Starting /dee2/code/volunteer_pipeline.sh SRR12666600 current disk space = 1541296545792 free memory = 1602368564 SRR12666600 SRAfilesize 0f1eb191075e9d6ebd10dfebe29f5cdf SRR12666600.sra SRR12666600.sra file validated SRR12666600 is paired end SRR12666600 is conventional basespace SRR12666600 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666600_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4465 37.0 37.0 37.0 37.0 37.0 2 36.26025 37.0 37.0 37.0 37.0 37.0 3 36.403 37.0 37.0 37.0 37.0 37.0 4 36.5125 37.0 37.0 37.0 37.0 37.0 5 36.4765 37.0 37.0 37.0 37.0 37.0 6 36.506 37.0 37.0 37.0 37.0 37.0 7 36.4625 37.0 37.0 37.0 37.0 37.0 8 36.4935 37.0 37.0 37.0 37.0 37.0 9 36.4995 37.0 37.0 37.0 37.0 37.0 10-14 36.51 37.0 37.0 37.0 37.0 37.0 15-19 36.5609 37.0 37.0 37.0 37.0 37.0 20-24 36.5305 37.0 37.0 37.0 37.0 37.0 25-29 36.4388 37.0 37.0 37.0 37.0 37.0 30-34 36.4013 37.0 37.0 37.0 37.0 37.0 35-39 36.350300000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.3575 37.0 37.0 37.0 37.0 37.0 45-49 36.3085 37.0 37.0 37.0 37.0 37.0 50-54 36.3411 37.0 37.0 37.0 37.0 37.0 55-59 36.3213 37.0 37.0 37.0 37.0 37.0 60-64 36.302200000000006 37.0 37.0 37.0 37.0 37.0 65-69 36.3162 37.0 37.0 37.0 37.0 37.0 70-74 36.2573 37.0 37.0 37.0 37.0 37.0 75-79 36.248200000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.1995 37.0 37.0 37.0 37.0 37.0 85-89 36.1808 37.0 37.0 37.0 37.0 37.0 90-94 36.162699999999994 37.0 37.0 37.0 37.0 37.0 95-99 36.0657 37.0 37.0 37.0 37.0 37.0 100-104 36.1101 37.0 37.0 37.0 37.0 37.0 105-109 36.131299999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.997099999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.9836 37.0 37.0 37.0 37.0 37.0 120-124 35.903200000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.93059999999999 37.0 37.0 37.0 37.0 37.0 130-134 35.9245 37.0 37.0 37.0 37.0 37.0 135-139 35.964000000000006 37.0 37.0 37.0 37.0 37.0 140-144 35.7741 37.0 37.0 37.0 37.0 37.0 145-149 35.6594 37.0 37.0 37.0 37.0 37.0 150-151 35.479 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 2.0 22 2.0 23 0.0 24 0.0 25 2.0 26 6.0 27 6.0 28 12.0 29 18.0 30 29.0 31 52.0 32 74.0 33 86.0 34 140.0 35 296.0 36 2808.0 37 466.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.325 13.3 6.2 32.175 2 23.340846481342346 15.001252191334835 37.165038817931375 24.492862509391436 3 18.675 23.549999999999997 26.224999999999998 31.55 4 25.074999999999996 31.075000000000003 21.675 22.175 5 24.474999999999998 34.300000000000004 21.275 19.950000000000003 6 19.625 34.2 23.799999999999997 22.375 7 16.825000000000003 19.8 41.85 21.525 8 18.099999999999998 21.95 29.575000000000003 30.375000000000004 9 20.575 20.375 30.825000000000003 28.225 10-14 22.595000000000002 27.284999999999997 24.945 25.174999999999997 15-19 23.29 25.835 25.540000000000003 25.335 20-24 22.58 25.564999999999998 25.755 26.1 25-29 22.59 25.840000000000003 25.835 25.735000000000003 30-34 22.54 25.124999999999996 26.229999999999997 26.105 35-39 22.900000000000002 26.325 24.85 25.924999999999997 40-44 22.88 26.174999999999997 25.415 25.53 45-49 23.200000000000003 25.979999999999997 25.124999999999996 25.695 50-54 22.805 25.85 25.88 25.465 55-59 23.23 26.185000000000002 25.235000000000003 25.35 60-64 22.900000000000002 26.419999999999998 25.0 25.679999999999996 65-69 23.385 26.009999999999998 25.019999999999996 25.585 70-74 23.549999999999997 25.4 25.755 25.295 75-79 24.295 25.305 24.745 25.655 80-84 23.125 25.8 25.3 25.775 85-89 23.799999999999997 25.575 24.695 25.929999999999996 90-94 23.595 25.729999999999997 25.180000000000003 25.495 95-99 23.119999999999997 25.585 25.27 26.025 100-104 23.655 25.814999999999998 24.985 25.545 105-109 23.265 25.230000000000004 25.355 26.150000000000002 110-114 23.16 25.790000000000003 24.9 26.150000000000002 115-119 24.03 26.029999999999998 24.54 25.4 120-124 23.71 25.66 24.8 25.83 125-129 24.385 25.215 24.675 25.724999999999998 130-134 23.995 25.919999999999998 24.745 25.34 135-139 23.595 25.650000000000002 24.93 25.825 140-144 24.015 24.86 25.36 25.765 145-149 23.799999999999997 26.375 24.065 25.759999999999998 150-151 23.724999999999998 25.9875 23.724999999999998 26.5625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 2.0 27 4.0 28 4.5 29 3.5 30 6.0 31 6.0 32 11.5 33 22.5 34 30.5 35 35.5 36 42.0 37 56.0 38 83.0 39 119.5 40 139.0 41 160.0 42 183.0 43 194.0 44 199.5 45 204.0 46 206.0 47 186.0 48 176.0 49 184.5 50 177.0 51 151.0 52 137.0 53 132.0 54 120.0 55 115.0 56 99.0 57 88.0 58 80.5 59 70.0 60 63.5 61 55.5 62 48.5 63 44.0 64 50.0 65 47.0 66 45.0 67 45.0 68 37.5 69 33.0 70 25.5 71 17.5 72 16.0 73 15.5 74 8.0 75 5.0 76 6.0 77 4.0 78 2.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.17500000000000002 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.85 #Duplication Level Percentage of deduplicated Percentage of total 1 91.943385955362 84.45 2 7.321720195971693 13.450000000000001 3 0.6804572672836147 1.875 4 0.027218290691344585 0.1 5 0.027218290691344585 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCCTCGTTGAATTAAGACTTTCACTGTCTTTCCACTAATTTCAGTAGAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.3125 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.35 0.0 0.0 0.0 0.0 104-105 0.4375 0.0 0.0 0.0 0.0 106-107 0.6499999999999999 0.0 0.0 0.0 0.0 108-109 0.8875 0.0 0.0 0.0 0.0 110-111 1.0625 0.0 0.0 0.0 0.0 112-113 1.2374999999999998 0.0 0.0 0.0 0.0 114-115 1.5 0.0 0.0 0.0 0.0 116-117 1.65 0.0 0.0 0.0 0.0 118-119 1.9125 0.0 0.0 0.0 0.0 120-121 2.2249999999999996 0.0 0.0 0.0 0.0 122-123 2.45 0.0 0.0 0.0 0.0 124-125 2.6875 0.0 0.0 0.0 0.0 126-127 2.9375 0.0 0.0 0.0 0.0 128-129 3.2375 0.0 0.0 0.0 0.0 130-131 3.5375 0.0 0.0 0.0 0.0 132-133 3.8 0.0 0.0 0.0 0.0 134-135 4.1 0.0 0.0 0.0 0.0 136-137 4.6 0.0 0.0 0.0 0.0 138-139 5.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12666600 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666600_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0715 37.0 37.0 37.0 37.0 37.0 2 35.862 37.0 37.0 37.0 37.0 37.0 3 35.9365 37.0 37.0 37.0 37.0 37.0 4 36.1305 37.0 37.0 37.0 37.0 37.0 5 36.1345 37.0 37.0 37.0 37.0 37.0 6 36.108 37.0 37.0 37.0 37.0 37.0 7 35.994 37.0 37.0 37.0 37.0 37.0 8 36.209 37.0 37.0 37.0 37.0 37.0 9 36.1935 37.0 37.0 37.0 37.0 37.0 10-14 36.1793 37.0 37.0 37.0 37.0 37.0 15-19 36.130199999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.1575 37.0 37.0 37.0 37.0 37.0 25-29 36.0863 37.0 37.0 37.0 37.0 37.0 30-34 36.04430000000001 37.0 37.0 37.0 37.0 37.0 35-39 35.9481 37.0 37.0 37.0 37.0 37.0 40-44 35.977199999999996 37.0 37.0 37.0 37.0 37.0 45-49 35.9559 37.0 37.0 37.0 37.0 37.0 50-54 35.9097 37.0 37.0 37.0 37.0 37.0 55-59 35.951 37.0 37.0 37.0 37.0 37.0 60-64 35.8369 37.0 37.0 37.0 37.0 37.0 65-69 35.90220000000001 37.0 37.0 37.0 37.0 37.0 70-74 35.84760000000001 37.0 37.0 37.0 37.0 37.0 75-79 35.8483 37.0 37.0 37.0 37.0 37.0 80-84 35.824200000000005 37.0 37.0 37.0 37.0 37.0 85-89 35.7998 37.0 37.0 37.0 37.0 37.0 90-94 35.7536 37.0 37.0 37.0 37.0 37.0 95-99 35.7222 37.0 37.0 37.0 37.0 37.0 100-104 35.7346 37.0 37.0 37.0 37.0 37.0 105-109 35.775099999999995 37.0 37.0 37.0 37.0 37.0 110-114 35.6259 37.0 37.0 37.0 37.0 37.0 115-119 35.67470000000001 37.0 37.0 37.0 37.0 37.0 120-124 35.6837 37.0 37.0 37.0 37.0 37.0 125-129 35.6228 37.0 37.0 37.0 37.0 37.0 130-134 35.5515 37.0 37.0 37.0 37.0 37.0 135-139 35.460300000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.3892 37.0 37.0 37.0 37.0 37.0 145-149 35.396100000000004 37.0 37.0 37.0 37.0 37.0 150-151 34.917 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 6.0 15 8.0 16 0.0 17 1.0 18 4.0 19 0.0 20 2.0 21 4.0 22 7.0 23 9.0 24 6.0 25 8.0 26 8.0 27 15.0 28 19.0 29 17.0 30 37.0 31 38.0 32 61.0 33 112.0 34 184.0 35 515.0 36 2544.0 37 392.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.800000000000004 16.525000000000002 7.5 29.175 2 26.625 20.974999999999998 31.6 20.8 3 22.6 23.0 29.275000000000002 25.124999999999996 4 27.075 32.25 18.5 22.175 5 27.750000000000004 33.550000000000004 18.3 20.4 6 21.575 36.1 19.25 23.075000000000003 7 21.224999999999998 16.05 38.224999999999994 24.5 8 21.7 19.75 25.900000000000002 32.65 9 24.65 20.349999999999998 26.025 28.975 10-14 26.484999999999996 25.44 23.03 25.045 15-19 26.090000000000003 24.9 24.065 24.945 20-24 25.840000000000003 24.805 24.19 25.165 25-29 25.525 24.9 24.099999999999998 25.474999999999998 30-34 25.985000000000003 25.174999999999997 24.21 24.63 35-39 25.480000000000004 24.725 24.595 25.2 40-44 26.185000000000002 25.105 23.86 24.85 45-49 26.045 24.545 24.23 25.180000000000003 50-54 26.63 24.834999999999997 24.265 24.27 55-59 26.395000000000003 24.525 24.18 24.9 60-64 25.615 25.424999999999997 24.884999999999998 24.075 65-69 25.8 25.97 23.825 24.404999999999998 70-74 26.584999999999997 24.975 24.33 24.11 75-79 26.26 24.73 24.8 24.21 80-84 26.465 25.069999999999997 24.575 23.89 85-89 25.94 25.779999999999998 24.645 23.635 90-94 26.22 25.369999999999997 24.55 23.86 95-99 26.045 26.14 23.98 23.835 100-104 26.6 25.215 24.83 23.355 105-109 26.46 25.019999999999996 24.84 23.68 110-114 26.395000000000003 25.124999999999996 24.635 23.845 115-119 26.36 25.395 25.040000000000003 23.205000000000002 120-124 26.575 25.515 24.945 22.965 125-129 26.44 25.2 24.404999999999998 23.955000000000002 130-134 27.034999999999997 25.825 24.215 22.925 135-139 27.12 26.340000000000003 24.45 22.09 140-144 27.800000000000004 25.435000000000002 24.69 22.075 145-149 27.245 26.029999999999998 24.12 22.605 150-151 27.575 25.35 23.9875 23.0875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.5 18 1.0 19 0.5 20 1.0 21 0.5 22 1.0 23 1.0 24 0.0 25 1.0 26 1.5 27 1.0 28 2.0 29 3.5 30 4.0 31 5.0 32 7.0 33 14.5 34 25.5 35 29.0 36 37.5 37 54.0 38 78.0 39 90.5 40 109.5 41 138.5 42 143.5 43 165.5 44 193.5 45 189.0 46 171.5 47 181.0 48 180.0 49 164.5 50 153.5 51 137.5 52 137.5 53 128.0 54 116.0 55 111.0 56 97.5 57 91.5 58 90.5 59 84.0 60 82.0 61 79.0 62 71.5 63 79.0 64 76.0 65 62.0 66 62.0 67 53.5 68 50.0 69 54.0 70 43.5 71 33.5 72 30.5 73 22.5 74 14.5 75 9.5 76 6.5 77 4.5 78 2.0 79 1.0 80 0.5 81 0.5 82 0.5 83 0.5 84 1.5 85 1.0 86 0.0 87 1.0 88 1.5 89 1.0 90 1.0 91 0.5 92 0.0 93 1.0 94 1.5 95 0.5 96 0.0 97 0.5 98 0.5 99 0.5 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.875 #Duplication Level Percentage of deduplicated Percentage of total 1 92.27210884353741 84.775 2 6.857142857142858 12.6 3 0.7619047619047619 2.1 4 0.05442176870748299 0.2 5 0.027210884353741496 0.125 6 0.0 0.0 7 0.0 0.0 8 0.027210884353741496 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 8 0.2 No Hit GTCAACTTGTAAAAATGATTACAGTGAATTCCTGGAATCCATCATTGAGG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.30000000000000004 0.0 0.0 0.0 0.0 96-97 0.3875 0.0 0.0 0.0 0.0 98-99 0.425 0.0 0.0 0.0 0.0 100-101 0.425 0.0 0.0 0.0 0.0 102-103 0.4375 0.0 0.0 0.0 0.0 104-105 0.525 0.0 0.0 0.0 0.0 106-107 0.7250000000000001 0.0 0.0 0.0 0.0 108-109 0.9624999999999999 0.0 0.0 0.0 0.0 110-111 1.1375000000000002 0.0 0.0 0.0 0.0 112-113 1.325 0.0 0.0 0.0 0.0 114-115 1.6 0.0 0.0 0.0 0.0 116-117 1.75 0.0 0.0 0.0 0.0 118-119 2.0 0.0 0.0 0.0 0.0 120-121 2.3 0.0 0.0 0.0 0.0 122-123 2.5250000000000004 0.0 0.0 0.0 0.0 124-125 2.7750000000000004 0.0 0.0 0.0 0.0 126-127 3.0375 0.0 0.0 0.0 0.0 128-129 3.35 0.0 0.0 0.0 0.0 130-131 3.6625 0.0 0.0 0.0 0.0 132-133 3.925 0.0 0.0 0.0 0.0 134-135 4.25 0.0 0.0 0.0 0.0 136-137 4.7375 0.0 0.0 0.0 0.0 138-139 5.137499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGGAGGC 10 0.006830828 145.0 1 >>END_MODULE Read 1991037 spots for SRR12666600.sra Written 1991037 spots for SRR12666600.sra Read 1991037 spots for SRR12666600.sra Written 1991037 spots for SRR12666600.sra Read 1991037 spots for SRR12666600.sra Written 1991037 spots for SRR12666600.sra Read 1991037 spots for SRR12666600.sra Written 1991037 spots for SRR12666600.sra Read 1991037 spots for SRR12666600.sra Written 1991037 spots for SRR12666600.sra Read 1991037 spots for SRR12666600.sra Written 1991037 spots for SRR12666600.sra Read 1991037 spots for SRR12666600.sra Written 1991037 spots for SRR12666600.sra Read 1991037 spots for SRR12666600.sra Written 1991037 spots for SRR12666600.sra Read 1991037 spots for SRR12666600.sra Written 1991037 spots for SRR12666600.sra Read 1991037 spots for SRR12666600.sra Written 1991037 spots for SRR12666600.sra Read 1991037 spots for SRR12666600.sra Written 1991037 spots for SRR12666600.sra Read 1991037 spots for SRR12666600.sra Written 1991037 spots for SRR12666600.sra Read 1991037 spots for SRR12666600.sra Written 1991037 spots for SRR12666600.sra Read 1991037 spots for SRR12666600.sra Written 1991037 spots for SRR12666600.sra Read 1991037 spots for SRR12666600.sra Written 1991037 spots for SRR12666600.sra Read 1991037 spots for SRR12666600.sra Written 1991037 spots for SRR12666600.sra Read 1991037 spots for SRR12666600.sra Written 1991037 spots for SRR12666600.sra Read 1991037 spots for SRR12666600.sra Written 1991037 spots for SRR12666600.sra Read 1991047 spots for SRR12666600.sra Written 1991047 spots for SRR12666600.sra Read 1991037 spots for SRR12666600.sra Written 1991037 spots for SRR12666600.sra SRR ids: ['SRR12666600.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ts9c7b83 SRR12666600.sra spots: 39820750 blocks: [[1, 1991037], [1991038, 3982074], [3982075, 5973111], [5973112, 7964148], [7964149, 9955185], [9955186, 11946222], [11946223, 13937259], [13937260, 15928296], [15928297, 17919333], [17919334, 19910370], [19910371, 21901407], [21901408, 23892444], [23892445, 25883481], [25883482, 27874518], [27874519, 29865555], [29865556, 31856592], [31856593, 33847629], [33847630, 35838666], [35838667, 37829703], [37829704, 39820750]] SRR12666600 file size 13511132 SRR12666600 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12666600 SRR12666600_1.fastq SRR12666600_2.fastq Input file: SRR12666600_1.fastq Paired file: SRR12666600_2.fastq trimmed: SRR12666600-trimmed-pair1.fastq, SRR12666600-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 17:36:15 2024 >> started Sat Dec 7 17:37:10 2024 >> done (55.781s) 39820750 read pairs processed; of these: 96 ( 0.00%) short read pairs filtered out after trimming by size control 3875 ( 0.01%) empty read pairs filtered out after trimming by size control 39816779 (99.99%) read pairs available; of these: 3389669 ( 8.51%) trimmed read pairs available after processing 36427110 (91.49%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 14 0.00% 20 8 0.00% 21 11 0.00% 22 18 0.00% 23 23 0.00% 24 22 0.00% 25 23 0.00% 26 31 0.00% 27 34 0.00% 28 21 0.00% 29 29 0.00% 30 29 0.00% 31 24 0.00% 32 45 0.00% 33 36 0.00% 34 32 0.00% 35 55 0.00% 36 58 0.00% 37 52 0.00% 38 58 0.00% 39 51 0.00% 40 57 0.00% 41 53 0.00% 42 78 0.00% 43 74 0.00% 44 65 0.00% 45 87 0.00% 46 96 0.00% 47 93 0.00% 48 126 0.00% 49 116 0.00% 50 135 0.00% 51 130 0.00% 52 130 0.00% 53 141 0.00% 54 151 0.00% 55 174 0.00% 56 184 0.00% 57 213 0.00% 58 238 0.00% 59 265 0.00% 60 281 0.00% 61 387 0.00% 62 399 0.00% 63 444 0.00% 64 427 0.00% 65 472 0.00% 66 582 0.00% 67 655 0.00% 68 731 0.00% 69 800 0.00% 70 940 0.00% 71 1131 0.00% 72 1298 0.00% 73 1500 0.00% 74 1598 0.00% 75 1804 0.00% 76 2078 0.01% 77 2251 0.01% 78 2651 0.01% 79 3029 0.01% 80 3316 0.01% 81 3780 0.01% 82 4387 0.01% 83 4930 0.01% 84 5389 0.01% 85 6043 0.02% 86 6568 0.02% 87 7237 0.02% 88 7851 0.02% 89 8616 0.02% 90 9544 0.02% 91 10619 0.03% 92 11829 0.03% 93 12858 0.03% 94 14123 0.04% 95 15095 0.04% 96 15922 0.04% 97 16952 0.04% 98 17940 0.05% 99 19381 0.05% 100 20998 0.05% 101 22400 0.06% 102 23735 0.06% 103 25609 0.06% 104 26999 0.07% 105 28806 0.07% 106 30077 0.08% 107 30892 0.08% 108 32156 0.08% 109 33864 0.09% 110 35112 0.09% 111 36823 0.09% 112 39168 0.10% 113 40652 0.10% 114 43062 0.11% 115 44719 0.11% 116 45614 0.11% 117 47716 0.12% 118 48426 0.12% 119 50258 0.13% 120 51427 0.13% 121 53310 0.13% 122 55243 0.14% 123 57928 0.15% 124 60619 0.15% 125 62583 0.16% 126 63601 0.16% 127 64646 0.16% 128 65958 0.17% 129 67276 0.17% 130 68886 0.17% 131 70545 0.18% 132 73511 0.18% 133 76052 0.19% 134 77471 0.19% 135 80830 0.20% 136 81818 0.21% 137 83072 0.21% 138 85438 0.21% 139 85867 0.22% 140 86161 0.22% 141 88799 0.22% 142 91156 0.23% 143 92618 0.23% 144 96452 0.24% 145 98776 0.25% 146 100426 0.25% 147 101712 0.26% 148 103180 0.26% 149 103476 0.26% 150 104623 0.26% 151 36427110 91.49% 39816779 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=5.21 fanout-score-rank=27 prefix-density=0.21 prefix-fanout=4.0 sequence=GTGATGGTCTTGCC criterion=fanout-score sequence-density=0.07 sequence-density-rank=15 fanout-score=461.43 fanout-score-rank=1 prefix-density=0.89 prefix-fanout=36.0 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.38 fanout-score-rank=30 prefix-density=0.28 prefix-fanout=2.3 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=28 fanout-score=593.37 fanout-score-rank=1 prefix-density=0.81 prefix-fanout=20.0 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR12666600 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 17:37:58 Started mapping on | Dec 07 17:37:58 Finished on | Dec 07 17:41:12 Mapping speed, Million of reads per hour | 738.87 Number of input reads | 39816779 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 38151766 Uniquely mapped reads % | 95.82% Average mapped length | 297.41 Number of splices: Total | 40377085 Number of splices: Annotated (sjdb) | 37883455 Number of splices: GT/AG | 39861977 Number of splices: GC/AG | 446437 Number of splices: AT/AC | 29339 Number of splices: Non-canonical | 39332 Mismatch rate per base, % | 0.12% Deletion rate per base | 0.00% Deletion average length | 1.48 Insertion rate per base | 0.00% Insertion average length | 1.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 437663 % of reads mapped to multiple loci | 1.10% Number of reads mapped to too many loci | 66651 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.04% % of reads unmapped: other | 0.87% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1227350 1227350 1227350 N_multimapping 437663 437663 437663 N_noFeature 1246899 37196762 1564021 N_ambiguous 748925 5108 112218 UnstrandedReadsAssigned:36155942 PositiveStrandReadsAssigned:949896 NegativeStrandReadsAssigned:36475527 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12666600 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12666600-trimmed-pair1.fastq SRR12666600-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 39,816,779 reads, 37,008,732 reads pseudoaligned [quant] estimated average fragment length: 288.707 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,191 rounds 52973 SRR12666600.ke.tsv 35125 SRR12666600.se.tsv 88098 total ==> SRR12666600.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 649.343 0 0 PNS24247 1044 756.293 167.216 9.16547 PNS24249 1928 1640.29 178.576 4.51306 PNS24246 1044 756.293 167.216 9.16547 PNS24248 1044 756.293 167.216 9.16547 PNS24244 1471 1183.29 266.777 9.34598 PNS24243 293 91.1623 0 0 KQK14069 1603 1315.29 4115.7 129.715 KQK14071 474 224.472 60.384 11.1513 ==> SRR12666600.se.tsv <== BRADI_1g14170v3 4609 BRADI_1g53295v3 211 BRADI_1g59795v3 599 BRADI_1g07683v3 0 BRADI_1g00485v3 88 BRADI_1g20270v3 2338 BRADI_1g74790v3 66 BRADI_1g09890v3 0 BRADI_1g77505v3 182 BRADI_1g48960v3 0 SRR12666600 completed mapping pipeline successfully