Starting /dee2/code/volunteer_pipeline.sh SRR12666906 current disk space = 1540923772928 free memory = 1602352368 SRR12666906 SRAfilesize d246f32ed409615753b25f290cb1512b SRR12666906.sra SRR12666906.sra file validated SRR12666906 is paired end SRR12666906 is conventional basespace SRR12666906 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666906_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5585 37.0 37.0 37.0 37.0 37.0 2 36.25825 37.0 37.0 37.0 37.0 37.0 3 36.526 37.0 37.0 37.0 37.0 37.0 4 36.5725 37.0 37.0 37.0 37.0 37.0 5 36.555 37.0 37.0 37.0 37.0 37.0 6 36.6115 37.0 37.0 37.0 37.0 37.0 7 36.4865 37.0 37.0 37.0 37.0 37.0 8 36.6395 37.0 37.0 37.0 37.0 37.0 9 36.641 37.0 37.0 37.0 37.0 37.0 10-14 36.5866 37.0 37.0 37.0 37.0 37.0 15-19 36.5702 37.0 37.0 37.0 37.0 37.0 20-24 36.503699999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.52669999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.464999999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.450599999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.4163 37.0 37.0 37.0 37.0 37.0 45-49 36.3352 37.0 37.0 37.0 37.0 37.0 50-54 36.391999999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.3723 37.0 37.0 37.0 37.0 37.0 60-64 36.34159999999999 37.0 37.0 37.0 37.0 37.0 65-69 36.314299999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.2821 37.0 37.0 37.0 37.0 37.0 75-79 36.2769 37.0 37.0 37.0 37.0 37.0 80-84 36.2634 37.0 37.0 37.0 37.0 37.0 85-89 36.2155 37.0 37.0 37.0 37.0 37.0 90-94 36.268299999999996 37.0 37.0 37.0 37.0 37.0 95-99 36.1289 37.0 37.0 37.0 37.0 37.0 100-104 36.14790000000001 37.0 37.0 37.0 37.0 37.0 105-109 36.2278 37.0 37.0 37.0 37.0 37.0 110-114 36.107800000000005 37.0 37.0 37.0 37.0 37.0 115-119 36.028800000000004 37.0 37.0 37.0 37.0 37.0 120-124 36.037099999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.972300000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.9541 37.0 37.0 37.0 37.0 37.0 135-139 35.9867 37.0 37.0 37.0 37.0 37.0 140-144 35.826499999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.6888 37.0 37.0 37.0 37.0 37.0 150-151 35.46 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 0.0 22 1.0 23 1.0 24 2.0 25 3.0 26 5.0 27 4.0 28 16.0 29 14.0 30 24.0 31 47.0 32 54.0 33 94.0 34 127.0 35 265.0 36 2844.0 37 498.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 52.625 11.75 5.225 30.4 2 23.967975981986488 13.88541406054541 36.85263947960971 25.293970477858394 3 20.674999999999997 22.2 27.900000000000002 29.225 4 27.425 28.275 20.974999999999998 23.325000000000003 5 25.650000000000002 32.300000000000004 22.75 19.3 6 21.525 32.95 23.9 21.625 7 18.5 20.225 40.775 20.5 8 20.150000000000002 21.675 28.775000000000002 29.4 9 18.9 19.025 32.324999999999996 29.75 10-14 24.245 25.395 24.07 26.290000000000003 15-19 24.08 24.79 24.985 26.145000000000003 20-24 23.53 24.675 25.235000000000003 26.56 25-29 23.665 24.195 25.255 26.884999999999998 30-34 24.01 24.87 24.7 26.419999999999998 35-39 23.5 24.605 25.34 26.555 40-44 24.455 23.89 24.84 26.815 45-49 23.95 24.675 24.525 26.85 50-54 23.765 24.165 25.83 26.240000000000002 55-59 24.235 24.555 24.455 26.755000000000003 60-64 24.42 24.255 24.545 26.779999999999998 65-69 24.91 23.669999999999998 24.87 26.55 70-74 24.59 24.32 24.63 26.46 75-79 24.75 24.4 24.88 25.97 80-84 24.759999999999998 24.165 24.555 26.52 85-89 24.385 23.87 25.005 26.740000000000002 90-94 24.87 24.395 23.96 26.775 95-99 24.66 24.02 24.715 26.605 100-104 24.785 24.22 24.73 26.265 105-109 25.555 24.16 23.86 26.424999999999997 110-114 24.545 24.46 24.665 26.33 115-119 25.6 24.44 23.785 26.174999999999997 120-124 25.255 24.005000000000003 23.799999999999997 26.939999999999998 125-129 24.955 24.13 25.14 25.775 130-134 25.474999999999998 23.54 24.205 26.779999999999998 135-139 25.380000000000003 23.69 24.099999999999998 26.83 140-144 25.055 23.9 24.060000000000002 26.985 145-149 25.06 24.08 24.425 26.435 150-151 25.55 22.975 24.45 27.025 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.5 25 1.0 26 0.0 27 0.0 28 1.5 29 6.0 30 7.0 31 7.5 32 14.0 33 25.5 34 31.0 35 32.5 36 40.0 37 55.5 38 77.5 39 93.5 40 105.0 41 131.0 42 140.5 43 152.5 44 167.0 45 170.5 46 169.5 47 167.5 48 168.5 49 162.0 50 165.0 51 147.5 52 143.5 53 135.5 54 110.0 55 98.5 56 106.0 57 99.5 58 85.5 59 89.5 60 82.0 61 82.0 62 75.0 63 66.5 64 74.0 65 83.5 66 76.5 67 61.5 68 53.5 69 46.0 70 38.5 71 35.0 72 32.5 73 26.0 74 19.5 75 12.5 76 7.0 77 5.5 78 5.5 79 3.0 80 2.0 81 1.5 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.9 #Duplication Level Percentage of deduplicated Percentage of total 1 91.17161716171617 82.875 2 7.838283828382838 14.249999999999998 3 0.7975797579757976 2.175 4 0.1925192519251925 0.7000000000000001 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.42500000000000004 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.625 0.0 0.0 0.0 0.0 100-101 0.7250000000000001 0.0 0.0 0.0 0.0 102-103 0.8625 0.0 0.0 0.0 0.0 104-105 0.975 0.0 0.0 0.0 0.0 106-107 1.0375 0.0 0.0 0.0 0.0 108-109 1.1 0.0 0.0 0.0 0.0 110-111 1.3875 0.0 0.0 0.0 0.0 112-113 1.6375000000000002 0.0 0.0 0.0 0.0 114-115 1.9375 0.0 0.0 0.0 0.0 116-117 2.3625 0.0 0.0 0.0 0.0 118-119 2.5999999999999996 0.0 0.0 0.0 0.0 120-121 2.8875 0.0 0.0 0.0 0.0 122-123 3.1125 0.0 0.0 0.0 0.0 124-125 3.575 0.0 0.0 0.0 0.0 126-127 4.125 0.0 0.0 0.0 0.0 128-129 4.525 0.0 0.0 0.0 0.0 130-131 4.824999999999999 0.0 0.0 0.0 0.0 132-133 5.375 0.0 0.0 0.0 0.0 134-135 5.8125 0.0 0.0 0.0 0.0 136-137 6.237500000000001 0.0 0.0 0.0 0.0 138-139 6.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12666906 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666906_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0455 37.0 37.0 37.0 37.0 37.0 2 36.0765 37.0 37.0 37.0 37.0 37.0 3 36.2015 37.0 37.0 37.0 37.0 37.0 4 36.2265 37.0 37.0 37.0 37.0 37.0 5 36.2995 37.0 37.0 37.0 37.0 37.0 6 36.0825 37.0 37.0 37.0 37.0 37.0 7 36.1165 37.0 37.0 37.0 37.0 37.0 8 36.25 37.0 37.0 37.0 37.0 37.0 9 36.2645 37.0 37.0 37.0 37.0 37.0 10-14 36.2504 37.0 37.0 37.0 37.0 37.0 15-19 36.245799999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.2056 37.0 37.0 37.0 37.0 37.0 25-29 36.15560000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.160700000000006 37.0 37.0 37.0 37.0 37.0 35-39 36.19029999999999 37.0 37.0 37.0 37.0 37.0 40-44 36.1397 37.0 37.0 37.0 37.0 37.0 45-49 36.0937 37.0 37.0 37.0 37.0 37.0 50-54 36.06920000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.0554 37.0 37.0 37.0 37.0 37.0 60-64 36.0372 37.0 37.0 37.0 37.0 37.0 65-69 36.0191 37.0 37.0 37.0 37.0 37.0 70-74 35.949799999999996 37.0 37.0 37.0 37.0 37.0 75-79 35.9839 37.0 37.0 37.0 37.0 37.0 80-84 35.984700000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.8868 37.0 37.0 37.0 37.0 37.0 90-94 35.910199999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.8884 37.0 37.0 37.0 37.0 37.0 100-104 35.897400000000005 37.0 37.0 37.0 37.0 37.0 105-109 35.91330000000001 37.0 37.0 37.0 37.0 37.0 110-114 35.8429 37.0 37.0 37.0 37.0 37.0 115-119 35.7559 37.0 37.0 37.0 37.0 37.0 120-124 35.7965 37.0 37.0 37.0 37.0 37.0 125-129 35.830200000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.720800000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.6392 37.0 37.0 37.0 37.0 37.0 140-144 35.4961 37.0 37.0 37.0 37.0 37.0 145-149 35.4741 37.0 37.0 37.0 37.0 37.0 150-151 35.06375 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 10.0 14 7.0 15 0.0 16 0.0 17 3.0 18 1.0 19 3.0 20 4.0 21 8.0 22 4.0 23 10.0 24 6.0 25 7.0 26 7.0 27 10.0 28 9.0 29 17.0 30 21.0 31 33.0 32 56.0 33 85.0 34 147.0 35 398.0 36 2659.0 37 494.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 51.5 16.875 6.35 25.275 2 28.499999999999996 21.0 27.650000000000002 22.85 3 25.95 22.900000000000002 26.400000000000002 24.75 4 27.025 32.6 17.65 22.725 5 28.050000000000004 33.675 17.349999999999998 20.925 6 23.75 35.575 17.625 23.05 7 21.575 17.150000000000002 35.099999999999994 26.174999999999997 8 21.7 20.674999999999997 24.65 32.975 9 24.6 21.475 23.799999999999997 30.125 10-14 27.055 24.995 22.53 25.419999999999998 15-19 26.415 24.2 23.055 26.33 20-24 26.565 24.3 22.869999999999997 26.265 25-29 26.924999999999997 24.57 22.79 25.715 30-34 26.340000000000003 24.665 23.18 25.814999999999998 35-39 26.695 24.505 22.99 25.81 40-44 26.640000000000004 24.224999999999998 23.185 25.95 45-49 27.034999999999997 24.224999999999998 23.505000000000003 25.235000000000003 50-54 26.865 24.435000000000002 23.01 25.69 55-59 27.01 24.575 22.634999999999998 25.779999999999998 60-64 27.694999999999997 24.63 22.355 25.319999999999997 65-69 27.279999999999998 24.279999999999998 22.89 25.55 70-74 26.729999999999997 24.279999999999998 23.294999999999998 25.695 75-79 26.924999999999997 24.505 22.725 25.845000000000002 80-84 27.165 24.365000000000002 23.044999999999998 25.424999999999997 85-89 27.089999999999996 24.67 22.765 25.474999999999998 90-94 26.974999999999998 24.310000000000002 23.375 25.34 95-99 26.795 24.349999999999998 23.21 25.645 100-104 27.145000000000003 24.41 23.005 25.44 105-109 26.66 24.505 23.425 25.41 110-114 27.565 25.145 23.145 24.145 115-119 27.18 25.650000000000002 22.585 24.585 120-124 28.16 24.705 22.814999999999998 24.32 125-129 27.185 25.05 22.945 24.82 130-134 28.065 24.145 23.3 24.490000000000002 135-139 27.67 24.875 23.419999999999998 24.035 140-144 27.689999999999998 25.35 22.745 24.215 145-149 27.965 24.73 23.75 23.555 150-151 28.3875 25.05 23.4625 23.1 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.5 16 0.5 17 0.5 18 1.0 19 1.0 20 1.0 21 1.0 22 1.0 23 1.0 24 0.5 25 0.5 26 1.5 27 1.5 28 2.0 29 3.0 30 3.5 31 8.0 32 9.0 33 10.0 34 15.5 35 17.0 36 26.0 37 52.5 38 70.5 39 76.5 40 87.0 41 106.0 42 112.0 43 111.5 44 143.0 45 169.5 46 167.5 47 166.0 48 167.5 49 148.5 50 126.5 51 129.0 52 126.0 53 118.0 54 114.0 55 115.5 56 106.5 57 102.0 58 109.0 59 103.0 60 103.0 61 96.0 62 96.5 63 101.5 64 99.0 65 93.0 66 76.5 67 80.5 68 89.5 69 69.0 70 50.5 71 52.0 72 45.5 73 34.0 74 23.5 75 12.5 76 9.0 77 9.5 78 7.0 79 2.0 80 2.5 81 2.0 82 0.5 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.5 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.225 #Duplication Level Percentage of deduplicated Percentage of total 1 90.82848434469382 81.95 2 8.063175394846219 14.549999999999999 3 0.8035466888334718 2.175 4 0.1662510390689942 0.6 5 0.0831255195344971 0.375 6 0.02770850651149903 0.15 7 0.0 0.0 8 0.02770850651149903 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 8 0.2 No Hit CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 6 0.15 No Hit GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit GCCCATCTTAGTTAACTTAGCAAACACGAGGAGTCTCACCATGCCATTGC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.2125 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.42500000000000004 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.625 0.0 0.0 0.0 0.0 100-101 0.7250000000000001 0.0 0.0 0.0 0.0 102-103 0.8625 0.0 0.0 0.0 0.0 104-105 0.975 0.0 0.0 0.0 0.0 106-107 1.0375 0.0 0.0 0.0 0.0 108-109 1.1 0.0 0.0 0.0 0.0 110-111 1.3875 0.0 0.0 0.0 0.0 112-113 1.6375000000000002 0.0 0.0 0.0 0.0 114-115 1.9375 0.0 0.0 0.0 0.0 116-117 2.3625 0.0 0.0 0.0 0.0 118-119 2.5999999999999996 0.0 0.0 0.0 0.0 120-121 2.8875 0.0 0.0 0.0 0.0 122-123 3.0875 0.0 0.0 0.0 0.0 124-125 3.5625 0.0 0.0 0.0 0.0 126-127 4.1 0.0 0.0 0.0 0.0 128-129 4.5 0.0 0.0 0.0 0.0 130-131 4.800000000000001 0.0 0.0 0.0 0.0 132-133 5.35 0.0 0.0 0.0 0.0 134-135 5.7875 0.0 0.0 0.0 0.0 136-137 6.225 0.0 0.0 0.0 0.0 138-139 6.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1666404 spots for SRR12666906.sra Written 1666404 spots for SRR12666906.sra Read 1666404 spots for SRR12666906.sra Written 1666404 spots for SRR12666906.sra Read 1666404 spots for SRR12666906.sra Written 1666404 spots for SRR12666906.sra Read 1666404 spots for SRR12666906.sra Written 1666404 spots for SRR12666906.sra Read 1666404 spots for SRR12666906.sra Written 1666404 spots for SRR12666906.sra Read 1666404 spots for SRR12666906.sra Written 1666404 spots for SRR12666906.sra Read 1666404 spots for SRR12666906.sra Written 1666404 spots for SRR12666906.sra Read 1666404 spots for SRR12666906.sra Written 1666404 spots for SRR12666906.sra Read 1666404 spots for SRR12666906.sra Written 1666404 spots for SRR12666906.sra Read 1666404 spots for SRR12666906.sra Written 1666404 spots for SRR12666906.sra Read 1666404 spots for SRR12666906.sra Written 1666404 spots for SRR12666906.sra Read 1666404 spots for SRR12666906.sra Written 1666404 spots for SRR12666906.sra Read 1666404 spots for SRR12666906.sra Written 1666404 spots for SRR12666906.sra Read 1666404 spots for SRR12666906.sra Written 1666404 spots for SRR12666906.sra Read 1666404 spots for SRR12666906.sra Written 1666404 spots for SRR12666906.sra Read 1666404 spots for SRR12666906.sra Written 1666404 spots for SRR12666906.sra Read 1666414 spots for SRR12666906.sra Written 1666414 spots for SRR12666906.sra Read 1666404 spots for SRR12666906.sra Written 1666404 spots for SRR12666906.sra Read 1666404 spots for SRR12666906.sra Written 1666404 spots for SRR12666906.sra Read 1666404 spots for SRR12666906.sra Written 1666404 spots for SRR12666906.sra SRR ids: ['SRR12666906.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_20w7flmz SRR12666906.sra spots: 33328090 blocks: [[1, 1666404], [1666405, 3332808], [3332809, 4999212], [4999213, 6665616], [6665617, 8332020], [8332021, 9998424], [9998425, 11664828], [11664829, 13331232], [13331233, 14997636], [14997637, 16664040], [16664041, 18330444], [18330445, 19996848], [19996849, 21663252], [21663253, 23329656], [23329657, 24996060], [24996061, 26662464], [26662465, 28328868], [28328869, 29995272], [29995273, 31661676], [31661677, 33328090]] SRR12666906 file size 11304642 SRR12666906 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12666906 SRR12666906_1.fastq SRR12666906_2.fastq Input file: SRR12666906_1.fastq Paired file: SRR12666906_2.fastq trimmed: SRR12666906-trimmed-pair1.fastq, SRR12666906-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 17:54:18 2024 >> started Sat Dec 7 17:54:55 2024 >> done (37.179s) 33328090 read pairs processed; of these: 98 ( 0.00%) short read pairs filtered out after trimming by size control 17268 ( 0.05%) empty read pairs filtered out after trimming by size control 33310724 (99.95%) read pairs available; of these: 3538210 (10.62%) trimmed read pairs available after processing 29772514 (89.38%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 17 0.00% 19 16 0.00% 20 15 0.00% 21 12 0.00% 22 11 0.00% 23 17 0.00% 24 24 0.00% 25 20 0.00% 26 24 0.00% 27 30 0.00% 28 31 0.00% 29 24 0.00% 30 34 0.00% 31 37 0.00% 32 44 0.00% 33 33 0.00% 34 39 0.00% 35 27 0.00% 36 31 0.00% 37 52 0.00% 38 64 0.00% 39 48 0.00% 40 48 0.00% 41 50 0.00% 42 58 0.00% 43 61 0.00% 44 55 0.00% 45 75 0.00% 46 81 0.00% 47 88 0.00% 48 106 0.00% 49 130 0.00% 50 103 0.00% 51 120 0.00% 52 118 0.00% 53 149 0.00% 54 153 0.00% 55 161 0.00% 56 216 0.00% 57 220 0.00% 58 254 0.00% 59 319 0.00% 60 340 0.00% 61 419 0.00% 62 433 0.00% 63 472 0.00% 64 498 0.00% 65 650 0.00% 66 670 0.00% 67 719 0.00% 68 868 0.00% 69 1046 0.00% 70 1230 0.00% 71 1378 0.00% 72 1611 0.00% 73 1801 0.01% 74 2037 0.01% 75 2213 0.01% 76 2440 0.01% 77 2836 0.01% 78 3006 0.01% 79 3613 0.01% 80 4098 0.01% 81 4468 0.01% 82 5384 0.02% 83 5990 0.02% 84 6584 0.02% 85 7128 0.02% 86 7621 0.02% 87 8471 0.03% 88 9400 0.03% 89 9984 0.03% 90 11170 0.03% 91 12523 0.04% 92 13484 0.04% 93 15076 0.05% 94 16439 0.05% 95 17237 0.05% 96 18382 0.06% 97 19365 0.06% 98 20078 0.06% 99 21663 0.07% 100 23052 0.07% 101 24637 0.07% 102 26700 0.08% 103 28509 0.09% 104 29936 0.09% 105 31533 0.09% 106 33160 0.10% 107 33508 0.10% 108 35540 0.11% 109 36113 0.11% 110 37420 0.11% 111 39543 0.12% 112 42337 0.13% 113 43972 0.13% 114 46910 0.14% 115 48184 0.14% 116 49593 0.15% 117 50699 0.15% 118 51859 0.16% 119 53080 0.16% 120 54774 0.16% 121 56020 0.17% 122 58172 0.17% 123 61119 0.18% 124 63855 0.19% 125 64992 0.20% 126 67709 0.20% 127 68507 0.21% 128 68119 0.20% 129 70769 0.21% 130 70045 0.21% 131 72134 0.22% 132 75569 0.23% 133 77478 0.23% 134 79876 0.24% 135 83223 0.25% 136 84253 0.25% 137 84392 0.25% 138 86205 0.26% 139 87912 0.26% 140 88989 0.27% 141 89713 0.27% 142 91361 0.27% 143 93020 0.28% 144 97110 0.29% 145 100315 0.30% 146 102018 0.31% 147 101907 0.31% 148 101851 0.31% 149 101250 0.30% 150 103228 0.31% 151 29772514 89.38% 33310724 reads passed initial QC criterion=sequence-density sequence-density=0.72 sequence-density-rank=1 fanout-score=3.72 fanout-score-rank=20 prefix-density=0.80 prefix-fanout=3.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.21 sequence-density-rank=21 fanout-score=25.41 fanout-score-rank=1 prefix-density=0.73 prefix-fanout=7.3 sequence=GGCGGCGGCGGCCTCG criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=4.02 fanout-score-rank=21 prefix-density=0.52 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=44 fanout-score=80.97 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=5.3 sequence=GTGCTCATCATCTTGTTTAATACCAAAGCTCTTCATATTCTCCTCCTTGATTTCATCAGCTTGAGGTTAGAGAGATTTGGAAGATGTCTT SRR12666906 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 17:56:05 Started mapping on | Dec 07 17:56:05 Finished on | Dec 07 17:59:10 Mapping speed, Million of reads per hour | 648.21 Number of input reads | 33310724 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 31690855 Uniquely mapped reads % | 95.14% Average mapped length | 296.08 Number of splices: Total | 35031897 Number of splices: Annotated (sjdb) | 33036454 Number of splices: GT/AG | 34505441 Number of splices: GC/AG | 455359 Number of splices: AT/AC | 11977 Number of splices: Non-canonical | 59120 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 2.59 Insertion rate per base | 0.02% Insertion average length | 2.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 423248 % of reads mapped to multiple loci | 1.27% Number of reads mapped to too many loci | 49939 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.63% % of reads unmapped: other | 0.82% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1196621 1196621 1196621 N_multimapping 423248 423248 423248 N_noFeature 989148 30737867 1217014 N_ambiguous 865048 4658 141103 UnstrandedReadsAssigned:29836659 PositiveStrandReadsAssigned:948330 NegativeStrandReadsAssigned:30332738 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12666906 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12666906-trimmed-pair1.fastq SRR12666906-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,310,724 reads, 30,646,890 reads pseudoaligned [quant] estimated average fragment length: 272.142 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,169 rounds 52973 SRR12666906.ke.tsv 35125 SRR12666906.se.tsv 88098 total ==> SRR12666906.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 665.746 0 0 PNS24247 1044 772.858 64.3446 3.48106 PNS24249 1928 1656.86 64.2206 1.62064 PNS24246 1044 772.858 64.3446 3.48106 PNS24248 1044 772.858 64.3446 3.48106 PNS24244 1471 1199.86 199.745 6.96058 PNS24243 293 95.272 0 0 KQK14069 1603 1331.86 2451.96 76.9759 KQK14071 474 231.531 13.0517 2.35698 ==> SRR12666906.se.tsv <== BRADI_1g14170v3 2546 BRADI_1g53295v3 121 BRADI_1g59795v3 873 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 500 BRADI_1g74790v3 211 BRADI_1g09890v3 0 BRADI_1g77505v3 523 BRADI_1g48960v3 0 SRR12666906 completed mapping pipeline successfully