Starting /dee2/code/volunteer_pipeline.sh SRR12666907 current disk space = 1540915589120 free memory = 1436933424 SRR12666907 SRAfilesize a53a6baeab6dfb56494702243cbeab79 SRR12666907.sra SRR12666907.sra file validated SRR12666907 is paired end SRR12666907 is conventional basespace SRR12666907 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666907_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3665 37.0 37.0 37.0 37.0 37.0 2 36.308 37.0 37.0 37.0 37.0 37.0 3 36.4925 37.0 37.0 37.0 37.0 37.0 4 36.4305 37.0 37.0 37.0 37.0 37.0 5 36.537 37.0 37.0 37.0 37.0 37.0 6 36.5255 37.0 37.0 37.0 37.0 37.0 7 36.419 37.0 37.0 37.0 37.0 37.0 8 36.514 37.0 37.0 37.0 37.0 37.0 9 36.5645 37.0 37.0 37.0 37.0 37.0 10-14 36.5209 37.0 37.0 37.0 37.0 37.0 15-19 36.531600000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.4601 37.0 37.0 37.0 37.0 37.0 25-29 36.413500000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.4208 37.0 37.0 37.0 37.0 37.0 35-39 36.4057 37.0 37.0 37.0 37.0 37.0 40-44 36.3658 37.0 37.0 37.0 37.0 37.0 45-49 36.333000000000006 37.0 37.0 37.0 37.0 37.0 50-54 36.3183 37.0 37.0 37.0 37.0 37.0 55-59 36.2844 37.0 37.0 37.0 37.0 37.0 60-64 36.3404 37.0 37.0 37.0 37.0 37.0 65-69 36.267700000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.275600000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.179500000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.203700000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.18390000000001 37.0 37.0 37.0 37.0 37.0 90-94 36.1628 37.0 37.0 37.0 37.0 37.0 95-99 36.0525 37.0 37.0 37.0 37.0 37.0 100-104 36.08489999999999 37.0 37.0 37.0 37.0 37.0 105-109 36.126400000000004 37.0 37.0 37.0 37.0 37.0 110-114 36.1268 37.0 37.0 37.0 37.0 37.0 115-119 35.970099999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.915499999999994 37.0 37.0 37.0 37.0 37.0 125-129 35.9354 37.0 37.0 37.0 37.0 37.0 130-134 35.869299999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.9195 37.0 37.0 37.0 37.0 37.0 140-144 35.709500000000006 37.0 37.0 37.0 37.0 37.0 145-149 35.5453 37.0 37.0 37.0 37.0 37.0 150-151 35.364000000000004 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 2.0 24 0.0 25 7.0 26 4.0 27 7.0 28 15.0 29 22.0 30 26.0 31 51.0 32 57.0 33 95.0 34 138.0 35 301.0 36 2861.0 37 413.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.0 13.075000000000001 7.6 34.325 2 21.4 17.125 37.85 23.625 3 20.5 23.474999999999998 26.924999999999997 29.099999999999998 4 24.425 30.475 21.15 23.95 5 22.375 34.175 23.674999999999997 19.775000000000002 6 20.925 35.175 22.275 21.625 7 16.35 21.6 41.85 20.200000000000003 8 19.75 21.75 28.275 30.225 9 19.950000000000003 20.8 31.5 27.750000000000004 10-14 22.295 26.345000000000002 25.290000000000003 26.07 15-19 22.5 26.14 25.305 26.055 20-24 21.725 27.115000000000002 26.045 25.115 25-29 22.695 26.340000000000003 26.040000000000003 24.925 30-34 22.13 25.885 25.85 26.135 35-39 22.825 26.0 25.945 25.230000000000004 40-44 22.575 26.284999999999997 25.635 25.505 45-49 22.225 26.61 25.729999999999997 25.435000000000002 50-54 22.735 26.57 25.2 25.495 55-59 23.46 26.305 25.21 25.025 60-64 22.735 26.0 25.45 25.814999999999998 65-69 22.84 26.090000000000003 25.82 25.25 70-74 23.064999999999998 25.419999999999998 26.395000000000003 25.119999999999997 75-79 22.53 26.534999999999997 25.4 25.535000000000004 80-84 22.975 25.790000000000003 25.185000000000002 26.05 85-89 22.919999999999998 26.22 25.335 25.525 90-94 22.994999999999997 25.900000000000002 26.06 25.045 95-99 23.244999999999997 25.765 25.814999999999998 25.174999999999997 100-104 23.28 26.32 25.174999999999997 25.224999999999998 105-109 23.535 25.745 25.564999999999998 25.155 110-114 23.31 25.919999999999998 25.285000000000004 25.485000000000003 115-119 23.915 25.955000000000002 25.14 24.990000000000002 120-124 23.51 25.825 25.564999999999998 25.1 125-129 23.45 26.484999999999996 25.009999999999998 25.055 130-134 23.745 26.095000000000002 24.7 25.46 135-139 23.565 25.590000000000003 25.39 25.455 140-144 23.825 25.790000000000003 24.89 25.495 145-149 23.535 26.075 25.119999999999997 25.27 150-151 23.3625 26.224999999999998 24.9 25.5125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.0 26 2.0 27 6.5 28 5.5 29 3.5 30 4.5 31 7.5 32 16.0 33 20.5 34 26.0 35 34.0 36 44.0 37 67.0 38 86.0 39 114.0 40 141.0 41 160.0 42 178.5 43 197.0 44 216.0 45 225.0 46 217.5 47 193.0 48 183.0 49 188.0 50 190.5 51 177.5 52 150.0 53 133.5 54 115.0 55 97.0 56 91.5 57 83.5 58 77.0 59 72.5 60 69.5 61 58.5 62 48.5 63 50.5 64 44.0 65 35.5 66 37.5 67 32.0 68 25.0 69 20.0 70 16.0 71 11.5 72 6.5 73 5.0 74 5.0 75 4.0 76 2.0 77 1.0 78 1.0 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.625 #Duplication Level Percentage of deduplicated Percentage of total 1 91.5961800818554 83.92500000000001 2 7.776261937244201 14.249999999999998 3 0.5457025920873124 1.5 4 0.054570259208731244 0.2 5 0.027285129604365622 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTGCCACAGCCTTGTCTTTCTGCGCCATCATGGCTGGGAGATCCACTTC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.4875 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.6875 0.0 0.0 0.0 0.0 102-103 0.9375 0.0 0.0 0.0 0.0 104-105 1.1 0.0 0.0 0.0 0.0 106-107 1.2125 0.0 0.0 0.0 0.0 108-109 1.35 0.0 0.0 0.0 0.0 110-111 1.4625 0.0 0.0 0.0 0.0 112-113 1.6375 0.0 0.0 0.0 0.0 114-115 1.925 0.0 0.0 0.0 0.0 116-117 2.0625 0.0 0.0 0.0 0.0 118-119 2.2625 0.0 0.0 0.0 0.0 120-121 2.55 0.0 0.0 0.0 0.0 122-123 3.05 0.0 0.0 0.0 0.0 124-125 3.575 0.0 0.0 0.0 0.0 126-127 3.95 0.0 0.0 0.0 0.0 128-129 4.2375 0.0 0.0 0.0 0.0 130-131 4.75 0.0 0.0 0.0 0.0 132-133 5.25 0.0 0.0 0.0 0.0 134-135 5.525 0.0 0.0 0.0 0.0 136-137 5.85 0.0 0.0 0.0 0.0 138-139 6.425000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12666907 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666907_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.02 37.0 37.0 37.0 37.0 37.0 2 35.894 37.0 37.0 37.0 37.0 37.0 3 36.01 37.0 37.0 37.0 37.0 37.0 4 36.2045 37.0 37.0 37.0 37.0 37.0 5 36.088 37.0 37.0 37.0 37.0 37.0 6 36.0475 37.0 37.0 37.0 37.0 37.0 7 36.146 37.0 37.0 37.0 37.0 37.0 8 36.2845 37.0 37.0 37.0 37.0 37.0 9 36.1905 37.0 37.0 37.0 37.0 37.0 10-14 36.199200000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.1938 37.0 37.0 37.0 37.0 37.0 20-24 36.1561 37.0 37.0 37.0 37.0 37.0 25-29 36.0777 37.0 37.0 37.0 37.0 37.0 30-34 36.101600000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.08069999999999 37.0 37.0 37.0 37.0 37.0 40-44 36.0444 37.0 37.0 37.0 37.0 37.0 45-49 36.046400000000006 37.0 37.0 37.0 37.0 37.0 50-54 36.0087 37.0 37.0 37.0 37.0 37.0 55-59 35.976800000000004 37.0 37.0 37.0 37.0 37.0 60-64 35.867900000000006 37.0 37.0 37.0 37.0 37.0 65-69 35.906600000000005 37.0 37.0 37.0 37.0 37.0 70-74 35.8791 37.0 37.0 37.0 37.0 37.0 75-79 35.8913 37.0 37.0 37.0 37.0 37.0 80-84 35.847500000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.812799999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.837599999999995 37.0 37.0 37.0 37.0 37.0 95-99 35.76649999999999 37.0 37.0 37.0 37.0 37.0 100-104 35.812200000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.747400000000006 37.0 37.0 37.0 37.0 37.0 110-114 35.7319 37.0 37.0 37.0 37.0 37.0 115-119 35.6723 37.0 37.0 37.0 37.0 37.0 120-124 35.685500000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.7295 37.0 37.0 37.0 37.0 37.0 130-134 35.6685 37.0 37.0 37.0 37.0 37.0 135-139 35.5185 37.0 37.0 37.0 37.0 37.0 140-144 35.4272 37.0 37.0 37.0 37.0 37.0 145-149 35.426 37.0 37.0 37.0 37.0 37.0 150-151 34.9905 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 6.0 14 4.0 15 2.0 16 4.0 17 1.0 18 0.0 19 2.0 20 2.0 21 3.0 22 7.0 23 2.0 24 5.0 25 8.0 26 10.0 27 19.0 28 9.0 29 16.0 30 38.0 31 45.0 32 63.0 33 96.0 34 187.0 35 491.0 36 2569.0 37 409.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.775 16.475 9.675 28.075 2 28.299999999999997 20.8 30.275000000000002 20.625 3 23.075000000000003 24.55 29.425 22.95 4 26.55 31.825 19.650000000000002 21.975 5 27.675 33.7 18.45 20.175 6 21.525 34.599999999999994 20.875 23.0 7 21.55 16.950000000000003 37.375 24.125 8 22.5 21.7 24.95 30.85 9 23.724999999999998 22.7 25.324999999999996 28.249999999999996 10-14 25.945 25.31 23.825 24.92 15-19 25.355 25.224999999999998 25.205 24.215 20-24 25.965 25.7 24.65 23.685000000000002 25-29 25.224999999999998 25.775 24.69 24.310000000000002 30-34 26.029999999999998 25.34 24.4 24.23 35-39 25.805 25.290000000000003 25.040000000000003 23.865 40-44 25.88 25.91 24.48 23.73 45-49 25.040000000000003 25.46 25.330000000000002 24.169999999999998 50-54 25.869999999999997 25.605 24.91 23.615 55-59 25.525 25.355 25.41 23.71 60-64 25.835 25.324999999999996 24.97 23.87 65-69 25.835 25.53 24.955 23.68 70-74 25.36 26.08 24.935 23.625 75-79 25.590000000000003 26.295 24.560000000000002 23.555 80-84 25.845000000000002 26.169999999999998 24.845 23.14 85-89 25.775 25.44 24.925 23.86 90-94 26.33 25.755 24.645 23.27 95-99 25.71 25.71 25.624999999999996 22.955000000000002 100-104 26.3 25.415 24.95 23.335 105-109 26.275 26.255 24.529999999999998 22.939999999999998 110-114 25.679999999999996 25.95 24.775 23.595 115-119 26.22 25.445 25.045 23.29 120-124 26.695 25.645 25.385 22.275 125-129 26.25 26.484999999999996 24.925 22.34 130-134 26.155 25.89 25.53 22.425 135-139 26.240000000000002 25.86 25.180000000000003 22.720000000000002 140-144 26.529999999999998 26.169999999999998 25.485000000000003 21.815 145-149 26.834999999999997 26.584999999999997 25.1 21.48 150-151 27.1625 25.900000000000002 25.5125 21.425 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 1.0 12 0.5 13 0.0 14 0.5 15 2.0 16 1.5 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 1.0 23 1.0 24 0.0 25 0.0 26 1.0 27 1.0 28 0.5 29 1.5 30 3.5 31 7.0 32 10.0 33 16.5 34 22.5 35 26.5 36 39.0 37 58.0 38 74.5 39 95.5 40 122.5 41 147.0 42 168.5 43 186.0 44 185.5 45 192.0 46 211.5 47 199.0 48 190.0 49 180.5 50 166.0 51 155.0 52 129.0 53 124.5 54 127.5 55 116.5 56 99.5 57 85.0 58 86.5 59 88.5 60 81.0 61 68.5 62 62.0 63 55.5 64 55.0 65 63.0 66 59.5 67 46.5 68 36.0 69 33.5 70 29.5 71 20.0 72 11.0 73 12.0 74 10.5 75 4.0 76 2.5 77 1.5 78 1.0 79 1.5 80 0.5 81 0.5 82 1.0 83 0.5 84 0.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.5 90 1.0 91 1.0 92 0.5 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 4.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.625 #Duplication Level Percentage of deduplicated Percentage of total 1 91.92360163710778 84.22500000000001 2 7.339699863574352 13.450000000000001 3 0.6275579809004093 1.725 4 0.054570259208731244 0.2 5 0.027285129604365622 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027285129604365622 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 11 0.27499999999999997 No Hit GTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCCGGTTCGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1625 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.3625 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.5125 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.575 0.0 0.0 0.0 0.0 100-101 0.6875 0.0 0.0 0.0 0.0 102-103 0.9375 0.0 0.0 0.0 0.0 104-105 1.1 0.0 0.0 0.0 0.0 106-107 1.2125 0.0 0.0 0.0 0.0 108-109 1.35 0.0 0.0 0.0 0.0 110-111 1.4625 0.0 0.0 0.0 0.0 112-113 1.6375 0.0 0.0 0.0 0.0 114-115 1.925 0.0 0.0 0.0 0.0 116-117 2.0625 0.0 0.0 0.0 0.0 118-119 2.2875 0.0 0.0 0.0 0.0 120-121 2.55 0.0 0.0 0.0 0.0 122-123 3.025 0.0 0.0 0.0 0.0 124-125 3.55 0.0 0.0 0.0 0.0 126-127 3.925 0.0 0.0 0.0 0.0 128-129 4.2375 0.0 0.0 0.0 0.0 130-131 4.75 0.0 0.0 0.0 0.0 132-133 5.25 0.0 0.0 0.0 0.0 134-135 5.5375 0.0 0.0 0.0 0.0 136-137 5.875 0.0 0.0 0.0 0.0 138-139 6.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCTTCC 10 0.006830828 145.0 4 >>END_MODULE Read 1542212 spots for SRR12666907.sra Written 1542212 spots for SRR12666907.sra Read 1542212 spots for SRR12666907.sra Written 1542212 spots for SRR12666907.sra Read 1542212 spots for SRR12666907.sra Written 1542212 spots for SRR12666907.sra Read 1542212 spots for SRR12666907.sra Written 1542212 spots for SRR12666907.sra Read 1542212 spots for SRR12666907.sra Written 1542212 spots for SRR12666907.sra Read 1542212 spots for SRR12666907.sra Written 1542212 spots for SRR12666907.sra Read 1542212 spots for SRR12666907.sra Written 1542212 spots for SRR12666907.sra Read 1542216 spots for SRR12666907.sra Written 1542216 spots for SRR12666907.sra Read 1542212 spots for SRR12666907.sra Written 1542212 spots for SRR12666907.sra Read 1542212 spots for SRR12666907.sra Written 1542212 spots for SRR12666907.sra Read 1542212 spots for SRR12666907.sra Written 1542212 spots for SRR12666907.sra Read 1542212 spots for SRR12666907.sra Written 1542212 spots for SRR12666907.sra Read 1542212 spots for SRR12666907.sra Written 1542212 spots for SRR12666907.sra Read 1542212 spots for SRR12666907.sra Written 1542212 spots for SRR12666907.sra Read 1542212 spots for SRR12666907.sra Written 1542212 spots for SRR12666907.sra Read 1542212 spots for SRR12666907.sra Written 1542212 spots for SRR12666907.sra Read 1542212 spots for SRR12666907.sra Written 1542212 spots for SRR12666907.sra Read 1542212 spots for SRR12666907.sra Written 1542212 spots for SRR12666907.sra Read 1542212 spots for SRR12666907.sra Written 1542212 spots for SRR12666907.sra Read 1542212 spots for SRR12666907.sra Written 1542212 spots for SRR12666907.sra SRR ids: ['SRR12666907.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ts53cekr SRR12666907.sra spots: 30844244 blocks: [[1, 1542212], [1542213, 3084424], [3084425, 4626636], [4626637, 6168848], [6168849, 7711060], [7711061, 9253272], [9253273, 10795484], [10795485, 12337696], [12337697, 13879908], [13879909, 15422120], [15422121, 16964332], [16964333, 18506544], [18506545, 20048756], [20048757, 21590968], [21590969, 23133180], [23133181, 24675392], [24675393, 26217604], [26217605, 27759816], [27759817, 29302028], [29302029, 30844244]] SRR12666907 file size 10460523 SRR12666907 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12666907 SRR12666907_1.fastq SRR12666907_2.fastq Input file: SRR12666907_1.fastq Paired file: SRR12666907_2.fastq trimmed: SRR12666907-trimmed-pair1.fastq, SRR12666907-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 17:54:14 2024 >> started Sat Dec 7 17:54:46 2024 >> done (32.374s) 30844244 read pairs processed; of these: 70 ( 0.00%) short read pairs filtered out after trimming by size control 33828 ( 0.11%) empty read pairs filtered out after trimming by size control 30810346 (99.89%) read pairs available; of these: 2704338 ( 8.78%) trimmed read pairs available after processing 28106008 (91.22%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 7 0.00% 20 6 0.00% 21 19 0.00% 22 21 0.00% 23 27 0.00% 24 22 0.00% 25 34 0.00% 26 25 0.00% 27 41 0.00% 28 50 0.00% 29 38 0.00% 30 33 0.00% 31 54 0.00% 32 52 0.00% 33 56 0.00% 34 50 0.00% 35 70 0.00% 36 66 0.00% 37 63 0.00% 38 94 0.00% 39 87 0.00% 40 91 0.00% 41 65 0.00% 42 74 0.00% 43 72 0.00% 44 89 0.00% 45 98 0.00% 46 95 0.00% 47 97 0.00% 48 124 0.00% 49 144 0.00% 50 150 0.00% 51 160 0.00% 52 166 0.00% 53 174 0.00% 54 209 0.00% 55 208 0.00% 56 235 0.00% 57 228 0.00% 58 297 0.00% 59 308 0.00% 60 333 0.00% 61 388 0.00% 62 424 0.00% 63 432 0.00% 64 515 0.00% 65 482 0.00% 66 610 0.00% 67 717 0.00% 68 722 0.00% 69 875 0.00% 70 949 0.00% 71 1046 0.00% 72 1223 0.00% 73 1395 0.00% 74 1520 0.00% 75 1634 0.01% 76 1887 0.01% 77 2054 0.01% 78 2280 0.01% 79 2673 0.01% 80 2908 0.01% 81 3535 0.01% 82 3894 0.01% 83 4360 0.01% 84 4779 0.02% 85 5401 0.02% 86 5701 0.02% 87 6220 0.02% 88 6765 0.02% 89 7197 0.02% 90 7937 0.03% 91 8734 0.03% 92 9917 0.03% 93 10601 0.03% 94 11776 0.04% 95 12532 0.04% 96 13497 0.04% 97 14198 0.05% 98 14793 0.05% 99 15767 0.05% 100 16885 0.05% 101 18221 0.06% 102 19566 0.06% 103 20792 0.07% 104 22166 0.07% 105 23989 0.08% 106 24288 0.08% 107 25069 0.08% 108 26546 0.09% 109 27325 0.09% 110 28365 0.09% 111 29780 0.10% 112 32067 0.10% 113 33389 0.11% 114 35343 0.11% 115 35678 0.12% 116 37234 0.12% 117 38629 0.13% 118 39275 0.13% 119 39728 0.13% 120 40907 0.13% 121 42878 0.14% 122 44564 0.14% 123 46329 0.15% 124 48846 0.16% 125 50041 0.16% 126 51226 0.17% 127 51938 0.17% 128 52736 0.17% 129 54401 0.18% 130 54284 0.18% 131 55456 0.18% 132 57911 0.19% 133 59792 0.19% 134 61895 0.20% 135 64307 0.21% 136 65453 0.21% 137 66023 0.21% 138 67172 0.22% 139 66963 0.22% 140 67478 0.22% 141 69025 0.22% 142 70564 0.23% 143 72247 0.23% 144 75166 0.24% 145 76628 0.25% 146 78621 0.26% 147 79529 0.26% 148 80134 0.26% 149 79936 0.26% 150 80871 0.26% 151 28106008 91.22% 30810346 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=4.01 fanout-score-rank=22 prefix-density=0.25 prefix-fanout=3.0 sequence=GATCTCGCCGAAG criterion=fanout-score sequence-density=0.08 sequence-density-rank=16 fanout-score=102.54 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=16.7 sequence=TCCTCCTTGCCA criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.27 fanout-score-rank=30 prefix-density=0.43 prefix-fanout=2.2 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.06 sequence-density-rank=28 fanout-score=279.38 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=19.6 sequence=CCGCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGACACCGTGACTTCATCAAGAACATGATTACCGGTACCTCCCAGGCTGACTGTGCCGTGCTTATCATTGACTCCACGACTGGAGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCATGCCCTCCTTGCTTTCACTCTTGGAGTGAAGCAGATGATCTGCTGCTGCAACAAGATG SRR12666907 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 17:56:59 Started mapping on | Dec 07 17:56:59 Finished on | Dec 07 18:00:11 Mapping speed, Million of reads per hour | 577.69 Number of input reads | 30810346 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 29033311 Uniquely mapped reads % | 94.23% Average mapped length | 296.88 Number of splices: Total | 31286584 Number of splices: Annotated (sjdb) | 29275485 Number of splices: GT/AG | 30852791 Number of splices: GC/AG | 353394 Number of splices: AT/AC | 22283 Number of splices: Non-canonical | 58116 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 2.42 Insertion rate per base | 0.01% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 435730 % of reads mapped to multiple loci | 1.41% Number of reads mapped to too many loci | 48433 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.26% % of reads unmapped: other | 0.94% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1341305 1341305 1341305 N_multimapping 435730 435730 435730 N_noFeature 1108756 28272829 1391249 N_ambiguous 572277 4458 95640 UnstrandedReadsAssigned:27352278 PositiveStrandReadsAssigned:756024 NegativeStrandReadsAssigned:27546422 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12666907 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12666907-trimmed-pair1.fastq SRR12666907-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,810,346 reads, 28,020,091 reads pseudoaligned [quant] estimated average fragment length: 293.909 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,203 rounds 52973 SRR12666907.ke.tsv 35125 SRR12666907.se.tsv 88098 total ==> SRR12666907.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 644.485 0 0 PNS24247 1044 751.091 177.713 13.3064 PNS24249 1928 1635.09 101.616 3.49509 PNS24246 1044 751.091 177.713 13.3064 PNS24248 1044 751.091 177.713 13.3064 PNS24244 1471 1178.09 331.245 15.8127 PNS24243 293 92.5351 2 1.21551 KQK14069 1603 1310.09 3687.96 158.314 KQK14071 474 223.38 50.7968 12.7888 ==> SRR12666907.se.tsv <== BRADI_1g14170v3 4089 BRADI_1g53295v3 370 BRADI_1g59795v3 723 BRADI_1g07683v3 0 BRADI_1g00485v3 92 BRADI_1g20270v3 1873 BRADI_1g74790v3 181 BRADI_1g09890v3 0 BRADI_1g77505v3 151 BRADI_1g48960v3 0 SRR12666907 completed mapping pipeline successfully