Starting /dee2/code/volunteer_pipeline.sh SRR12666603 current disk space = 1541176827904 free memory = 1506340596 SRR12666603 SRAfilesize 78a4470dca19bf375ed582f610044a6b SRR12666603.sra SRR12666603.sra file validated SRR12666603 is paired end SRR12666603 is conventional basespace SRR12666603 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666603_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3615 37.0 37.0 37.0 37.0 37.0 2 36.246 37.0 37.0 37.0 37.0 37.0 3 36.494 37.0 37.0 37.0 37.0 37.0 4 36.565 37.0 37.0 37.0 37.0 37.0 5 36.5515 37.0 37.0 37.0 37.0 37.0 6 36.508 37.0 37.0 37.0 37.0 37.0 7 36.5005 37.0 37.0 37.0 37.0 37.0 8 36.54 37.0 37.0 37.0 37.0 37.0 9 36.636 37.0 37.0 37.0 37.0 37.0 10-14 36.5705 37.0 37.0 37.0 37.0 37.0 15-19 36.513400000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.5124 37.0 37.0 37.0 37.0 37.0 25-29 36.444100000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.4208 37.0 37.0 37.0 37.0 37.0 35-39 36.4245 37.0 37.0 37.0 37.0 37.0 40-44 36.38459999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.355000000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.3359 37.0 37.0 37.0 37.0 37.0 55-59 36.352 37.0 37.0 37.0 37.0 37.0 60-64 36.2932 37.0 37.0 37.0 37.0 37.0 65-69 36.2897 37.0 37.0 37.0 37.0 37.0 70-74 36.2635 37.0 37.0 37.0 37.0 37.0 75-79 36.2688 37.0 37.0 37.0 37.0 37.0 80-84 36.2248 37.0 37.0 37.0 37.0 37.0 85-89 36.179899999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.1583 37.0 37.0 37.0 37.0 37.0 95-99 36.064499999999995 37.0 37.0 37.0 37.0 37.0 100-104 36.1635 37.0 37.0 37.0 37.0 37.0 105-109 36.1462 37.0 37.0 37.0 37.0 37.0 110-114 36.0414 37.0 37.0 37.0 37.0 37.0 115-119 35.9846 37.0 37.0 37.0 37.0 37.0 120-124 35.972699999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.9652 37.0 37.0 37.0 37.0 37.0 130-134 35.981899999999996 37.0 37.0 37.0 37.0 37.0 135-139 36.0056 37.0 37.0 37.0 37.0 37.0 140-144 35.7597 37.0 37.0 37.0 37.0 37.0 145-149 35.7253 37.0 37.0 37.0 37.0 37.0 150-151 35.53325 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 0.0 22 2.0 23 2.0 24 4.0 25 3.0 26 5.0 27 6.0 28 19.0 29 22.0 30 22.0 31 45.0 32 52.0 33 97.0 34 115.0 35 295.0 36 2796.0 37 514.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.05 11.450000000000001 10.7 36.8 2 23.123123123123122 16.09109109109109 34.28428428428428 26.5015015015015 3 23.35 22.275 23.724999999999998 30.65 4 27.375 27.925 20.200000000000003 24.5 5 24.975 34.0 21.349999999999998 19.675 6 22.325 33.125 23.474999999999998 21.075 7 18.65 18.525 42.5 20.325 8 20.9 19.525000000000002 28.4 31.175000000000004 9 20.05 21.675 30.3 27.975 10-14 23.599999999999998 25.85 24.465 26.085 15-19 24.11 24.735 25.345000000000002 25.81 20-24 23.285 25.255 25.069999999999997 26.39 25-29 23.990000000000002 24.955 25.295 25.759999999999998 30-34 23.69 25.045 25.515 25.75 35-39 22.994999999999997 25.055 26.025 25.924999999999997 40-44 24.125 24.97 25.1 25.805 45-49 23.86 24.560000000000002 24.965 26.615 50-54 24.21 24.69 24.905 26.195 55-59 23.93 24.560000000000002 25.05 26.46 60-64 24.935 24.575 24.745 25.745 65-69 24.635 24.495 25.3 25.569999999999997 70-74 24.29 25.305 24.315 26.090000000000003 75-79 24.5 24.445 25.290000000000003 25.765 80-84 24.59 24.515 24.745 26.150000000000002 85-89 24.545 25.095 24.365000000000002 25.995 90-94 24.490000000000002 24.685000000000002 24.755 26.07 95-99 24.9 24.77 24.84 25.490000000000002 100-104 24.915000000000003 24.54 24.855 25.69 105-109 24.735 24.845 24.395 26.025 110-114 24.525 24.995 24.404999999999998 26.075 115-119 24.355 24.759999999999998 24.795 26.090000000000003 120-124 25.145 24.54 24.709999999999997 25.605 125-129 24.295 25.130000000000003 24.535 26.040000000000003 130-134 24.709999999999997 24.685000000000002 24.5 26.105 135-139 24.905 24.169999999999998 24.395 26.529999999999998 140-144 25.095 24.66 24.474999999999998 25.77 145-149 25.124999999999996 24.985 23.9 25.990000000000002 150-151 25.387500000000003 24.2875 24.3625 25.9625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 2.0 25 2.5 26 0.5 27 2.0 28 3.5 29 4.0 30 11.0 31 13.5 32 12.5 33 14.5 34 27.0 35 43.0 36 48.0 37 58.0 38 63.0 39 81.5 40 107.5 41 127.5 42 148.0 43 168.0 44 190.0 45 198.5 46 194.5 47 199.0 48 185.0 49 156.5 50 141.0 51 136.5 52 147.5 53 121.5 54 95.5 55 97.0 56 99.5 57 89.5 58 72.0 59 88.0 60 103.0 61 97.5 62 83.0 63 70.5 64 75.5 65 74.5 66 66.5 67 62.0 68 49.5 69 43.0 70 36.0 71 22.0 72 19.0 73 14.0 74 8.5 75 7.5 76 6.0 77 5.5 78 2.5 79 0.5 80 1.0 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.35 #Duplication Level Percentage of deduplicated Percentage of total 1 90.64748201438849 81.89999999999999 2 8.273381294964029 14.95 3 0.857775318206973 2.325 4 0.1936912008854455 0.7000000000000001 5 0.02767017155506364 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGGGGTCAGCGAGGTGGGCGAAGAGGTTGTCAATGGGGCCGGTGCCGGT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.3875 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.625 0.0 0.0 0.0 0.0 102-103 0.8 0.0 0.0 0.0 0.0 104-105 1.0 0.0 0.0 0.0 0.0 106-107 1.1625 0.0 0.0 0.0 0.0 108-109 1.3 0.0 0.0 0.0 0.0 110-111 1.4625 0.0 0.0 0.0 0.0 112-113 1.6375000000000002 0.0 0.0 0.0 0.0 114-115 1.8624999999999998 0.0 0.0 0.0 0.0 116-117 2.1 0.0 0.0 0.0 0.0 118-119 2.2625 0.0 0.0 0.0 0.0 120-121 2.575 0.0 0.0 0.0 0.0 122-123 2.8375 0.0 0.0 0.0 0.0 124-125 3.125 0.0 0.0 0.0 0.0 126-127 3.5999999999999996 0.0 0.0 0.0 0.0 128-129 3.975 0.0 0.0 0.0 0.0 130-131 4.324999999999999 0.0 0.0 0.0 0.0 132-133 4.7375 0.0 0.0 0.0 0.0 134-135 5.0625 0.0 0.0 0.0 0.0 136-137 5.575 0.0 0.0 0.0 0.0 138-139 6.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCAGCA 10 0.006830828 145.0 7 >>END_MODULE SRR12666603 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666603_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1675 37.0 37.0 37.0 37.0 37.0 2 36.0835 37.0 37.0 37.0 37.0 37.0 3 36.2205 37.0 37.0 37.0 37.0 37.0 4 36.1815 37.0 37.0 37.0 37.0 37.0 5 36.2125 37.0 37.0 37.0 37.0 37.0 6 36.1085 37.0 37.0 37.0 37.0 37.0 7 36.15 37.0 37.0 37.0 37.0 37.0 8 36.3475 37.0 37.0 37.0 37.0 37.0 9 36.2655 37.0 37.0 37.0 37.0 37.0 10-14 36.2628 37.0 37.0 37.0 37.0 37.0 15-19 36.2043 37.0 37.0 37.0 37.0 37.0 20-24 36.2014 37.0 37.0 37.0 37.0 37.0 25-29 36.1571 37.0 37.0 37.0 37.0 37.0 30-34 36.1342 37.0 37.0 37.0 37.0 37.0 35-39 36.1308 37.0 37.0 37.0 37.0 37.0 40-44 36.10509999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.022299999999994 37.0 37.0 37.0 37.0 37.0 50-54 36.0426 37.0 37.0 37.0 37.0 37.0 55-59 36.0483 37.0 37.0 37.0 37.0 37.0 60-64 35.992200000000004 37.0 37.0 37.0 37.0 37.0 65-69 35.9864 37.0 37.0 37.0 37.0 37.0 70-74 35.9763 37.0 37.0 37.0 37.0 37.0 75-79 35.9347 37.0 37.0 37.0 37.0 37.0 80-84 35.92190000000001 37.0 37.0 37.0 37.0 37.0 85-89 35.9384 37.0 37.0 37.0 37.0 37.0 90-94 35.9368 37.0 37.0 37.0 37.0 37.0 95-99 35.8871 37.0 37.0 37.0 37.0 37.0 100-104 35.8335 37.0 37.0 37.0 37.0 37.0 105-109 35.836499999999994 37.0 37.0 37.0 37.0 37.0 110-114 35.8347 37.0 37.0 37.0 37.0 37.0 115-119 35.7565 37.0 37.0 37.0 37.0 37.0 120-124 35.837 37.0 37.0 37.0 37.0 37.0 125-129 35.7864 37.0 37.0 37.0 37.0 37.0 130-134 35.7651 37.0 37.0 37.0 37.0 37.0 135-139 35.6254 37.0 37.0 37.0 37.0 37.0 140-144 35.4465 37.0 37.0 37.0 37.0 37.0 145-149 35.3669 37.0 37.0 37.0 37.0 37.0 150-151 35.01375 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 9.0 14 4.0 15 5.0 16 0.0 17 2.0 18 2.0 19 1.0 20 4.0 21 9.0 22 5.0 23 11.0 24 3.0 25 9.0 26 5.0 27 10.0 28 10.0 29 24.0 30 20.0 31 43.0 32 38.0 33 85.0 34 157.0 35 424.0 36 2684.0 37 436.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.45 14.099999999999998 11.65 30.8 2 28.275 19.85 28.625 23.25 3 24.025 22.7 27.750000000000004 25.525 4 28.225 30.25 17.9 23.625 5 28.725 31.6 19.025 20.65 6 23.474999999999998 34.5 18.2 23.825 7 21.7 15.1 37.175000000000004 26.025 8 24.65 19.025 24.625 31.7 9 24.325 21.825 24.625 29.225 10-14 27.025 24.665 22.575 25.735000000000003 15-19 26.265 24.485 23.48 25.77 20-24 26.150000000000002 24.815 23.09 25.945 25-29 26.655 24.42 23.095 25.83 30-34 26.07 24.990000000000002 23.25 25.69 35-39 26.57 24.15 23.72 25.56 40-44 26.495 24.91 23.605 24.990000000000002 45-49 26.474999999999998 24.77 22.925 25.83 50-54 25.94 24.0 23.79 26.27 55-59 26.450000000000003 24.59 23.87 25.09 60-64 26.44 24.4 23.494999999999997 25.665 65-69 26.265 24.665 23.56 25.509999999999998 70-74 26.14 24.279999999999998 23.990000000000002 25.590000000000003 75-79 26.125 24.315 23.77 25.790000000000003 80-84 26.19 25.275 23.48 25.055 85-89 26.195 24.295 23.965 25.545 90-94 26.200000000000003 24.975 23.345 25.480000000000004 95-99 26.845000000000002 24.48 23.885 24.79 100-104 26.745 25.169999999999998 23.419999999999998 24.665 105-109 25.97 25.035 24.19 24.805 110-114 27.134999999999998 24.97 23.669999999999998 24.224999999999998 115-119 26.68 24.785 23.47 25.064999999999998 120-124 27.41 24.77 23.445 24.375 125-129 26.640000000000004 25.705 23.235 24.42 130-134 27.36 25.365 23.525 23.75 135-139 27.165 25.145 23.765 23.925 140-144 27.779999999999998 25.174999999999997 23.64 23.405 145-149 27.474999999999998 24.935 24.240000000000002 23.35 150-151 28.95 24.837500000000002 22.95 23.2625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 2.0 23 2.0 24 0.5 25 0.0 26 0.5 27 3.5 28 3.5 29 3.5 30 8.0 31 9.0 32 8.5 33 15.0 34 23.0 35 28.5 36 35.0 37 39.5 38 54.5 39 78.0 40 99.0 41 126.0 42 146.5 43 151.0 44 149.5 45 146.5 46 154.0 47 161.5 48 152.5 49 157.5 50 145.5 51 135.0 52 122.0 53 98.5 54 110.0 55 112.5 56 105.0 57 100.5 58 96.0 59 95.0 60 106.5 61 106.5 62 103.5 63 101.0 64 97.0 65 83.0 66 68.0 67 82.5 68 80.0 69 61.5 70 52.0 71 49.5 72 39.0 73 29.5 74 20.5 75 10.0 76 7.0 77 2.5 78 1.5 79 1.0 80 1.0 81 1.5 82 0.5 83 0.5 84 1.0 85 1.0 86 0.5 87 1.0 88 1.5 89 0.5 90 0.5 91 0.5 92 1.0 93 1.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.225 #Duplication Level Percentage of deduplicated Percentage of total 1 90.88390135771682 82.0 2 7.786090329731228 14.05 3 1.0529232474369632 2.85 4 0.22166805209199225 0.8 5 0.0 0.0 6 0.05541701302299806 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCCAAGTGAAGTGAGCACCACTGCTGCAGAGAGAGAGATCGAGATGGCA 6 0.15 No Hit GGAACGTGCAGGCGGAGCTGGTGCACTGCCGGTGGGCGATGCTGGGCGCG 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.3625 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.6000000000000001 0.0 0.0 0.0 0.0 102-103 0.775 0.0 0.0 0.0 0.0 104-105 0.975 0.0 0.0 0.0 0.0 106-107 1.1375000000000002 0.0 0.0 0.0 0.0 108-109 1.275 0.0 0.0 0.0 0.0 110-111 1.4375 0.0 0.0 0.0 0.0 112-113 1.6124999999999998 0.0 0.0 0.0 0.0 114-115 1.875 0.0 0.0 0.0 0.0 116-117 2.125 0.0 0.0 0.0 0.0 118-119 2.2875 0.0 0.0 0.0 0.0 120-121 2.6125 0.0 0.0 0.0 0.0 122-123 2.8875 0.0 0.0 0.0 0.0 124-125 3.175 0.0 0.0 0.0 0.0 126-127 3.6500000000000004 0.0 0.0 0.0 0.0 128-129 4.025 0.0 0.0 0.0 0.0 130-131 4.4 0.0 0.0 0.0 0.0 132-133 4.8125 0.0 0.0 0.0 0.0 134-135 5.112500000000001 0.0 0.0 0.0 0.0 136-137 5.65 0.0 0.0 0.0 0.0 138-139 6.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCTCCC 10 0.006830828 145.0 8 TAAGCAA 10 0.006830828 145.0 5 AATTAAG 10 0.006830828 145.0 2 ATTAAGC 10 0.006830828 145.0 3 TTAAGCA 10 0.006830828 145.0 4 AGCAAAA 10 0.006830828 145.0 7 TGTGTGG 10 0.006830828 145.0 145 AAGCAAA 10 0.006830828 145.0 6 GGGGGGG 20 0.00593511 29.0 135-139 >>END_MODULE Read 2141599 spots for SRR12666603.sra Written 2141599 spots for SRR12666603.sra Read 2141599 spots for SRR12666603.sra Written 2141599 spots for SRR12666603.sra Read 2141599 spots for SRR12666603.sra Written 2141599 spots for SRR12666603.sra Read 2141599 spots for SRR12666603.sra Written 2141599 spots for SRR12666603.sra Read 2141599 spots for SRR12666603.sra Written 2141599 spots for SRR12666603.sra Read 2141611 spots for SRR12666603.sra Written 2141611 spots for SRR12666603.sra Read 2141599 spots for SRR12666603.sra Written 2141599 spots for SRR12666603.sra Read 2141599 spots for SRR12666603.sra Written 2141599 spots for SRR12666603.sra Read 2141599 spots for SRR12666603.sra Written 2141599 spots for SRR12666603.sra Read 2141599 spots for SRR12666603.sra Written 2141599 spots for SRR12666603.sra Read 2141599 spots for SRR12666603.sra Written 2141599 spots for SRR12666603.sra Read 2141599 spots for SRR12666603.sra Written 2141599 spots for SRR12666603.sra Read 2141599 spots for SRR12666603.sra Written 2141599 spots for SRR12666603.sra Read 2141599 spots for SRR12666603.sra Written 2141599 spots for SRR12666603.sra Read 2141599 spots for SRR12666603.sra Written 2141599 spots for SRR12666603.sra Read 2141599 spots for SRR12666603.sra Written 2141599 spots for SRR12666603.sra Read 2141599 spots for SRR12666603.sra Written 2141599 spots for SRR12666603.sra Read 2141599 spots for SRR12666603.sra Written 2141599 spots for SRR12666603.sra Read 2141599 spots for SRR12666603.sra Written 2141599 spots for SRR12666603.sra Read 2141599 spots for SRR12666603.sra Written 2141599 spots for SRR12666603.sra SRR ids: ['SRR12666603.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_v1b7xq2d SRR12666603.sra spots: 42831992 blocks: [[1, 2141599], [2141600, 4283198], [4283199, 6424797], [6424798, 8566396], [8566397, 10707995], [10707996, 12849594], [12849595, 14991193], [14991194, 17132792], [17132793, 19274391], [19274392, 21415990], [21415991, 23557589], [23557590, 25699188], [25699189, 27840787], [27840788, 29982386], [29982387, 32123985], [32123986, 34265584], [34265585, 36407183], [36407184, 38548782], [38548783, 40690381], [40690382, 42831992]] SRR12666603 file size 14534484 SRR12666603 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12666603 SRR12666603_1.fastq SRR12666603_2.fastq Input file: SRR12666603_1.fastq Paired file: SRR12666603_2.fastq trimmed: SRR12666603-trimmed-pair1.fastq, SRR12666603-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 17:47:39 2024 >> started Sat Dec 7 17:55:40 2024 >> done (480.940s) 42831992 read pairs processed; of these: 94 ( 0.00%) short read pairs filtered out after trimming by size control 9578 ( 0.02%) empty read pairs filtered out after trimming by size control 42822320 (99.98%) read pairs available; of these: 3691161 ( 8.62%) trimmed read pairs available after processing 39131159 (91.38%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 11 0.00% 20 13 0.00% 21 16 0.00% 22 28 0.00% 23 15 0.00% 24 16 0.00% 25 27 0.00% 26 31 0.00% 27 33 0.00% 28 49 0.00% 29 32 0.00% 30 55 0.00% 31 39 0.00% 32 44 0.00% 33 49 0.00% 34 47 0.00% 35 59 0.00% 36 49 0.00% 37 64 0.00% 38 71 0.00% 39 53 0.00% 40 59 0.00% 41 55 0.00% 42 73 0.00% 43 91 0.00% 44 78 0.00% 45 92 0.00% 46 99 0.00% 47 93 0.00% 48 101 0.00% 49 119 0.00% 50 138 0.00% 51 126 0.00% 52 139 0.00% 53 123 0.00% 54 177 0.00% 55 170 0.00% 56 171 0.00% 57 196 0.00% 58 218 0.00% 59 263 0.00% 60 280 0.00% 61 333 0.00% 62 320 0.00% 63 408 0.00% 64 363 0.00% 65 457 0.00% 66 483 0.00% 67 593 0.00% 68 605 0.00% 69 679 0.00% 70 836 0.00% 71 980 0.00% 72 1146 0.00% 73 1361 0.00% 74 1406 0.00% 75 1625 0.00% 76 1748 0.00% 77 1974 0.00% 78 2171 0.01% 79 2557 0.01% 80 2806 0.01% 81 3230 0.01% 82 3755 0.01% 83 4310 0.01% 84 4835 0.01% 85 5302 0.01% 86 5729 0.01% 87 6427 0.02% 88 7147 0.02% 89 7824 0.02% 90 8586 0.02% 91 9753 0.02% 92 11006 0.03% 93 12202 0.03% 94 13575 0.03% 95 14405 0.03% 96 15536 0.04% 97 16726 0.04% 98 17501 0.04% 99 18965 0.04% 100 20131 0.05% 101 21858 0.05% 102 24005 0.06% 103 26322 0.06% 104 28005 0.07% 105 29470 0.07% 106 31211 0.07% 107 32416 0.08% 108 33893 0.08% 109 34854 0.08% 110 36441 0.09% 111 38639 0.09% 112 41733 0.10% 113 44164 0.10% 114 46679 0.11% 115 49405 0.12% 116 50172 0.12% 117 52728 0.12% 118 52787 0.12% 119 53863 0.13% 120 56379 0.13% 121 57902 0.14% 122 61073 0.14% 123 64302 0.15% 124 66911 0.16% 125 69873 0.16% 126 71980 0.17% 127 72573 0.17% 128 73390 0.17% 129 74185 0.17% 130 75968 0.18% 131 77925 0.18% 132 81105 0.19% 133 83471 0.19% 134 87197 0.20% 135 90279 0.21% 136 92164 0.22% 137 93414 0.22% 138 94365 0.22% 139 96193 0.22% 140 96276 0.22% 141 97861 0.23% 142 101469 0.24% 143 103595 0.24% 144 107103 0.25% 145 110266 0.26% 146 112661 0.26% 147 114499 0.27% 148 114988 0.27% 149 114296 0.27% 150 115389 0.27% 151 39131159 91.38% 42822320 reads passed initial QC criterion=sequence-density sequence-density=0.85 sequence-density-rank=1 fanout-score=3.32 fanout-score-rank=17 prefix-density=0.92 prefix-fanout=3.1 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTGTGTGGCGTCGGT criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=15.26 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.6 sequence=TTGATGAAAATGGTATTATAATTATATAGTTGATGTCTTTTGGTCACAAGATGACCAAATTACGCATCACAAGTACAACCCCACGTCAGAAAATGGTAGAAACTTCTATTGCTTATTACAAATTCACATCGAGCCATCCGGCATGCAGTACTGGAAAATAGCGAGTACATATACTCCATGGCATCGCATCCACATCAATGGATCGATCTGTAGGGTCATCTCCATATCTGTATGTATAAGTATACGTTGTATGTATAGGAGTTAACCGGATGAGAGGACTTAGAGCTCCCATGTGTCGAACTTGCCGGAGACGAAGTCGTAGTGGCCGCCCACGAGCTTGAGGGTTCCGTTGGCGACGCCTTCCTTGACGAACGGGTAGGTCTTGAGGTTCTCGAGGGACACGTTCACGGCCTCCTTTTCCAAGACGGCGCATTGGTCATCGAAAGGCATGGAGGCGCACTCGGTCTGCACCTTCTTCTTGGCCGGGAACCCGATCCTGACCCAGTCCTCG criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=3.77 fanout-score-rank=17 prefix-density=0.68 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAGCTCCCCTGGGTACTATGATGGCAGGTACTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=124.49 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=9.2 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAATACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTTGGTTC SRR12666603 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 18:01:53 Started mapping on | Dec 07 18:01:54 Finished on | Dec 07 18:44:23 Mapping speed, Million of reads per hour | 60.48 Number of input reads | 42822320 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 41114128 Uniquely mapped reads % | 96.01% Average mapped length | 297.56 Number of splices: Total | 45333000 Number of splices: Annotated (sjdb) | 42909249 Number of splices: GT/AG | 44715386 Number of splices: GC/AG | 556066 Number of splices: AT/AC | 17267 Number of splices: Non-canonical | 44281 Mismatch rate per base, % | 0.11% Deletion rate per base | 0.00% Deletion average length | 1.48 Insertion rate per base | 0.00% Insertion average length | 1.21 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 430798 % of reads mapped to multiple loci | 1.01% Number of reads mapped to too many loci | 59672 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.04% % of reads unmapped: other | 0.80% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1277394 1277394 1277394 N_multimapping 430798 430798 430798 N_noFeature 1518541 39996272 1803482 N_ambiguous 997735 5612 166527 UnstrandedReadsAssigned:38597852 PositiveStrandReadsAssigned:1112244 NegativeStrandReadsAssigned:39144119 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12666603 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12666603-trimmed-pair1.fastq SRR12666603-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 42,822,320 reads, 39,664,085 reads pseudoaligned [quant] estimated average fragment length: 284.858 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,184 rounds 52973 SRR12666603.ke.tsv 35125 SRR12666603.se.tsv 88098 total ==> SRR12666603.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 652.998 0 0 PNS24247 1044 760.142 85.9267 4.10391 PNS24249 1928 1644.14 79.4053 1.75337 PNS24246 1044 760.142 85.9267 4.10391 PNS24248 1044 760.142 85.9267 4.10391 PNS24244 1471 1187.14 132.815 4.06169 PNS24243 293 90.9378 0 0 KQK14069 1603 1319.14 504.571 13.8866 KQK14071 474 223.155 12.396 2.01669 ==> SRR12666603.se.tsv <== BRADI_1g14170v3 559 BRADI_1g53295v3 292 BRADI_1g59795v3 1357 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 549 BRADI_1g74790v3 277 BRADI_1g09890v3 0 BRADI_1g77505v3 401 BRADI_1g48960v3 0 SRR12666603 completed mapping pipeline successfully