanout=3.2 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=43.20 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=3.4 sequence=ATATATTACTGTTCACCAAATGAATATACTCAATATCTTTATATATGAACAAAAACTTTTCATGCCCAGCAATTGCTTGGATGCAATGCGGTACTTAGGTACAAAGAGTGAAACATCAGAATAATTAAAGTGGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTTGGGTCGTAGTTCTCGGCATTCCGGTCAGTGCAACCTTCTGGGACGGGCAAATTACCTTGTTGTGCTCCTTTACCTCCTCCTATGCAGCTAGAGATGGTGTGTGTATGAAGAGTGTTCTAACCGTAGAAGGAACCAGTCTTCATGGCATCTGAGTTAGCATCTCCCAGAGCAGCCTCGCTCATGTACTTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCTTGGACGAGCATGTGGCCGTACTCCAGGAGCTTCTCGATTGTCATCTTTGGCTGCTCAAAGGACACCGGTCCATCCTTCGAGTTCACCAGCTTCTTGCCGATGTTC criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=3.75 fanout-score-rank=15 prefix-density=0.77 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=50.19 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=4.4 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR12666467 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 13:50:22 Started mapping on | Dec 07 13:50:22 Finished on | Dec 07 13:54:24 Mapping speed, Million of reads per hour | 560.06 Number of input reads | 37648397 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 35666503 Uniquely mapped reads % | 94.74% Average mapped length | 296.01 Number of splices: Total | 40881844 Number of splices: Annotated (sjdb) | 38640695 Number of splices: GT/AG | 40260644 Number of splices: GC/AG | 529940 Number of splices: AT/AC | 14546 Number of splices: Non-canonical | 76714 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.02% Deletion average length | 2.93 Insertion rate per base | 0.02% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 510600 % of reads mapped to multiple loci | 1.36% Number of reads mapped to too many loci | 42734 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.17% % of reads unmapped: other | 0.63% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1471294 1471294 1471294 N_multimapping 510600 510600 510600 N_noFeature 1127232 34438131 1368102 N_ambiguous 1136170 4680 149896 UnstrandedReadsAssigned:33403101 PositiveStrandReadsAssigned:1223692 NegativeStrandReadsAssigned:34148505 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12666467 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12666467-trimmed-pair1.fastq SRR12666467-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 37,648,397 reads, 34,558,862 reads pseudoaligned [quant] estimated average fragment length: 277.566 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,185 rounds 52973 SRR12666467.ke.tsv 35125 SRR12666467.se.tsv 88098 total ==> SRR12666467.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 660.162 0 0 PNS24247 1044 767.434 72.8708 3.61271 PNS24249 1928 1651.43 88.5227 2.03945 PNS24246 1044 767.434 72.8708 3.61271 PNS24248 1044 767.434 72.8708 3.61271 PNS24244 1471 1194.43 93.865 2.98994 PNS24243 293 94.8183 1 0.401262 KQK14069 1603 1326.43 1714.4 49.1754 KQK14071 474 230.046 62.3622 10.314 ==> SRR12666467.se.tsv <== BRADI_1g14170v3 2140 BRADI_1g53295v3 986 BRADI_1g59795v3 216 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 916 BRADI_1g74790v3 245 BRADI_1g09890v3 0 BRADI_1g77505v3 587 BRADI_1g48960v3 1 SRR12666467 completed mapping pipeline successfully