Starting /dee2/code/volunteer_pipeline.sh SRR12666605 current disk space = 1540956418048 free memory = 1602347928 SRR12666605 SRAfilesize f7d0dcd6b93c53800e09b7863c5f6bbe SRR12666605.sra SRR12666605.sra file validated SRR12666605 is paired end SRR12666605 is conventional basespace SRR12666605 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666605_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4475 37.0 37.0 37.0 37.0 37.0 2 36.23325 37.0 37.0 37.0 37.0 37.0 3 36.458 37.0 37.0 37.0 37.0 37.0 4 36.5385 37.0 37.0 37.0 37.0 37.0 5 36.4485 37.0 37.0 37.0 37.0 37.0 6 36.5655 37.0 37.0 37.0 37.0 37.0 7 36.561 37.0 37.0 37.0 37.0 37.0 8 36.5145 37.0 37.0 37.0 37.0 37.0 9 36.587 37.0 37.0 37.0 37.0 37.0 10-14 36.5212 37.0 37.0 37.0 37.0 37.0 15-19 36.5295 37.0 37.0 37.0 37.0 37.0 20-24 36.484500000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.4195 37.0 37.0 37.0 37.0 37.0 30-34 36.38870000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.34910000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.3295 37.0 37.0 37.0 37.0 37.0 45-49 36.3163 37.0 37.0 37.0 37.0 37.0 50-54 36.305099999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.2669 37.0 37.0 37.0 37.0 37.0 60-64 36.28869999999999 37.0 37.0 37.0 37.0 37.0 65-69 36.255 37.0 37.0 37.0 37.0 37.0 70-74 36.2156 37.0 37.0 37.0 37.0 37.0 75-79 36.218900000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.131 37.0 37.0 37.0 37.0 37.0 85-89 36.1175 37.0 37.0 37.0 37.0 37.0 90-94 36.1922 37.0 37.0 37.0 37.0 37.0 95-99 36.0927 37.0 37.0 37.0 37.0 37.0 100-104 36.0398 37.0 37.0 37.0 37.0 37.0 105-109 36.0809 37.0 37.0 37.0 37.0 37.0 110-114 36.027100000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.9837 37.0 37.0 37.0 37.0 37.0 120-124 35.9947 37.0 37.0 37.0 37.0 37.0 125-129 35.930800000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.969199999999994 37.0 37.0 37.0 37.0 37.0 135-139 35.9588 37.0 37.0 37.0 37.0 37.0 140-144 35.748000000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.6423 37.0 37.0 37.0 37.0 37.0 150-151 35.45 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 1.0 23 5.0 24 3.0 25 1.0 26 3.0 27 8.0 28 18.0 29 31.0 30 29.0 31 40.0 32 60.0 33 96.0 34 145.0 35 285.0 36 2759.0 37 514.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 50.05 12.325 7.049999999999999 30.575000000000003 2 22.441831373530146 14.385789342006506 35.15136352264198 28.021015761821367 3 21.25 22.025 27.400000000000002 29.325000000000003 4 26.974999999999998 28.625 21.025 23.375 5 22.975 33.475 21.275 22.275 6 21.25 33.875 23.425 21.45 7 18.5 19.825 40.2 21.475 8 19.625 21.15 28.525 30.7 9 23.175 18.9 30.8 27.125 10-14 23.87 25.650000000000002 24.404999999999998 26.075 15-19 24.169999999999998 25.305 24.779999999999998 25.745 20-24 23.845 25.005 25.135 26.015 25-29 24.05 25.31 24.515 26.125 30-34 23.74 24.72 25.619999999999997 25.919999999999998 35-39 23.915 25.03 24.97 26.085 40-44 23.91 25.19 25.31 25.590000000000003 45-49 24.295 24.975 24.740000000000002 25.990000000000002 50-54 24.01 25.019999999999996 24.745 26.224999999999998 55-59 23.285 25.790000000000003 24.695 26.229999999999997 60-64 23.849999999999998 24.75 24.875 26.525 65-69 23.755000000000003 25.230000000000004 25.264999999999997 25.75 70-74 23.995 25.22 25.1 25.685000000000002 75-79 24.22 24.95 24.740000000000002 26.090000000000003 80-84 24.565 24.905 24.72 25.81 85-89 24.57 24.89 24.64 25.900000000000002 90-94 24.54 24.85 24.58 26.029999999999998 95-99 24.745 24.654999999999998 24.709999999999997 25.89 100-104 24.695 24.68 24.36 26.265 105-109 24.845 25.0 24.285 25.869999999999997 110-114 24.825 24.975 24.9 25.3 115-119 24.759999999999998 24.685000000000002 24.195 26.36 120-124 24.154999999999998 24.65 24.245 26.950000000000003 125-129 25.19 24.33 24.435000000000002 26.045 130-134 25.495 24.990000000000002 23.555 25.96 135-139 25.380000000000003 24.64 23.955000000000002 26.025 140-144 25.05 25.165 23.29 26.495 145-149 25.275 24.54 24.115000000000002 26.07 150-151 25.4 24.4875 23.150000000000002 26.9625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 0.5 22 1.5 23 1.5 24 0.5 25 1.5 26 3.0 27 3.5 28 3.5 29 6.5 30 10.0 31 11.0 32 12.0 33 18.5 34 26.0 35 36.5 36 44.5 37 59.5 38 75.0 39 83.5 40 115.0 41 136.5 42 160.0 43 166.0 44 163.0 45 187.5 46 197.5 47 181.0 48 175.0 49 185.5 50 168.5 51 139.0 52 123.5 53 126.0 54 117.0 55 97.5 56 92.0 57 80.5 58 85.0 59 89.0 60 81.0 61 77.5 62 69.5 63 70.5 64 69.0 65 68.0 66 66.0 67 62.5 68 57.5 69 46.5 70 33.5 71 28.0 72 22.0 73 17.0 74 14.0 75 7.5 76 7.5 77 8.0 78 4.5 79 1.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.675 #Duplication Level Percentage of deduplicated Percentage of total 1 91.87346604854105 84.22500000000001 2 7.2811562585219525 13.350000000000001 3 0.7362967002999727 2.025 4 0.109080992637033 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.5874999999999999 0.0 0.0 0.0 0.0 98-99 0.7625 0.0 0.0 0.0 0.0 100-101 0.8999999999999999 0.0 0.0 0.0 0.0 102-103 1.0125 0.0 0.0 0.0 0.0 104-105 1.1625 0.0 0.0 0.0 0.0 106-107 1.3125 0.0 0.0 0.0 0.0 108-109 1.5 0.0 0.0 0.0 0.0 110-111 1.7125 0.0 0.0 0.0 0.0 112-113 1.875 0.0 0.0 0.0 0.0 114-115 2.075 0.0 0.0 0.0 0.0 116-117 2.4875 0.0 0.0 0.0 0.0 118-119 2.7625 0.0 0.0 0.0 0.0 120-121 3.0625 0.0 0.0 0.0 0.0 122-123 3.3625 0.0 0.0 0.0 0.0 124-125 3.725 0.0 0.0 0.0 0.0 126-127 4.2 0.0 0.0 0.0 0.0 128-129 4.5875 0.0 0.0 0.0 0.0 130-131 4.925 0.0 0.0 0.0 0.0 132-133 5.2375 0.0 0.0 0.0 0.0 134-135 5.75 0.0 0.0 0.0 0.0 136-137 6.2125 0.0 0.0 0.0 0.0 138-139 6.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACATGG 10 0.006830828 145.0 3 CGTAGTA 10 0.006830828 145.0 145 AAGTCAA 10 0.006830828 145.0 5 ACTCCAG 35 0.0035366106 20.714287 140-144 TCTGAAC 35 0.0035366106 20.714287 135-139 >>END_MODULE SRR12666605 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666605_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.7455 37.0 37.0 37.0 37.0 37.0 2 35.7615 37.0 37.0 37.0 37.0 37.0 3 35.883 37.0 37.0 37.0 37.0 37.0 4 36.02 37.0 37.0 37.0 37.0 37.0 5 35.964 37.0 37.0 37.0 37.0 37.0 6 35.9565 37.0 37.0 37.0 37.0 37.0 7 36.0345 37.0 37.0 37.0 37.0 37.0 8 35.9385 37.0 37.0 37.0 37.0 37.0 9 36.037 37.0 37.0 37.0 37.0 37.0 10-14 36.022800000000004 37.0 37.0 37.0 37.0 37.0 15-19 35.8886 37.0 37.0 37.0 37.0 37.0 20-24 35.854 37.0 37.0 37.0 37.0 37.0 25-29 35.8072 37.0 37.0 37.0 37.0 37.0 30-34 35.7909 37.0 37.0 37.0 37.0 37.0 35-39 35.7466 37.0 37.0 37.0 37.0 37.0 40-44 35.76180000000001 37.0 37.0 37.0 37.0 37.0 45-49 35.682100000000005 37.0 37.0 37.0 37.0 37.0 50-54 35.6687 37.0 37.0 37.0 37.0 37.0 55-59 35.6531 37.0 37.0 37.0 37.0 37.0 60-64 35.631099999999996 37.0 37.0 37.0 37.0 37.0 65-69 35.561 37.0 37.0 37.0 37.0 37.0 70-74 35.546499999999995 37.0 37.0 37.0 37.0 37.0 75-79 35.6038 37.0 37.0 37.0 37.0 37.0 80-84 35.585300000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.5228 37.0 37.0 37.0 37.0 37.0 90-94 35.5135 37.0 37.0 37.0 37.0 37.0 95-99 35.495000000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.4953 37.0 37.0 37.0 37.0 37.0 105-109 35.4951 37.0 37.0 37.0 37.0 37.0 110-114 35.4274 37.0 37.0 37.0 37.0 37.0 115-119 35.35379999999999 37.0 37.0 37.0 37.0 37.0 120-124 35.379900000000006 37.0 37.0 37.0 37.0 37.0 125-129 35.3856 37.0 37.0 37.0 37.0 37.0 130-134 35.499 37.0 37.0 37.0 37.0 37.0 135-139 35.2618 37.0 37.0 37.0 37.0 37.0 140-144 35.0738 37.0 37.0 37.0 25.0 37.0 145-149 35.053399999999996 37.0 37.0 37.0 27.4 37.0 150-151 34.768 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 6.0 14 9.0 15 8.0 16 6.0 17 8.0 18 6.0 19 8.0 20 8.0 21 18.0 22 12.0 23 17.0 24 16.0 25 15.0 26 12.0 27 14.0 28 15.0 29 28.0 30 31.0 31 37.0 32 53.0 33 84.0 34 162.0 35 422.0 36 2529.0 37 474.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 51.175000000000004 15.45 8.55 24.825 2 29.025000000000002 19.15 27.675 24.15 3 25.8 23.1 27.3 23.799999999999997 4 28.925 30.425 18.275 22.375 5 28.9 33.125 17.375 20.599999999999998 6 24.85 32.375 19.2 23.575 7 24.425 16.425 33.925 25.224999999999998 8 23.674999999999997 20.925 22.075 33.324999999999996 9 26.400000000000002 20.825 24.7 28.075 10-14 27.455000000000002 24.385 22.68 25.480000000000004 15-19 26.625 24.51 23.68 25.185000000000002 20-24 26.950000000000003 25.635 22.86 24.555 25-29 27.16 24.625 23.145 25.069999999999997 30-34 27.045 24.965 23.015 24.975 35-39 26.735 24.41 23.685000000000002 25.169999999999998 40-44 26.85 24.465 23.145 25.540000000000003 45-49 26.435 24.94 23.89 24.735 50-54 26.305 25.130000000000003 23.064999999999998 25.5 55-59 26.334999999999997 24.79 23.405 25.47 60-64 26.669999999999998 25.11 23.39 24.83 65-69 26.740000000000002 25.035 23.400000000000002 24.825 70-74 26.474999999999998 24.675 23.330000000000002 25.52 75-79 25.729999999999997 25.535000000000004 23.56 25.174999999999997 80-84 26.735 25.575 22.71 24.98 85-89 26.51 24.529999999999998 23.65 25.31 90-94 26.145000000000003 25.05 23.724999999999998 25.080000000000002 95-99 26.715 25.415 23.419999999999998 24.45 100-104 27.310000000000002 25.155 23.185 24.349999999999998 105-109 26.44 25.779999999999998 23.165 24.615000000000002 110-114 26.955000000000002 25.53 23.1 24.415 115-119 27.27 25.490000000000002 22.465 24.775 120-124 27.025 25.885 23.005 24.085 125-129 26.815 26.13 22.775000000000002 24.279999999999998 130-134 27.284999999999997 25.619999999999997 23.185 23.91 135-139 27.51 25.945 22.965 23.580000000000002 140-144 27.32 25.655 23.35 23.674999999999997 145-149 28.015 26.005 22.615 23.365 150-151 27.6375 26.450000000000003 23.400000000000002 22.5125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.5 7 0.5 8 0.0 9 1.0 10 2.0 11 1.0 12 1.0 13 1.5 14 0.5 15 1.0 16 1.5 17 1.5 18 1.5 19 1.5 20 1.0 21 1.5 22 2.0 23 2.5 24 3.5 25 2.0 26 2.5 27 4.5 28 6.5 29 6.5 30 7.5 31 11.5 32 13.0 33 11.5 34 16.0 35 24.5 36 29.0 37 42.5 38 62.0 39 74.0 40 83.5 41 112.5 42 142.5 43 146.0 44 159.5 45 161.0 46 162.0 47 172.5 48 161.5 49 146.0 50 152.0 51 146.0 52 118.0 53 107.0 54 99.5 55 101.5 56 100.0 57 102.5 58 107.0 59 95.5 60 82.5 61 89.5 62 108.5 63 108.5 64 92.5 65 83.5 66 71.0 67 59.5 68 66.0 69 62.5 70 54.5 71 50.5 72 35.0 73 28.0 74 27.5 75 15.0 76 6.5 77 5.0 78 4.0 79 3.0 80 2.0 81 2.0 82 1.0 83 0.0 84 1.0 85 1.0 86 0.5 87 0.5 88 1.0 89 1.0 90 0.0 91 1.0 92 1.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.5 98 1.5 99 1.0 100 7.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.14999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 91.79923203510697 83.675 2 7.295666483817882 13.3 3 0.7405375754251234 2.025 4 0.10970927043335163 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.027427317608337907 0.2 9 0.0 0.0 >10 0.027427317608337907 0.4 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 16 0.4 No Hit GCCAGCCTCACACTCTTAGGAGAGCACGGTACAGCAGTACATCAATGGCG 8 0.2 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.5375000000000001 0.0 0.0 0.0 0.0 98-99 0.7124999999999999 0.0 0.0 0.0 0.0 100-101 0.8500000000000001 0.0 0.0 0.0 0.0 102-103 0.975 0.0 0.0 0.0 0.0 104-105 1.1375000000000002 0.0 0.0 0.0 0.0 106-107 1.2875 0.0 0.0 0.0 0.0 108-109 1.4375 0.0 0.0 0.0 0.0 110-111 1.6375 0.0 0.0 0.0 0.0 112-113 1.8125 0.0 0.0 0.0 0.0 114-115 2.0250000000000004 0.0 0.0 0.0 0.0 116-117 2.425 0.0 0.0 0.0 0.0 118-119 2.7125000000000004 0.0 0.0 0.0 0.0 120-121 3.0 0.0 0.0 0.0 0.0 122-123 3.2875 0.0 0.0 0.0 0.0 124-125 3.65 0.0 0.0 0.0 0.0 126-127 4.15 0.0 0.0 0.0 0.0 128-129 4.5375 0.0 0.0 0.0 0.0 130-131 4.9 0.0 0.0 0.0 0.0 132-133 5.2125 0.0 0.0 0.0 0.0 134-135 5.7 0.0 0.0 0.0 0.0 136-137 6.1625 0.0 0.0 0.0 0.0 138-139 6.762499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTAGGGA 35 0.0035366106 20.714287 135-139 GAAAGAG 35 0.0035366106 20.714287 140-144 >>END_MODULE Read 1610569 spots for SRR12666605.sra Written 1610569 spots for SRR12666605.sra Read 1610569 spots for SRR12666605.sra Written 1610569 spots for SRR12666605.sra Read 1610569 spots for SRR12666605.sra Written 1610569 spots for SRR12666605.sra Read 1610569 spots for SRR12666605.sra Written 1610569 spots for SRR12666605.sra Read 1610569 spots for SRR12666605.sra Written 1610569 spots for SRR12666605.sra Read 1610569 spots for SRR12666605.sra Written 1610569 spots for SRR12666605.sra Read 1610577 spots for SRR12666605.sra Written 1610577 spots for SRR12666605.sra Read 1610569 spots for SRR12666605.sra Written 1610569 spots for SRR12666605.sra Read 1610569 spots for SRR12666605.sra Written 1610569 spots for SRR12666605.sra Read 1610569 spots for SRR12666605.sra Written 1610569 spots for SRR12666605.sra Read 1610569 spots for SRR12666605.sra Written 1610569 spots for SRR12666605.sra Read 1610569 spots for SRR12666605.sra Written 1610569 spots for SRR12666605.sra Read 1610569 spots for SRR12666605.sra Written 1610569 spots for SRR12666605.sra Read 1610569 spots for SRR12666605.sra Written 1610569 spots for SRR12666605.sra Read 1610569 spots for SRR12666605.sra Written 1610569 spots for SRR12666605.sra Read 1610569 spots for SRR12666605.sra Written 1610569 spots for SRR12666605.sra Read 1610569 spots for SRR12666605.sra Written 1610569 spots for SRR12666605.sra Read 1610569 spots for SRR12666605.sra Written 1610569 spots for SRR12666605.sra Read 1610569 spots for SRR12666605.sra Written 1610569 spots for SRR12666605.sra Read 1610569 spots for SRR12666605.sra Written 1610569 spots for SRR12666605.sra SRR ids: ['SRR12666605.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0lavlkds SRR12666605.sra spots: 32211388 blocks: [[1, 1610569], [1610570, 3221138], [3221139, 4831707], [4831708, 6442276], [6442277, 8052845], [8052846, 9663414], [9663415, 11273983], [11273984, 12884552], [12884553, 14495121], [14495122, 16105690], [16105691, 17716259], [17716260, 19326828], [19326829, 20937397], [20937398, 22547966], [22547967, 24158535], [24158536, 25769104], [25769105, 27379673], [27379674, 28990242], [28990243, 30600811], [30600812, 32211388]] SRR12666605 file size 10925138 SRR12666605 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12666605 SRR12666605_1.fastq SRR12666605_2.fastq Input file: SRR12666605_1.fastq Paired file: SRR12666605_2.fastq trimmed: SRR12666605-trimmed-pair1.fastq, SRR12666605-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 17:53:00 2024 >> started Sat Dec 7 17:53:36 2024 >> done (36.467s) 32211388 read pairs processed; of these: 89 ( 0.00%) short read pairs filtered out after trimming by size control 24697 ( 0.08%) empty read pairs filtered out after trimming by size control 32186602 (99.92%) read pairs available; of these: 3399844 (10.56%) trimmed read pairs available after processing 28786758 (89.44%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 14 0.00% 20 13 0.00% 21 15 0.00% 22 19 0.00% 23 14 0.00% 24 21 0.00% 25 27 0.00% 26 31 0.00% 27 32 0.00% 28 43 0.00% 29 32 0.00% 30 45 0.00% 31 45 0.00% 32 38 0.00% 33 60 0.00% 34 54 0.00% 35 49 0.00% 36 39 0.00% 37 45 0.00% 38 57 0.00% 39 45 0.00% 40 51 0.00% 41 43 0.00% 42 69 0.00% 43 57 0.00% 44 71 0.00% 45 75 0.00% 46 69 0.00% 47 189 0.00% 48 75 0.00% 49 91 0.00% 50 110 0.00% 51 94 0.00% 52 114 0.00% 53 109 0.00% 54 129 0.00% 55 155 0.00% 56 136 0.00% 57 174 0.00% 58 163 0.00% 59 207 0.00% 60 221 0.00% 61 275 0.00% 62 303 0.00% 63 352 0.00% 64 401 0.00% 65 427 0.00% 66 460 0.00% 67 526 0.00% 68 589 0.00% 69 712 0.00% 70 816 0.00% 71 991 0.00% 72 1087 0.00% 73 1339 0.00% 74 1462 0.00% 75 1641 0.01% 76 1841 0.01% 77 2112 0.01% 78 2269 0.01% 79 2687 0.01% 80 3070 0.01% 81 3577 0.01% 82 4221 0.01% 83 4574 0.01% 84 5357 0.02% 85 5829 0.02% 86 6192 0.02% 87 6927 0.02% 88 7648 0.02% 89 8408 0.03% 90 9424 0.03% 91 10563 0.03% 92 11815 0.04% 93 13019 0.04% 94 14105 0.04% 95 15514 0.05% 96 15994 0.05% 97 17102 0.05% 98 18122 0.06% 99 19513 0.06% 100 20433 0.06% 101 22205 0.07% 102 24456 0.08% 103 26348 0.08% 104 28093 0.09% 105 29372 0.09% 106 31141 0.10% 107 31356 0.10% 108 33091 0.10% 109 34310 0.11% 110 35889 0.11% 111 38128 0.12% 112 40465 0.13% 113 42510 0.13% 114 45273 0.14% 115 46665 0.14% 116 48130 0.15% 117 49832 0.15% 118 49928 0.16% 119 50896 0.16% 120 52837 0.16% 121 54109 0.17% 122 56305 0.17% 123 59436 0.18% 124 63280 0.20% 125 64148 0.20% 126 67151 0.21% 127 67397 0.21% 128 67634 0.21% 129 68682 0.21% 130 69581 0.22% 131 70432 0.22% 132 73442 0.23% 133 75976 0.24% 134 78411 0.24% 135 81621 0.25% 136 82598 0.26% 137 83611 0.26% 138 84799 0.26% 139 84313 0.26% 140 85806 0.27% 141 87618 0.27% 142 89392 0.28% 143 90211 0.28% 144 94821 0.29% 145 97712 0.30% 146 98520 0.31% 147 98321 0.31% 148 100047 0.31% 149 98979 0.31% 150 99719 0.31% 151 28786758 89.44% 32186602 reads passed initial QC criterion=sequence-density sequence-density=0.79 sequence-density-rank=1 fanout-score=3.22 fanout-score-rank=13 prefix-density=0.85 prefix-fanout=3.0 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.11 sequence-density-rank=31 fanout-score=11.35 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=3.0 sequence=AGCTTGAGGGTGTAGCTGGCGACTTGCTCAGGGGTGGCCCGCTCCTTGCACTCGGCGCCGGGTGTCACCATGCTGGGCTTGAGGAGGATGCCCTCGAACAAGACGTTGTTCTGGGCCATGTAGTAGAAAGTCTCCGCCCACACCTTCTGCGCCACCTCGAAGGTCCTGTCGATGCCGTGCTCGCCGTCCAGCAGGATCTCCGGCTCCACAATCGGCACCAGACCGTTGTCCTGAGAGATGGCAGCGTAACGGGCAAGACCCCATGCAGCTTCCTTGACAGCAAGCTCAGATGGGCCGTTGGGGATGCTGACGACAGTGCGCCACTTGGCGAAGCGGGCGCCTTGCTGGTAGTAGGCTGCCTCACGGGAGGCAAGGCCATCAAGACCTTGGCACCATGACTCGTCGTTGGAACCAACGAGTGGCACAAGACCCTTGTCAACCTTGATGCCGGGAACG criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=3.75 fanout-score-rank=18 prefix-density=0.66 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAGCTCCCCTGGGTACTATGATGGCAGGTACTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=98.01 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=6.6 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR12666605 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 17:55:12 Started mapping on | Dec 07 17:55:12 Finished on | Dec 07 17:58:17 Mapping speed, Million of reads per hour | 626.33 Number of input reads | 32186602 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 30308597 Uniquely mapped reads % | 94.17% Average mapped length | 296.27 Number of splices: Total | 32683466 Number of splices: Annotated (sjdb) | 30892788 Number of splices: GT/AG | 32228276 Number of splices: GC/AG | 405779 Number of splices: AT/AC | 14797 Number of splices: Non-canonical | 34614 Mismatch rate per base, % | 0.12% Deletion rate per base | 0.00% Deletion average length | 1.49 Insertion rate per base | 0.00% Insertion average length | 1.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 360019 % of reads mapped to multiple loci | 1.12% Number of reads mapped to too many loci | 42981 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.86% % of reads unmapped: other | 0.72% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1517986 1517986 1517986 N_multimapping 360019 360019 360019 N_noFeature 997874 29502610 1200238 N_ambiguous 718664 4081 116179 UnstrandedReadsAssigned:28592059 PositiveStrandReadsAssigned:801906 NegativeStrandReadsAssigned:28992180 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12666605 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12666605-trimmed-pair1.fastq SRR12666605-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,186,602 reads, 29,693,973 reads pseudoaligned [quant] estimated average fragment length: 272.918 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,208 rounds 52973 SRR12666605.ke.tsv 35125 SRR12666605.se.tsv 88098 total ==> SRR12666605.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 664.8 0 0 PNS24247 1044 772.082 62.6737 3.86983 PNS24249 1928 1656.08 52.8524 1.52143 PNS24246 1044 772.082 62.6737 3.86983 PNS24248 1044 772.082 62.6737 3.86983 PNS24244 1471 1199.08 134.126 5.33255 PNS24243 293 95.3711 0 0 KQK14069 1603 1331.08 420.074 15.045 KQK14071 474 232.757 36.4633 7.46832 ==> SRR12666605.se.tsv <== BRADI_1g14170v3 565 BRADI_1g53295v3 190 BRADI_1g59795v3 939 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 543 BRADI_1g74790v3 243 BRADI_1g09890v3 0 BRADI_1g77505v3 296 BRADI_1g48960v3 0 SRR12666605 completed mapping pipeline successfully