Starting /dee2/code/volunteer_pipeline.sh SRR12666602 current disk space = 1541156868096 free memory = 1470101568 SRR12666602 SRAfilesize c1e708192a4f22dec24026bec6dbd6ef SRR12666602.sra SRR12666602.sra file validated SRR12666602 is paired end SRR12666602 is conventional basespace SRR12666602 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666602_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5155 37.0 37.0 37.0 37.0 37.0 2 36.1825 37.0 37.0 37.0 37.0 37.0 3 36.4895 37.0 37.0 37.0 37.0 37.0 4 36.4355 37.0 37.0 37.0 37.0 37.0 5 36.4795 37.0 37.0 37.0 37.0 37.0 6 36.55 37.0 37.0 37.0 37.0 37.0 7 36.4725 37.0 37.0 37.0 37.0 37.0 8 36.5945 37.0 37.0 37.0 37.0 37.0 9 36.4645 37.0 37.0 37.0 37.0 37.0 10-14 36.522 37.0 37.0 37.0 37.0 37.0 15-19 36.511900000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.4918 37.0 37.0 37.0 37.0 37.0 25-29 36.4288 37.0 37.0 37.0 37.0 37.0 30-34 36.3951 37.0 37.0 37.0 37.0 37.0 35-39 36.396 37.0 37.0 37.0 37.0 37.0 40-44 36.367200000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.2782 37.0 37.0 37.0 37.0 37.0 50-54 36.318599999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.291000000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.3086 37.0 37.0 37.0 37.0 37.0 65-69 36.275200000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.229099999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.20290000000001 37.0 37.0 37.0 37.0 37.0 80-84 36.1466 37.0 37.0 37.0 37.0 37.0 85-89 36.2198 37.0 37.0 37.0 37.0 37.0 90-94 36.2241 37.0 37.0 37.0 37.0 37.0 95-99 36.0885 37.0 37.0 37.0 37.0 37.0 100-104 36.1365 37.0 37.0 37.0 37.0 37.0 105-109 36.1425 37.0 37.0 37.0 37.0 37.0 110-114 36.0356 37.0 37.0 37.0 37.0 37.0 115-119 35.988 37.0 37.0 37.0 37.0 37.0 120-124 35.9972 37.0 37.0 37.0 37.0 37.0 125-129 35.929100000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.928399999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.9249 37.0 37.0 37.0 37.0 37.0 140-144 35.799899999999994 37.0 37.0 37.0 37.0 37.0 145-149 35.737700000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.397999999999996 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 1.0 22 2.0 23 0.0 24 1.0 25 4.0 26 3.0 27 14.0 28 16.0 29 19.0 30 33.0 31 44.0 32 54.0 33 80.0 34 149.0 35 294.0 36 2844.0 37 441.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 51.05 13.075000000000001 6.825 29.049999999999997 2 23.261630815407706 16.3831915957979 34.817408704352175 25.53776888444222 3 19.975 25.1 28.15 26.775 4 25.275 30.875000000000004 20.849999999999998 23.0 5 24.425 35.099999999999994 21.65 18.825 6 21.475 34.449999999999996 22.3 21.775 7 15.75 22.25 40.325 21.675 8 19.1 21.95 27.025 31.924999999999997 9 20.474999999999998 20.150000000000002 30.3 29.075 10-14 23.375 26.529999999999998 24.37 25.724999999999998 15-19 23.255 26.35 25.05 25.345000000000002 20-24 21.965 26.11 26.224999999999998 25.7 25-29 22.56 26.5 25.585 25.355 30-34 23.405 26.22 24.555 25.82 35-39 23.26 25.275 26.295 25.169999999999998 40-44 22.97 26.135 25.55 25.345000000000002 45-49 22.865 26.155 25.44 25.540000000000003 50-54 23.294999999999998 25.83 25.56 25.314999999999998 55-59 23.150000000000002 26.005 25.585 25.259999999999998 60-64 23.075000000000003 26.405 24.925 25.595000000000002 65-69 23.39 25.86 25.290000000000003 25.46 70-74 22.82 26.979999999999997 25.2 25.0 75-79 23.200000000000003 25.900000000000002 25.09 25.81 80-84 23.695 25.66 25.255 25.39 85-89 23.48 25.650000000000002 25.619999999999997 25.25 90-94 23.825 25.490000000000002 25.540000000000003 25.145 95-99 23.369999999999997 25.735000000000003 25.669999999999998 25.224999999999998 100-104 24.055 25.44 24.93 25.575 105-109 23.549999999999997 25.474999999999998 25.085 25.89 110-114 23.445 24.86 25.729999999999997 25.965 115-119 23.26 26.16 24.990000000000002 25.590000000000003 120-124 23.62 26.21 24.43 25.740000000000002 125-129 23.47 25.94 25.405 25.185000000000002 130-134 24.08 25.96 24.7 25.259999999999998 135-139 23.815 26.38 24.775 25.03 140-144 23.71 25.740000000000002 24.215 26.334999999999997 145-149 24.104999999999997 26.47 24.215 25.21 150-151 23.95 26.0 24.637500000000003 25.412499999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 1.0 26 0.5 27 2.5 28 3.5 29 3.5 30 7.5 31 12.5 32 16.0 33 24.0 34 34.0 35 40.0 36 51.5 37 61.5 38 87.5 39 111.0 40 120.0 41 144.0 42 160.0 43 178.5 44 187.5 45 194.0 46 214.0 47 211.0 48 197.0 49 180.0 50 186.0 51 199.0 52 158.0 53 119.0 54 120.0 55 113.5 56 92.5 57 79.0 58 71.5 59 67.0 60 57.0 61 63.5 62 69.0 63 59.5 64 53.0 65 41.5 66 41.0 67 36.0 68 30.5 69 29.0 70 21.0 71 14.5 72 9.5 73 6.0 74 5.5 75 3.5 76 2.0 77 3.0 78 3.0 79 1.5 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.5 #Duplication Level Percentage of deduplicated Percentage of total 1 92.48648648648648 85.55 2 6.945945945945946 12.85 3 0.5405405405405406 1.5 4 0.02702702702702703 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.30000000000000004 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.7125 0.0 0.0 0.0 0.0 102-103 0.9 0.0 0.0 0.0 0.0 104-105 1.025 0.0 0.0 0.0 0.0 106-107 1.3125 0.0 0.0 0.0 0.0 108-109 1.55 0.0 0.0 0.0 0.0 110-111 1.7375 0.0 0.0 0.0 0.0 112-113 1.9625 0.0 0.0 0.0 0.0 114-115 2.325 0.0 0.0 0.0 0.0 116-117 2.7125 0.0 0.0 0.0 0.0 118-119 3.05 0.0 0.0 0.0 0.0 120-121 3.2125 0.0 0.0 0.0 0.0 122-123 3.5 0.0 0.0 0.0 0.0 124-125 3.9000000000000004 0.0 0.0 0.0 0.0 126-127 4.3625 0.0 0.0 0.0 0.0 128-129 4.7625 0.0 0.0 0.0 0.0 130-131 5.325 0.0 0.0 0.0 0.0 132-133 5.6625 0.0 0.0 0.0 0.0 134-135 6.1875 0.0 0.0 0.0 0.0 136-137 6.675000000000001 0.0 0.0 0.0 0.0 138-139 7.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCCTTC 10 0.006830828 145.0 7 GTTAACT 10 0.006830828 145.0 1 >>END_MODULE SRR12666602 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666602_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.9825 37.0 37.0 37.0 37.0 37.0 2 36.053 37.0 37.0 37.0 37.0 37.0 3 36.0265 37.0 37.0 37.0 37.0 37.0 4 36.3265 37.0 37.0 37.0 37.0 37.0 5 36.201 37.0 37.0 37.0 37.0 37.0 6 36.1855 37.0 37.0 37.0 37.0 37.0 7 36.1955 37.0 37.0 37.0 37.0 37.0 8 36.305 37.0 37.0 37.0 37.0 37.0 9 36.39 37.0 37.0 37.0 37.0 37.0 10-14 36.2742 37.0 37.0 37.0 37.0 37.0 15-19 36.1429 37.0 37.0 37.0 37.0 37.0 20-24 36.1487 37.0 37.0 37.0 37.0 37.0 25-29 36.087900000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.0656 37.0 37.0 37.0 37.0 37.0 35-39 36.08140000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.0192 37.0 37.0 37.0 37.0 37.0 45-49 35.96040000000001 37.0 37.0 37.0 37.0 37.0 50-54 35.939699999999995 37.0 37.0 37.0 37.0 37.0 55-59 35.9583 37.0 37.0 37.0 37.0 37.0 60-64 35.8289 37.0 37.0 37.0 37.0 37.0 65-69 35.918400000000005 37.0 37.0 37.0 37.0 37.0 70-74 35.8375 37.0 37.0 37.0 37.0 37.0 75-79 35.8655 37.0 37.0 37.0 37.0 37.0 80-84 35.8534 37.0 37.0 37.0 37.0 37.0 85-89 35.8012 37.0 37.0 37.0 37.0 37.0 90-94 35.7881 37.0 37.0 37.0 37.0 37.0 95-99 35.757999999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.765699999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.747 37.0 37.0 37.0 37.0 37.0 110-114 35.7068 37.0 37.0 37.0 37.0 37.0 115-119 35.6315 37.0 37.0 37.0 37.0 37.0 120-124 35.6444 37.0 37.0 37.0 37.0 37.0 125-129 35.68429999999999 37.0 37.0 37.0 37.0 37.0 130-134 35.6117 37.0 37.0 37.0 37.0 37.0 135-139 35.455499999999994 37.0 37.0 37.0 37.0 37.0 140-144 35.4412 37.0 37.0 37.0 37.0 37.0 145-149 35.3251 37.0 37.0 37.0 34.6 37.0 150-151 34.931 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 2.0 13 4.0 14 8.0 15 6.0 16 2.0 17 5.0 18 2.0 19 5.0 20 2.0 21 0.0 22 6.0 23 11.0 24 11.0 25 15.0 26 10.0 27 5.0 28 14.0 29 23.0 30 31.0 31 41.0 32 54.0 33 79.0 34 148.0 35 426.0 36 2613.0 37 476.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 51.1 17.65 7.85 23.400000000000002 2 28.95 19.0 28.525 23.525 3 24.8 21.9 29.475 23.825 4 26.775 31.624999999999996 19.425 22.175 5 26.674999999999997 34.150000000000006 18.425 20.75 6 22.2 34.325 19.8 23.674999999999997 7 21.85 17.7 35.225 25.224999999999998 8 21.85 21.7 23.35 33.1 9 24.15 20.175 25.724999999999998 29.95 10-14 25.955000000000002 25.03 23.125 25.89 15-19 25.795 24.88 23.93 25.395 20-24 25.865 25.319999999999997 24.085 24.73 25-29 25.5 25.1 24.43 24.97 30-34 25.495 24.815 24.635 25.055 35-39 26.165 25.2 24.095 24.54 40-44 25.645 25.61 24.14 24.605 45-49 25.465 25.005 24.62 24.91 50-54 25.990000000000002 25.169999999999998 24.635 24.205 55-59 26.355 24.91 24.779999999999998 23.955000000000002 60-64 25.64 24.905 25.180000000000003 24.275 65-69 26.11 25.785000000000004 24.48 23.625 70-74 26.240000000000002 25.580000000000002 24.63 23.549999999999997 75-79 26.345000000000002 25.155 24.560000000000002 23.94 80-84 26.334999999999997 25.515 25.080000000000002 23.07 85-89 26.57 25.455 24.12 23.855 90-94 26.240000000000002 25.590000000000003 24.3 23.87 95-99 25.724999999999998 25.735000000000003 24.715 23.825 100-104 26.125 25.955000000000002 24.245 23.674999999999997 105-109 26.41 25.395 25.145 23.05 110-114 26.229999999999997 25.759999999999998 24.46 23.549999999999997 115-119 26.655 25.75 24.415 23.18 120-124 27.215 25.650000000000002 24.29 22.845 125-129 26.865 25.924999999999997 23.965 23.244999999999997 130-134 26.55 26.169999999999998 24.285 22.994999999999997 135-139 27.095000000000002 25.869999999999997 24.060000000000002 22.975 140-144 26.945000000000004 25.8 24.94 22.314999999999998 145-149 28.494999999999997 25.369999999999997 24.23 21.905 150-151 27.575 26.0375 23.275000000000002 23.1125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 1.5 17 2.0 18 1.0 19 0.0 20 0.0 21 2.0 22 2.5 23 2.0 24 1.5 25 0.5 26 1.0 27 2.0 28 2.5 29 3.0 30 5.0 31 9.5 32 11.0 33 17.5 34 22.5 35 30.5 36 41.5 37 51.5 38 63.5 39 78.5 40 92.5 41 105.0 42 144.5 43 169.5 44 177.5 45 187.0 46 192.5 47 186.0 48 182.0 49 184.5 50 169.0 51 149.0 52 140.5 53 137.5 54 130.0 55 117.5 56 100.0 57 93.5 58 100.0 59 102.0 60 91.5 61 78.5 62 63.0 63 60.5 64 72.0 65 68.0 66 59.0 67 53.5 68 48.5 69 51.0 70 40.0 71 23.5 72 21.5 73 15.5 74 6.0 75 5.0 76 5.0 77 3.0 78 1.5 79 2.0 80 2.5 81 2.5 82 1.5 83 0.5 84 0.5 85 0.5 86 0.5 87 0.5 88 0.5 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 1.0 97 0.5 98 0.5 99 0.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.55 #Duplication Level Percentage of deduplicated Percentage of total 1 92.62560777957862 85.725 2 6.780118854673149 12.55 3 0.5672609400324149 1.575 4 0.0 0.0 5 0.0 0.0 6 0.02701242571582928 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.4625 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.7625 0.0 0.0 0.0 0.0 102-103 0.95 0.0 0.0 0.0 0.0 104-105 1.0750000000000002 0.0 0.0 0.0 0.0 106-107 1.3624999999999998 0.0 0.0 0.0 0.0 108-109 1.6 0.0 0.0 0.0 0.0 110-111 1.8125 0.0 0.0 0.0 0.0 112-113 2.0375 0.0 0.0 0.0 0.0 114-115 2.4 0.0 0.0 0.0 0.0 116-117 2.7875 0.0 0.0 0.0 0.0 118-119 3.0999999999999996 0.0 0.0 0.0 0.0 120-121 3.2625 0.0 0.0 0.0 0.0 122-123 3.55 0.0 0.0 0.0 0.0 124-125 3.9875 0.0 0.0 0.0 0.0 126-127 4.4875 0.0 0.0 0.0 0.0 128-129 4.9 0.0 0.0 0.0 0.0 130-131 5.475 0.0 0.0 0.0 0.0 132-133 5.8125 0.0 0.0 0.0 0.0 134-135 6.3375 0.0 0.0 0.0 0.0 136-137 6.85 0.0 0.0 0.0 0.0 138-139 7.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1965587 spots for SRR12666602.sra Written 1965587 spots for SRR12666602.sra Read 1965587 spots for SRR12666602.sra Written 1965587 spots for SRR12666602.sra Read 1965587 spots for SRR12666602.sra Written 1965587 spots for SRR12666602.sra Read 1965587 spots for SRR12666602.sra Written 1965587 spots for SRR12666602.sra Read 1965587 spots for SRR12666602.sra Written 1965587 spots for SRR12666602.sra Read 1965587 spots for SRR12666602.sra Written 1965587 spots for SRR12666602.sra Read 1965587 spots for SRR12666602.sra Written 1965587 spots for SRR12666602.sra Read 1965587 spots for SRR12666602.sra Written 1965587 spots for SRR12666602.sra Read 1965587 spots for SRR12666602.sra Written 1965587 spots for SRR12666602.sra Read 1965587 spots for SRR12666602.sra Written 1965587 spots for SRR12666602.sra Read 1965587 spots for SRR12666602.sra Written 1965587 spots for SRR12666602.sra Read 1965587 spots for SRR12666602.sra Written 1965587 spots for SRR12666602.sra Read 1965599 spots for SRR12666602.sra Written 1965599 spots for SRR12666602.sra Read 1965587 spots for SRR12666602.sra Written 1965587 spots for SRR12666602.sra Read 1965587 spots for SRR12666602.sra Written 1965587 spots for SRR12666602.sra Read 1965587 spots for SRR12666602.sra Written 1965587 spots for SRR12666602.sra Read 1965587 spots for SRR12666602.sra Written 1965587 spots for SRR12666602.sra Read 1965587 spots for SRR12666602.sra Written 1965587 spots for SRR12666602.sra Read 1965587 spots for SRR12666602.sra Written 1965587 spots for SRR12666602.sra Read 1965587 spots for SRR12666602.sra Written 1965587 spots for SRR12666602.sra SRR ids: ['SRR12666602.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_m64fjfxp SRR12666602.sra spots: 39311752 blocks: [[1, 1965587], [1965588, 3931174], [3931175, 5896761], [5896762, 7862348], [7862349, 9827935], [9827936, 11793522], [11793523, 13759109], [13759110, 15724696], [15724697, 17690283], [17690284, 19655870], [19655871, 21621457], [21621458, 23587044], [23587045, 25552631], [25552632, 27518218], [27518219, 29483805], [29483806, 31449392], [31449393, 33414979], [33414980, 35380566], [35380567, 37346153], [37346154, 39311752]] SRR12666602 file size 13338152 SRR12666602 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12666602 SRR12666602_1.fastq SRR12666602_2.fastq Input file: SRR12666602_1.fastq Paired file: SRR12666602_2.fastq trimmed: SRR12666602-trimmed-pair1.fastq, SRR12666602-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 17:46:13 2024 >> started Sat Dec 7 17:51:05 2024 >> done (291.730s) 39311752 read pairs processed; of these: 118 ( 0.00%) short read pairs filtered out after trimming by size control 21393 ( 0.05%) empty read pairs filtered out after trimming by size control 39290241 (99.95%) read pairs available; of these: 3924102 ( 9.99%) trimmed read pairs available after processing 35366139 (90.01%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 16 0.00% 20 13 0.00% 21 27 0.00% 22 19 0.00% 23 18 0.00% 24 19 0.00% 25 27 0.00% 26 34 0.00% 27 50 0.00% 28 37 0.00% 29 43 0.00% 30 44 0.00% 31 59 0.00% 32 66 0.00% 33 41 0.00% 34 46 0.00% 35 57 0.00% 36 76 0.00% 37 66 0.00% 38 68 0.00% 39 71 0.00% 40 74 0.00% 41 85 0.00% 42 91 0.00% 43 78 0.00% 44 77 0.00% 45 117 0.00% 46 124 0.00% 47 124 0.00% 48 101 0.00% 49 162 0.00% 50 179 0.00% 51 176 0.00% 52 192 0.00% 53 209 0.00% 54 206 0.00% 55 232 0.00% 56 282 0.00% 57 246 0.00% 58 322 0.00% 59 390 0.00% 60 414 0.00% 61 510 0.00% 62 561 0.00% 63 624 0.00% 64 645 0.00% 65 730 0.00% 66 817 0.00% 67 808 0.00% 68 1054 0.00% 69 1168 0.00% 70 1367 0.00% 71 1590 0.00% 72 1816 0.00% 73 2115 0.01% 74 2373 0.01% 75 2603 0.01% 76 2716 0.01% 77 3114 0.01% 78 3278 0.01% 79 3864 0.01% 80 4431 0.01% 81 5207 0.01% 82 5977 0.02% 83 6651 0.02% 84 7485 0.02% 85 8055 0.02% 86 8711 0.02% 87 9346 0.02% 88 10111 0.03% 89 10966 0.03% 90 12450 0.03% 91 13861 0.04% 92 15327 0.04% 93 17086 0.04% 94 18514 0.05% 95 19291 0.05% 96 20724 0.05% 97 21467 0.05% 98 22297 0.06% 99 23827 0.06% 100 25818 0.07% 101 27446 0.07% 102 30177 0.08% 103 32001 0.08% 104 33958 0.09% 105 36198 0.09% 106 36926 0.09% 107 37840 0.10% 108 39580 0.10% 109 40291 0.10% 110 42170 0.11% 111 44835 0.11% 112 46964 0.12% 113 49684 0.13% 114 52676 0.13% 115 54399 0.14% 116 55541 0.14% 117 56858 0.14% 118 56612 0.14% 119 58101 0.15% 120 60372 0.15% 121 62011 0.16% 122 64601 0.16% 123 68622 0.17% 124 71395 0.18% 125 73149 0.19% 126 75301 0.19% 127 75381 0.19% 128 75586 0.19% 129 77837 0.20% 130 77875 0.20% 131 80331 0.20% 132 83956 0.21% 133 85618 0.22% 134 89094 0.23% 135 93210 0.24% 136 94358 0.24% 137 95188 0.24% 138 95842 0.24% 139 94858 0.24% 140 95760 0.24% 141 97763 0.25% 142 99830 0.25% 143 102465 0.26% 144 106369 0.27% 145 109288 0.28% 146 111817 0.28% 147 113286 0.29% 148 111854 0.28% 149 111553 0.28% 150 113133 0.29% 151 35366139 90.01% 39290241 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=4.68 fanout-score-rank=23 prefix-density=0.24 prefix-fanout=3.8 sequence=GTGATGGTCTTGCC criterion=fanout-score sequence-density=0.08 sequence-density-rank=13 fanout-score=109.63 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=16.7 sequence=TCCTCCTTGCCA criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.26 fanout-score-rank=31 prefix-density=0.39 prefix-fanout=2.2 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.06 sequence-density-rank=24 fanout-score=259.89 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=20.2 sequence=CCGCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR12666602 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 17:57:26 Started mapping on | Dec 07 17:57:27 Finished on | Dec 07 18:24:24 Mapping speed, Million of reads per hour | 87.47 Number of input reads | 39290241 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 37253270 Uniquely mapped reads % | 94.82% Average mapped length | 296.50 Number of splices: Total | 39932661 Number of splices: Annotated (sjdb) | 37467754 Number of splices: GT/AG | 39393678 Number of splices: GC/AG | 471561 Number of splices: AT/AC | 26984 Number of splices: Non-canonical | 40438 Mismatch rate per base, % | 0.12% Deletion rate per base | 0.00% Deletion average length | 1.45 Insertion rate per base | 0.00% Insertion average length | 1.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 459325 % of reads mapped to multiple loci | 1.17% Number of reads mapped to too many loci | 76192 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.74% % of reads unmapped: other | 1.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1577646 1577646 1577646 N_multimapping 459325 459325 459325 N_noFeature 1244033 36314952 1551428 N_ambiguous 728520 5205 99468 UnstrandedReadsAssigned:35280717 PositiveStrandReadsAssigned:933113 NegativeStrandReadsAssigned:35602374 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12666602 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12666602-trimmed-pair1.fastq SRR12666602-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 39,290,241 reads, 36,233,881 reads pseudoaligned [quant] estimated average fragment length: 284.761 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,253 rounds 52973 SRR12666602.ke.tsv 35125 SRR12666602.se.tsv 88098 total ==> SRR12666602.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 653.383 0 0 PNS24247 1044 760.239 157.555 8.77059 PNS24249 1928 1644.24 151.229 3.89239 PNS24246 1044 760.239 157.555 8.77059 PNS24248 1044 760.239 157.555 8.77059 PNS24244 1471 1187.24 322.106 11.4817 PNS24243 293 94.4813 2 0.89584 KQK14069 1603 1319.24 10413.3 334.051 KQK14071 474 228.144 154.746 28.705 ==> SRR12666602.se.tsv <== BRADI_1g14170v3 11440 BRADI_1g53295v3 211 BRADI_1g59795v3 696 BRADI_1g07683v3 0 BRADI_1g00485v3 146 BRADI_1g20270v3 2350 BRADI_1g74790v3 87 BRADI_1g09890v3 0 BRADI_1g77505v3 238 BRADI_1g48960v3 0 SRR12666602 completed mapping pipeline successfully