Starting /dee2/code/volunteer_pipeline.sh SRR12666604 current disk space = 1541107429376 free memory = 1595941036 SRR12666604 SRAfilesize 098a5f0bfce63f2a7169d664bc70c776 SRR12666604.sra SRR12666604.sra file validated SRR12666604 is paired end SRR12666604 is conventional basespace SRR12666604 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666604_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.385 37.0 37.0 37.0 37.0 37.0 2 36.28425 37.0 37.0 37.0 37.0 37.0 3 36.448 37.0 37.0 37.0 37.0 37.0 4 36.439 37.0 37.0 37.0 37.0 37.0 5 36.5285 37.0 37.0 37.0 37.0 37.0 6 36.417 37.0 37.0 37.0 37.0 37.0 7 36.496 37.0 37.0 37.0 37.0 37.0 8 36.5955 37.0 37.0 37.0 37.0 37.0 9 36.5305 37.0 37.0 37.0 37.0 37.0 10-14 36.522800000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.538 37.0 37.0 37.0 37.0 37.0 20-24 36.5033 37.0 37.0 37.0 37.0 37.0 25-29 36.424400000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.418 37.0 37.0 37.0 37.0 37.0 35-39 36.401300000000006 37.0 37.0 37.0 37.0 37.0 40-44 36.3394 37.0 37.0 37.0 37.0 37.0 45-49 36.293099999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.2866 37.0 37.0 37.0 37.0 37.0 55-59 36.284200000000006 37.0 37.0 37.0 37.0 37.0 60-64 36.2751 37.0 37.0 37.0 37.0 37.0 65-69 36.193400000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.1627 37.0 37.0 37.0 37.0 37.0 75-79 36.167 37.0 37.0 37.0 37.0 37.0 80-84 36.193200000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.1502 37.0 37.0 37.0 37.0 37.0 90-94 36.1539 37.0 37.0 37.0 37.0 37.0 95-99 36.0574 37.0 37.0 37.0 37.0 37.0 100-104 36.0927 37.0 37.0 37.0 37.0 37.0 105-109 36.123999999999995 37.0 37.0 37.0 37.0 37.0 110-114 36.0176 37.0 37.0 37.0 37.0 37.0 115-119 35.963 37.0 37.0 37.0 37.0 37.0 120-124 35.8907 37.0 37.0 37.0 37.0 37.0 125-129 35.9217 37.0 37.0 37.0 37.0 37.0 130-134 35.8802 37.0 37.0 37.0 37.0 37.0 135-139 35.87669999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.6716 37.0 37.0 37.0 37.0 37.0 145-149 35.5252 37.0 37.0 37.0 37.0 37.0 150-151 35.376 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 2.0 21 1.0 22 3.0 23 3.0 24 0.0 25 7.0 26 5.0 27 10.0 28 14.0 29 17.0 30 30.0 31 50.0 32 57.0 33 90.0 34 147.0 35 307.0 36 2797.0 37 460.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.675000000000004 11.375 8.375 36.575 2 23.85481852315394 14.893617021276595 35.76971214017522 25.481852315394242 3 21.725 21.875 25.05 31.35 4 27.05 27.700000000000003 22.15 23.1 5 26.075 32.1 21.8 20.025000000000002 6 21.725 34.075 22.400000000000002 21.8 7 17.0 21.15 41.275 20.575 8 20.225 20.549999999999997 29.049999999999997 30.175 9 20.95 20.625 30.049999999999997 28.375 10-14 23.34 26.005 25.06 25.595000000000002 15-19 23.765 25.025 25.055 26.155 20-24 23.474999999999998 25.169999999999998 25.31 26.045 25-29 23.189999999999998 25.919999999999998 25.5 25.39 30-34 23.865 25.035 25.185000000000002 25.915 35-39 23.705000000000002 25.419999999999998 24.39 26.484999999999996 40-44 23.91 25.27 25.15 25.669999999999998 45-49 23.84 24.605 24.83 26.724999999999998 50-54 23.51 24.85 25.03 26.61 55-59 23.695 25.169999999999998 24.89 26.245 60-64 23.345 25.775 25.005 25.874999999999996 65-69 23.745 25.595000000000002 24.935 25.724999999999998 70-74 23.74 25.755 24.8 25.705 75-79 24.4 25.224999999999998 24.52 25.855 80-84 23.810000000000002 24.57 25.035 26.584999999999997 85-89 23.93 25.169999999999998 24.775 26.125 90-94 24.099999999999998 25.365 24.195 26.340000000000003 95-99 24.92 24.065 24.79 26.224999999999998 100-104 24.474999999999998 24.925 24.42 26.179999999999996 105-109 24.625 24.985 24.48 25.91 110-114 24.305 25.16 24.675 25.86 115-119 24.485 24.685000000000002 24.9 25.929999999999996 120-124 24.959999999999997 24.555 24.099999999999998 26.384999999999998 125-129 24.325 25.195 24.08 26.400000000000002 130-134 24.6 25.195 24.175 26.029999999999998 135-139 24.95 24.82 24.58 25.650000000000002 140-144 24.94 24.89 23.72 26.450000000000003 145-149 24.995 25.124999999999996 23.765 26.115 150-151 25.112499999999997 24.5125 24.887500000000003 25.4875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 0.5 26 1.0 27 1.5 28 2.5 29 7.5 30 12.0 31 11.0 32 12.0 33 15.5 34 22.0 35 34.0 36 45.5 37 62.5 38 79.0 39 94.5 40 119.0 41 147.5 42 166.5 43 167.0 44 168.5 45 184.5 46 203.0 47 200.0 48 189.5 49 177.5 50 156.0 51 135.0 52 122.0 53 117.0 54 114.0 55 108.5 56 100.0 57 83.0 58 71.0 59 71.0 60 77.0 61 81.5 62 74.0 63 69.0 64 69.0 65 58.0 66 49.0 67 51.0 68 55.5 69 50.5 70 31.5 71 26.5 72 28.0 73 23.0 74 17.5 75 12.5 76 9.0 77 4.5 78 1.5 79 2.0 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.125 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.2 #Duplication Level Percentage of deduplicated Percentage of total 1 91.22807017543859 83.2 2 7.949561403508771 14.499999999999998 3 0.7675438596491228 2.1 4 0.05482456140350877 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.6375 0.0 0.0 0.0 0.0 100-101 0.7875 0.0 0.0 0.0 0.0 102-103 0.925 0.0 0.0 0.0 0.0 104-105 1.1625 0.0 0.0 0.0 0.0 106-107 1.2625 0.0 0.0 0.0 0.0 108-109 1.4 0.0 0.0 0.0 0.0 110-111 1.6875 0.0 0.0 0.0 0.0 112-113 2.025 0.0 0.0 0.0 0.0 114-115 2.4375 0.0 0.0 0.0 0.0 116-117 2.825 0.0 0.0 0.0 0.0 118-119 3.2375 0.0 0.0 0.0 0.0 120-121 3.6375 0.0 0.0 0.0 0.0 122-123 3.85 0.0 0.0 0.0 0.0 124-125 4.1875 0.0 0.0 0.0 0.0 126-127 4.737500000000001 0.0 0.0 0.0 0.0 128-129 5.0375 0.0 0.0 0.0 0.0 130-131 5.475 0.0 0.0 0.0 0.0 132-133 5.887499999999999 0.0 0.0 0.0 0.0 134-135 6.3625 0.0 0.0 0.0 0.0 136-137 6.825 0.0 0.0 0.0 0.0 138-139 7.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCAAGA 10 0.006830828 145.0 1 >>END_MODULE SRR12666604 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666604_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.668 37.0 37.0 37.0 37.0 37.0 2 35.0965 37.0 37.0 37.0 25.0 37.0 3 35.3595 37.0 37.0 37.0 37.0 37.0 4 35.517 37.0 37.0 37.0 37.0 37.0 5 35.56 37.0 37.0 37.0 37.0 37.0 6 35.463 37.0 37.0 37.0 37.0 37.0 7 35.6525 37.0 37.0 37.0 37.0 37.0 8 35.7615 37.0 37.0 37.0 37.0 37.0 9 35.7925 37.0 37.0 37.0 37.0 37.0 10-14 35.7896 37.0 37.0 37.0 37.0 37.0 15-19 35.7359 37.0 37.0 37.0 37.0 37.0 20-24 35.725300000000004 37.0 37.0 37.0 37.0 37.0 25-29 35.6863 37.0 37.0 37.0 37.0 37.0 30-34 35.695499999999996 37.0 37.0 37.0 37.0 37.0 35-39 35.6965 37.0 37.0 37.0 37.0 37.0 40-44 35.56660000000001 37.0 37.0 37.0 37.0 37.0 45-49 35.582499999999996 37.0 37.0 37.0 37.0 37.0 50-54 35.5156 37.0 37.0 37.0 37.0 37.0 55-59 35.5323 37.0 37.0 37.0 37.0 37.0 60-64 35.424600000000005 37.0 37.0 37.0 37.0 37.0 65-69 35.4579 37.0 37.0 37.0 37.0 37.0 70-74 35.41940000000001 37.0 37.0 37.0 37.0 37.0 75-79 35.3934 37.0 37.0 37.0 37.0 37.0 80-84 35.3639 37.0 37.0 37.0 34.6 37.0 85-89 35.3312 37.0 37.0 37.0 37.0 37.0 90-94 35.32599999999999 37.0 37.0 37.0 37.0 37.0 95-99 35.30800000000001 37.0 37.0 37.0 34.6 37.0 100-104 35.352799999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.312400000000004 37.0 37.0 37.0 32.2 37.0 110-114 35.2017 37.0 37.0 37.0 32.2 37.0 115-119 35.1106 37.0 37.0 37.0 27.4 37.0 120-124 35.2111 37.0 37.0 37.0 32.2 37.0 125-129 35.161500000000004 37.0 37.0 37.0 27.4 37.0 130-134 35.0984 37.0 37.0 37.0 25.0 37.0 135-139 34.9582 37.0 37.0 37.0 25.0 37.0 140-144 34.770500000000006 37.0 37.0 37.0 25.0 37.0 145-149 34.785199999999996 37.0 37.0 37.0 25.0 37.0 150-151 34.18875 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 7.0 14 3.0 15 2.0 16 2.0 17 3.0 18 1.0 19 5.0 20 5.0 21 2.0 22 15.0 23 9.0 24 14.0 25 11.0 26 14.0 27 25.0 28 27.0 29 31.0 30 43.0 31 63.0 32 89.0 33 140.0 34 330.0 35 775.0 36 2213.0 37 170.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.25 15.425 10.25 29.075 2 28.749999999999996 20.275000000000002 29.4 21.575 3 24.6 22.900000000000002 28.625 23.875 4 30.85 28.775000000000002 17.849999999999998 22.525000000000002 5 28.525 33.025 17.8 20.65 6 23.125 35.449999999999996 18.375 23.05 7 23.375 15.45 35.575 25.6 8 22.7 20.75 24.6 31.95 9 23.45 22.075 25.1 29.375 10-14 27.13 24.615000000000002 23.400000000000002 24.855 15-19 26.735 24.22 24.005000000000003 25.040000000000003 20-24 26.715 25.2 23.380000000000003 24.705 25-29 27.060000000000002 24.845 23.395 24.7 30-34 26.91 25.11 23.77 24.21 35-39 26.405 25.14 23.57 24.884999999999998 40-44 26.365 25.135 23.435 25.064999999999998 45-49 26.525 24.435000000000002 24.11 24.93 50-54 26.115 25.14 23.400000000000002 25.345000000000002 55-59 27.63 24.349999999999998 23.150000000000002 24.87 60-64 26.284999999999997 24.43 24.195 25.09 65-69 26.695 24.515 23.685000000000002 25.105 70-74 27.08 23.905 24.185000000000002 24.83 75-79 26.889999999999997 24.015 24.065 25.03 80-84 26.575 24.365000000000002 24.14 24.92 85-89 26.724999999999998 24.505 24.065 24.705 90-94 26.55 24.060000000000002 24.474999999999998 24.915000000000003 95-99 27.26 24.07 23.995 24.675 100-104 26.87 24.485 23.615 25.03 105-109 26.810000000000002 24.41 23.880000000000003 24.9 110-114 26.155 25.4 23.34 25.105 115-119 26.979999999999997 24.41 23.68 24.93 120-124 27.495000000000005 24.404999999999998 23.990000000000002 24.11 125-129 27.93 24.57 24.060000000000002 23.44 130-134 27.825 24.67 23.595 23.91 135-139 28.139999999999997 25.11 23.65 23.1 140-144 28.27 25.025 23.515 23.189999999999998 145-149 28.720000000000002 24.285 24.044999999999998 22.95 150-151 28.237499999999997 24.775 23.5125 23.474999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 1.5 21 1.5 22 1.0 23 1.5 24 0.5 25 0.0 26 1.5 27 1.5 28 1.0 29 5.5 30 7.5 31 7.0 32 9.5 33 12.5 34 21.5 35 34.5 36 38.5 37 40.0 38 58.0 39 81.0 40 108.5 41 144.0 42 144.5 43 139.0 44 146.5 45 144.5 46 168.0 47 181.5 48 187.0 49 177.5 50 132.5 51 122.5 52 117.0 53 105.5 54 102.5 55 93.0 56 96.5 57 104.0 58 106.0 59 109.5 60 106.5 61 101.5 62 98.5 63 97.0 64 87.0 65 75.5 66 67.0 67 58.5 68 63.5 69 61.5 70 48.5 71 33.5 72 29.0 73 27.5 74 20.5 75 15.5 76 10.0 77 5.0 78 2.5 79 2.5 80 2.5 81 1.0 82 2.0 83 2.5 84 1.5 85 1.0 86 0.5 87 1.0 88 0.5 89 0.0 90 1.0 91 1.5 92 1.0 93 1.0 94 0.5 95 0.5 96 1.5 97 1.0 98 0.5 99 1.0 100 4.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.2 #Duplication Level Percentage of deduplicated Percentage of total 1 91.99561403508771 83.89999999999999 2 6.93530701754386 12.65 3 0.9046052631578948 2.475 4 0.08223684210526315 0.3 5 0.0 0.0 6 0.027412280701754384 0.15 7 0.027412280701754384 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.027412280701754384 0.35000000000000003 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 14 0.35000000000000003 No Hit CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 7 0.17500000000000002 No Hit GGTTGACAAGGGTCTTGTGCCACTCGTTGGTTCCAACGACGAGTCATGGT 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.8375 0.0 0.0 0.0 0.0 102-103 0.975 0.0 0.0 0.0 0.0 104-105 1.2125 0.0 0.0 0.0 0.0 106-107 1.3375 0.0 0.0 0.0 0.0 108-109 1.5 0.0 0.0 0.0 0.0 110-111 1.7875 0.0 0.0 0.0 0.0 112-113 2.1375 0.0 0.0 0.0 0.0 114-115 2.5625 0.0 0.0 0.0 0.0 116-117 2.95 0.0 0.0 0.0 0.0 118-119 3.375 0.0 0.0 0.0 0.0 120-121 3.7625 0.0 0.0 0.0 0.0 122-123 3.975 0.0 0.0 0.0 0.0 124-125 4.2875 0.0 0.0 0.0 0.0 126-127 4.8125 0.0 0.0 0.0 0.0 128-129 5.1375 0.0 0.0 0.0 0.0 130-131 5.6125 0.0 0.0 0.0 0.0 132-133 6.025 0.0 0.0 0.0 0.0 134-135 6.5 0.0 0.0 0.0 0.0 136-137 6.975 0.0 0.0 0.0 0.0 138-139 7.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCAACC 10 0.006830828 145.0 1 >>END_MODULE Read 1758640 spots for SRR12666604.sra Written 1758640 spots for SRR12666604.sra Read 1758640 spots for SRR12666604.sra Written 1758640 spots for SRR12666604.sra Read 1758640 spots for SRR12666604.sra Written 1758640 spots for SRR12666604.sra Read 1758640 spots for SRR12666604.sra Written 1758640 spots for SRR12666604.sra Read 1758640 spots for SRR12666604.sra Written 1758640 spots for SRR12666604.sra Read 1758640 spots for SRR12666604.sra Written 1758640 spots for SRR12666604.sra Read 1758646 spots for SRR12666604.sra Written 1758646 spots for SRR12666604.sra Read 1758640 spots for SRR12666604.sra Written 1758640 spots for SRR12666604.sra Read 1758640 spots for SRR12666604.sra Written 1758640 spots for SRR12666604.sra Read 1758640 spots for SRR12666604.sra Written 1758640 spots for SRR12666604.sra Read 1758640 spots for SRR12666604.sra Written 1758640 spots for SRR12666604.sra Read 1758640 spots for SRR12666604.sra Written 1758640 spots for SRR12666604.sra Read 1758640 spots for SRR12666604.sra Written 1758640 spots for SRR12666604.sra Read 1758640 spots for SRR12666604.sra Written 1758640 spots for SRR12666604.sra Read 1758640 spots for SRR12666604.sra Written 1758640 spots for SRR12666604.sra Read 1758640 spots for SRR12666604.sra Written 1758640 spots for SRR12666604.sra Read 1758640 spots for SRR12666604.sra Written 1758640 spots for SRR12666604.sra Read 1758640 spots for SRR12666604.sra Written 1758640 spots for SRR12666604.sra Read 1758640 spots for SRR12666604.sra Written 1758640 spots for SRR12666604.sra Read 1758640 spots for SRR12666604.sra Written 1758640 spots for SRR12666604.sra SRR ids: ['SRR12666604.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_v4479t55 SRR12666604.sra spots: 35172806 blocks: [[1, 1758640], [1758641, 3517280], [3517281, 5275920], [5275921, 7034560], [7034561, 8793200], [8793201, 10551840], [10551841, 12310480], [12310481, 14069120], [14069121, 15827760], [15827761, 17586400], [17586401, 19345040], [19345041, 21103680], [21103681, 22862320], [22862321, 24620960], [24620961, 26379600], [26379601, 28138240], [28138241, 29896880], [29896881, 31655520], [31655521, 33414160], [33414161, 35172806]] SRR12666604 file size 11931557 SRR12666604 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12666604 SRR12666604_1.fastq SRR12666604_2.fastq Input file: SRR12666604_1.fastq Paired file: SRR12666604_2.fastq trimmed: SRR12666604-trimmed-pair1.fastq, SRR12666604-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 17:42:46 2024 >> started Sat Dec 7 17:43:26 2024 >> done (39.874s) 35172806 read pairs processed; of these: 77 ( 0.00%) short read pairs filtered out after trimming by size control 39676 ( 0.11%) empty read pairs filtered out after trimming by size control 35133053 (99.89%) read pairs available; of these: 3877932 (11.04%) trimmed read pairs available after processing 31255121 (88.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 18 0.00% 20 9 0.00% 21 15 0.00% 22 11 0.00% 23 18 0.00% 24 19 0.00% 25 21 0.00% 26 13 0.00% 27 33 0.00% 28 28 0.00% 29 38 0.00% 30 26 0.00% 31 35 0.00% 32 40 0.00% 33 38 0.00% 34 29 0.00% 35 41 0.00% 36 39 0.00% 37 46 0.00% 38 76 0.00% 39 56 0.00% 40 65 0.00% 41 65 0.00% 42 62 0.00% 43 59 0.00% 44 76 0.00% 45 81 0.00% 46 80 0.00% 47 84 0.00% 48 97 0.00% 49 132 0.00% 50 101 0.00% 51 119 0.00% 52 157 0.00% 53 160 0.00% 54 144 0.00% 55 169 0.00% 56 210 0.00% 57 218 0.00% 58 281 0.00% 59 297 0.00% 60 364 0.00% 61 464 0.00% 62 465 0.00% 63 479 0.00% 64 550 0.00% 65 607 0.00% 66 692 0.00% 67 809 0.00% 68 959 0.00% 69 1041 0.00% 70 1216 0.00% 71 1389 0.00% 72 1745 0.00% 73 1996 0.01% 74 2270 0.01% 75 2544 0.01% 76 2680 0.01% 77 3166 0.01% 78 3489 0.01% 79 4031 0.01% 80 4393 0.01% 81 5060 0.01% 82 5700 0.02% 83 6545 0.02% 84 7167 0.02% 85 8107 0.02% 86 8704 0.02% 87 9466 0.03% 88 10407 0.03% 89 11263 0.03% 90 12406 0.04% 91 13881 0.04% 92 15272 0.04% 93 16363 0.05% 94 18189 0.05% 95 19215 0.05% 96 20421 0.06% 97 21828 0.06% 98 22845 0.07% 99 24246 0.07% 100 25384 0.07% 101 27443 0.08% 102 29502 0.08% 103 31350 0.09% 104 33080 0.09% 105 34864 0.10% 106 36631 0.10% 107 38084 0.11% 108 38844 0.11% 109 40583 0.12% 110 41998 0.12% 111 44625 0.13% 112 46856 0.13% 113 48473 0.14% 114 50416 0.14% 115 53478 0.15% 116 54150 0.15% 117 56323 0.16% 118 56945 0.16% 119 58413 0.17% 120 60048 0.17% 121 62138 0.18% 122 63417 0.18% 123 66184 0.19% 124 69679 0.20% 125 71448 0.20% 126 73923 0.21% 127 74349 0.21% 128 75630 0.22% 129 77453 0.22% 130 78339 0.22% 131 80038 0.23% 132 82538 0.23% 133 85377 0.24% 134 86938 0.25% 135 90263 0.26% 136 91091 0.26% 137 92254 0.26% 138 93889 0.27% 139 95840 0.27% 140 96977 0.28% 141 97767 0.28% 142 99969 0.28% 143 102057 0.29% 144 105139 0.30% 145 107912 0.31% 146 109093 0.31% 147 110797 0.32% 148 111300 0.32% 149 110659 0.31% 150 112235 0.32% 151 31255121 88.96% 35133053 reads passed initial QC criterion=sequence-density sequence-density=0.75 sequence-density-rank=1 fanout-score=3.13 fanout-score-rank=14 prefix-density=0.81 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.11 sequence-density-rank=28 fanout-score=10.61 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=2.9 sequence=GCCGGGAACGATTCCCTGCTCGACAAGGATGTCAACAATCTTCTTGCCATCAACAGTCGATTGGTAGAGGGTCTCCTCGAAGAGGATAGCACCAGAGATGTAATTTCCCAGGCCTGGTGGAGTGACAAGGAGGGTACGGTAAGCCTGGCGGTTAGCCTCAGTGTTCTCAAGGCCAATCGAGTCAAGTCTCTTTCCACAGGTAGCATTGGACTCATCCATGGCTAGGATGCCCCTTCCTGGTGATGCGATGGTATTCGCGGTCTTGACAAGTTCATCAGCGTATGCGCTGGCACGGACAACCATGGAGACGGTCATCTGCTTGGGAGTGGCAGCCTGGCGGGTGGCGCCCCATTCGGACTTCTTGGGAAGGAAAGACGATTTGAGGATAGTAGCCGAGGCCATTGTTTCTGGCTCCAAAGGCAAGAGGATCAGGTGCTACCCTCTTCTTTGACACAAGCTTGCAAT criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=3.71 fanout-score-rank=17 prefix-density=0.63 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=145.69 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=9.3 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR12666604 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 17:44:09 Started mapping on | Dec 07 17:44:09 Finished on | Dec 07 17:47:50 Mapping speed, Million of reads per hour | 572.30 Number of input reads | 35133053 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 33543509 Uniquely mapped reads % | 95.48% Average mapped length | 295.96 Number of splices: Total | 36021522 Number of splices: Annotated (sjdb) | 34089643 Number of splices: GT/AG | 35533246 Number of splices: GC/AG | 436831 Number of splices: AT/AC | 16740 Number of splices: Non-canonical | 34705 Mismatch rate per base, % | 0.16% Deletion rate per base | 0.00% Deletion average length | 1.43 Insertion rate per base | 0.00% Insertion average length | 1.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 431482 % of reads mapped to multiple loci | 1.23% Number of reads mapped to too many loci | 53414 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.25% % of reads unmapped: other | 0.90% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1158062 1158062 1158062 N_multimapping 431482 431482 431482 N_noFeature 1198641 32672623 1448210 N_ambiguous 741562 4315 122069 UnstrandedReadsAssigned:31603306 PositiveStrandReadsAssigned:866571 NegativeStrandReadsAssigned:31973230 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12666604 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12666604-trimmed-pair1.fastq SRR12666604-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 35,133,053 reads, 32,513,531 reads pseudoaligned [quant] estimated average fragment length: 267.322 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,171 rounds 52973 SRR12666604.ke.tsv 35125 SRR12666604.se.tsv 88098 total ==> SRR12666604.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 670.151 0 0 PNS24247 1044 777.678 53.6213 3.09237 PNS24249 1928 1661.68 74.4155 2.00849 PNS24246 1044 777.678 53.6213 3.09237 PNS24248 1044 777.678 53.6213 3.09237 PNS24244 1471 1204.68 151.721 5.64843 PNS24243 293 95.688 0 0 KQK14069 1603 1336.68 185.692 6.23047 KQK14071 474 232.724 17.9951 3.4679 ==> SRR12666604.se.tsv <== BRADI_1g14170v3 319 BRADI_1g53295v3 183 BRADI_1g59795v3 1056 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 631 BRADI_1g74790v3 285 BRADI_1g09890v3 0 BRADI_1g77505v3 307 BRADI_1g48960v3 0 SRR12666604 completed mapping pipeline successfully