Starting /dee2/code/volunteer_pipeline.sh SRR12666908 current disk space = 1540907311104 free memory = 1602345076 SRR12666908 SRAfilesize 7f493c43b0e0310e809a9a142189402c SRR12666908.sra SRR12666908.sra file validated SRR12666908 is paired end SRR12666908 is conventional basespace SRR12666908 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666908_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.613 37.0 37.0 37.0 37.0 37.0 2 36.43525 37.0 37.0 37.0 37.0 37.0 3 36.523 37.0 37.0 37.0 37.0 37.0 4 36.5375 37.0 37.0 37.0 37.0 37.0 5 36.596 37.0 37.0 37.0 37.0 37.0 6 36.5915 37.0 37.0 37.0 37.0 37.0 7 36.581 37.0 37.0 37.0 37.0 37.0 8 36.6305 37.0 37.0 37.0 37.0 37.0 9 36.658 37.0 37.0 37.0 37.0 37.0 10-14 36.5687 37.0 37.0 37.0 37.0 37.0 15-19 36.5826 37.0 37.0 37.0 37.0 37.0 20-24 36.462 37.0 37.0 37.0 37.0 37.0 25-29 36.442 37.0 37.0 37.0 37.0 37.0 30-34 36.4175 37.0 37.0 37.0 37.0 37.0 35-39 36.4221 37.0 37.0 37.0 37.0 37.0 40-44 36.3892 37.0 37.0 37.0 37.0 37.0 45-49 36.373 37.0 37.0 37.0 37.0 37.0 50-54 36.3151 37.0 37.0 37.0 37.0 37.0 55-59 36.3202 37.0 37.0 37.0 37.0 37.0 60-64 36.2792 37.0 37.0 37.0 37.0 37.0 65-69 36.2457 37.0 37.0 37.0 37.0 37.0 70-74 36.207100000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.199 37.0 37.0 37.0 37.0 37.0 80-84 36.185 37.0 37.0 37.0 37.0 37.0 85-89 36.182 37.0 37.0 37.0 37.0 37.0 90-94 36.144600000000004 37.0 37.0 37.0 37.0 37.0 95-99 36.0969 37.0 37.0 37.0 37.0 37.0 100-104 36.0775 37.0 37.0 37.0 37.0 37.0 105-109 36.1075 37.0 37.0 37.0 37.0 37.0 110-114 35.9976 37.0 37.0 37.0 37.0 37.0 115-119 36.0133 37.0 37.0 37.0 37.0 37.0 120-124 35.9561 37.0 37.0 37.0 37.0 37.0 125-129 35.9024 37.0 37.0 37.0 37.0 37.0 130-134 35.933 37.0 37.0 37.0 37.0 37.0 135-139 35.8474 37.0 37.0 37.0 37.0 37.0 140-144 35.7291 37.0 37.0 37.0 37.0 37.0 145-149 35.593399999999995 37.0 37.0 37.0 37.0 37.0 150-151 35.34 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 3.0 23 1.0 24 2.0 25 6.0 26 12.0 27 11.0 28 8.0 29 27.0 30 30.0 31 45.0 32 52.0 33 81.0 34 122.0 35 307.0 36 2811.0 37 481.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.199999999999996 12.6 7.95 32.25 2 23.317488116087066 15.086314736052039 35.2514385789342 26.344758568926697 3 20.549999999999997 22.925 26.150000000000002 30.375000000000004 4 27.450000000000003 28.575 20.9 23.075000000000003 5 25.85 31.2 22.775000000000002 20.175 6 21.425 32.9 22.675 23.0 7 17.349999999999998 20.8 40.975 20.875 8 21.575 20.825 28.075 29.525000000000002 9 20.549999999999997 19.950000000000003 31.874999999999996 27.625 10-14 23.735 25.705 24.81 25.75 15-19 24.355 25.03 24.865000000000002 25.75 20-24 22.925 25.424999999999997 25.224999999999998 26.424999999999997 25-29 24.115000000000002 24.765 24.8 26.32 30-34 23.485 24.990000000000002 25.435000000000002 26.090000000000003 35-39 23.215 25.14 24.834999999999997 26.810000000000002 40-44 24.66 24.245 24.585 26.51 45-49 23.355 25.88 24.4 26.365 50-54 22.86 25.264999999999997 25.264999999999997 26.61 55-59 23.86 24.959999999999997 24.565 26.615 60-64 24.135 24.404999999999998 24.67 26.790000000000003 65-69 23.815 24.48 24.68 27.025 70-74 24.165 24.13 24.990000000000002 26.715 75-79 24.66 25.115 24.135 26.090000000000003 80-84 24.310000000000002 24.3 25.324999999999996 26.064999999999998 85-89 24.725 24.005000000000003 24.57 26.700000000000003 90-94 24.25 24.75 24.235 26.765 95-99 24.45 23.880000000000003 24.385 27.284999999999997 100-104 24.709999999999997 24.325 25.0 25.965 105-109 24.73 24.85 24.21 26.21 110-114 24.335 24.91 24.32 26.435 115-119 25.130000000000003 24.675 24.13 26.064999999999998 120-124 25.19 24.685000000000002 23.965 26.16 125-129 24.995 24.875 23.56 26.57 130-134 25.679999999999996 24.29 24.025 26.005 135-139 24.775 24.725 24.044999999999998 26.455000000000002 140-144 25.319999999999997 24.58 23.35 26.75 145-149 25.22 24.52 23.555 26.705000000000002 150-151 25.087500000000002 24.2 23.45 27.2625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 1.5 24 2.0 25 2.5 26 2.5 27 1.0 28 3.0 29 7.0 30 8.5 31 10.5 32 13.0 33 23.0 34 30.0 35 33.5 36 46.5 37 65.5 38 83.5 39 113.0 40 126.0 41 123.0 42 133.0 43 149.5 44 172.5 45 173.0 46 169.5 47 189.0 48 178.0 49 157.5 50 157.5 51 143.5 52 130.5 53 115.5 54 100.0 55 89.5 56 88.0 57 95.0 58 96.5 59 84.5 60 77.0 61 77.5 62 71.5 63 77.5 64 78.5 65 70.5 66 68.5 67 64.5 68 53.5 69 46.0 70 40.0 71 28.5 72 30.5 73 27.5 74 20.5 75 17.0 76 10.0 77 6.0 78 5.0 79 5.0 80 2.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.225 #Duplication Level Percentage of deduplicated Percentage of total 1 89.82908377696835 80.15 2 8.657887363407117 15.45 3 1.260857383020454 3.375 4 0.1961333706920706 0.7000000000000001 5 0.0 0.0 6 0.02801905295601009 0.15 7 0.02801905295601009 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAGTCCTGCCTGATCGGTCCAATCCCGGCCATCTCTCACTGACTCTCGGG 7 0.17500000000000002 No Hit CTCCGCTCGAACATCTTCACCAGCAGGATCATCACGATCACGTGCCCCAC 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.21250000000000002 0.0 0.0 0.0 0.0 78-79 0.2375 0.0 0.0 0.0 0.0 80-81 0.3 0.0 0.0 0.0 0.0 82-83 0.3 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.4625 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.6375 0.0 0.0 0.0 0.0 94-95 0.8 0.0 0.0 0.0 0.0 96-97 0.925 0.0 0.0 0.0 0.0 98-99 1.0499999999999998 0.0 0.0 0.0 0.0 100-101 1.15 0.0 0.0 0.0 0.0 102-103 1.3875000000000002 0.0 0.0 0.0 0.0 104-105 1.65 0.0 0.0 0.0 0.0 106-107 1.8624999999999998 0.0 0.0 0.0 0.0 108-109 2.05 0.0 0.0 0.0 0.0 110-111 2.3625 0.0 0.0 0.0 0.0 112-113 2.775 0.0 0.0 0.0 0.0 114-115 3.0875 0.0 0.0 0.0 0.0 116-117 3.5375 0.0 0.0 0.0 0.0 118-119 4.0625 0.0 0.0 0.0 0.0 120-121 4.574999999999999 0.0 0.0 0.0 0.0 122-123 4.9625 0.0 0.0 0.0 0.0 124-125 5.3875 0.0 0.0 0.0 0.0 126-127 6.0 0.0 0.0 0.0 0.0 128-129 6.5 0.0 0.0 0.0 0.0 130-131 6.8375 0.0 0.0 0.0 0.0 132-133 7.4125 0.0 0.0 0.0 0.0 134-135 8.075 0.0 0.0 0.0 0.0 136-137 8.8 0.0 0.0 0.0 0.0 138-139 9.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATAAGC 10 0.006830828 145.0 5 >>END_MODULE SRR12666908 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666908_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.992 37.0 37.0 37.0 37.0 37.0 2 35.909 37.0 37.0 37.0 37.0 37.0 3 36.1335 37.0 37.0 37.0 37.0 37.0 4 36.1305 37.0 37.0 37.0 37.0 37.0 5 36.1475 37.0 37.0 37.0 37.0 37.0 6 35.9 37.0 37.0 37.0 37.0 37.0 7 36.116 37.0 37.0 37.0 37.0 37.0 8 36.1285 37.0 37.0 37.0 37.0 37.0 9 36.084 37.0 37.0 37.0 37.0 37.0 10-14 36.070899999999995 37.0 37.0 37.0 37.0 37.0 15-19 35.9778 37.0 37.0 37.0 37.0 37.0 20-24 35.9166 37.0 37.0 37.0 37.0 37.0 25-29 35.85360000000001 37.0 37.0 37.0 37.0 37.0 30-34 35.7886 37.0 37.0 37.0 37.0 37.0 35-39 35.87349999999999 37.0 37.0 37.0 37.0 37.0 40-44 35.7327 37.0 37.0 37.0 37.0 37.0 45-49 35.718399999999995 37.0 37.0 37.0 37.0 37.0 50-54 35.6585 37.0 37.0 37.0 37.0 37.0 55-59 35.6854 37.0 37.0 37.0 37.0 37.0 60-64 35.5464 37.0 37.0 37.0 37.0 37.0 65-69 35.5983 37.0 37.0 37.0 37.0 37.0 70-74 35.6018 37.0 37.0 37.0 37.0 37.0 75-79 35.6358 37.0 37.0 37.0 37.0 37.0 80-84 35.577999999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.5195 37.0 37.0 37.0 37.0 37.0 90-94 35.5493 37.0 37.0 37.0 37.0 37.0 95-99 35.4755 37.0 37.0 37.0 37.0 37.0 100-104 35.535199999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.567 37.0 37.0 37.0 37.0 37.0 110-114 35.4992 37.0 37.0 37.0 37.0 37.0 115-119 35.4199 37.0 37.0 37.0 37.0 37.0 120-124 35.3897 37.0 37.0 37.0 37.0 37.0 125-129 35.419799999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.368100000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.218399999999995 37.0 37.0 37.0 34.6 37.0 140-144 35.1711 37.0 37.0 37.0 34.6 37.0 145-149 34.9859 37.0 37.0 37.0 25.0 37.0 150-151 34.716750000000005 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 10.0 13 11.0 14 17.0 15 15.0 16 4.0 17 2.0 18 7.0 19 3.0 20 8.0 21 15.0 22 12.0 23 10.0 24 9.0 25 5.0 26 9.0 27 8.0 28 15.0 29 17.0 30 23.0 31 42.0 32 58.0 33 86.0 34 146.0 35 420.0 36 2538.0 37 510.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.475 16.650000000000002 9.675 26.200000000000003 2 32.1 18.875 26.125 22.900000000000002 3 26.75 22.375 25.85 25.025 4 28.749999999999996 31.0 17.125 23.125 5 30.025000000000002 31.35 17.474999999999998 21.15 6 25.025 32.324999999999996 18.45 24.2 7 24.75 15.8 34.475 24.975 8 23.65 20.075000000000003 22.325 33.95 9 25.474999999999998 21.875 24.825 27.825 10-14 28.294999999999998 24.15 21.925 25.629999999999995 15-19 27.295 24.9 22.29 25.515 20-24 27.67 24.279999999999998 22.545 25.505 25-29 27.744999999999997 24.125 22.71 25.419999999999998 30-34 26.950000000000003 24.695 23.189999999999998 25.165 35-39 27.189999999999998 24.795 22.470000000000002 25.545 40-44 27.325 24.62 22.900000000000002 25.155 45-49 26.195 24.385 23.46 25.96 50-54 26.884999999999998 25.2 22.814999999999998 25.1 55-59 27.11 25.165 22.465 25.259999999999998 60-64 26.875 25.03 22.845 25.25 65-69 27.095000000000002 24.88 23.03 24.995 70-74 27.375 24.58 23.39 24.654999999999998 75-79 26.75 24.625 23.32 25.305 80-84 27.21 24.2 22.97 25.619999999999997 85-89 26.974999999999998 25.355 22.965 24.705 90-94 27.55 25.019999999999996 22.775000000000002 24.654999999999998 95-99 27.235 24.69 23.705000000000002 24.37 100-104 27.735 25.169999999999998 22.52 24.575 105-109 27.265 25.0 22.965 24.77 110-114 26.889999999999997 24.905 23.135 25.069999999999997 115-119 27.189999999999998 25.169999999999998 23.39 24.25 120-124 28.244999999999997 25.09 22.925 23.74 125-129 27.43 24.94 22.595000000000002 25.035 130-134 28.02 25.46 22.525000000000002 23.995 135-139 28.244999999999997 25.465 22.895 23.395 140-144 28.155 25.545 22.935 23.365 145-149 28.775000000000002 25.96 22.235 23.03 150-151 28.975 25.874999999999996 22.825 22.325 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 1.0 16 2.0 17 1.0 18 1.0 19 1.5 20 0.5 21 0.0 22 0.5 23 0.5 24 1.0 25 3.0 26 2.5 27 1.0 28 3.5 29 6.5 30 9.0 31 11.0 32 11.0 33 10.5 34 15.0 35 23.5 36 33.0 37 42.5 38 61.5 39 75.5 40 94.0 41 116.5 42 124.0 43 131.0 44 135.0 45 152.0 46 165.5 47 156.0 48 142.0 49 146.0 50 155.5 51 142.5 52 129.0 53 126.5 54 113.5 55 99.5 56 93.5 57 100.5 58 107.0 59 102.5 60 102.0 61 101.5 62 99.0 63 98.5 64 85.0 65 78.0 66 78.5 67 71.5 68 68.0 69 62.0 70 57.5 71 47.5 72 41.0 73 38.0 74 25.0 75 18.0 76 14.5 77 7.5 78 6.0 79 3.5 80 1.5 81 2.0 82 1.5 83 1.0 84 1.0 85 1.0 86 0.5 87 1.0 88 2.0 89 1.5 90 1.0 91 1.5 92 3.0 93 3.5 94 2.0 95 1.0 96 1.0 97 2.0 98 1.5 99 1.0 100 7.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.1 #Duplication Level Percentage of deduplicated Percentage of total 1 90.29180695847363 80.45 2 8.080808080808081 14.399999999999999 3 1.2626262626262625 3.375 4 0.25252525252525254 0.8999999999999999 5 0.05611672278338946 0.25 6 0.0 0.0 7 0.02805836139169473 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.02805836139169473 0.44999999999999996 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 18 0.44999999999999996 No Hit TCTCTCTCATCCATATCTTCTTCTGCTTCCTTGGTCTTCTTCCGCATCCA 7 0.17500000000000002 No Hit GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 5 0.125 No Hit AGAACATCGGCAAGAAGCTGGTGAACTCGAAGGATGGACCGGTGTCCTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.525 0.0 0.0 0.0 0.0 92-93 0.6125 0.0 0.0 0.0 0.0 94-95 0.7749999999999999 0.0 0.0 0.0 0.0 96-97 0.9 0.0 0.0 0.0 0.0 98-99 1.025 0.0 0.0 0.0 0.0 100-101 1.15 0.0 0.0 0.0 0.0 102-103 1.3875000000000002 0.0 0.0 0.0 0.0 104-105 1.6875 0.0 0.0 0.0 0.0 106-107 1.9375 0.0 0.0 0.0 0.0 108-109 2.125 0.0 0.0 0.0 0.0 110-111 2.475 0.0 0.0 0.0 0.0 112-113 2.9125 0.0 0.0 0.0 0.0 114-115 3.2375 0.0 0.0 0.0 0.0 116-117 3.7125 0.0 0.0 0.0 0.0 118-119 4.225 0.0 0.0 0.0 0.0 120-121 4.725 0.0 0.0 0.0 0.0 122-123 5.1125 0.0 0.0 0.0 0.0 124-125 5.5625 0.0 0.0 0.0 0.0 126-127 6.175000000000001 0.0 0.0 0.0 0.0 128-129 6.675000000000001 0.0 0.0 0.0 0.0 130-131 6.9875 0.0 0.0 0.0 0.0 132-133 7.575 0.0 0.0 0.0 0.0 134-135 8.25 0.0 0.0 0.0 0.0 136-137 8.975 0.0 0.0 0.0 0.0 138-139 9.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCTGCT 10 0.006830828 145.0 6 CTGAACT 10 0.006830828 145.0 3 GTAGGGA 30 0.0017973486 72.5 145 >>END_MODULE Read 1283085 spots for SRR12666908.sra Written 1283085 spots for SRR12666908.sra Read 1283085 spots for SRR12666908.sra Written 1283085 spots for SRR12666908.sra Read 1283085 spots for SRR12666908.sra Written 1283085 spots for SRR12666908.sra Read 1283085 spots for SRR12666908.sra Written 1283085 spots for SRR12666908.sra Read 1283085 spots for SRR12666908.sra Written 1283085 spots for SRR12666908.sra Read 1283085 spots for SRR12666908.sra Written 1283085 spots for SRR12666908.sra Read 1283085 spots for SRR12666908.sra Written 1283085 spots for SRR12666908.sra Read 1283085 spots for SRR12666908.sra Written 1283085 spots for SRR12666908.sra Read 1283085 spots for SRR12666908.sra Written 1283085 spots for SRR12666908.sra Read 1283085 spots for SRR12666908.sra Written 1283085 spots for SRR12666908.sra Read 1283085 spots for SRR12666908.sra Written 1283085 spots for SRR12666908.sra Read 1283085 spots for SRR12666908.sra Written 1283085 spots for SRR12666908.sra Read 1283085 spots for SRR12666908.sra Written 1283085 spots for SRR12666908.sra Read 1283085 spots for SRR12666908.sra Written 1283085 spots for SRR12666908.sra Read 1283085 spots for SRR12666908.sra Written 1283085 spots for SRR12666908.sra Read 1283085 spots for SRR12666908.sra Written 1283085 spots for SRR12666908.sra Read 1283090 spots for SRR12666908.sra Written 1283090 spots for SRR12666908.sra Read 1283085 spots for SRR12666908.sra Written 1283085 spots for SRR12666908.sra Read 1283085 spots for SRR12666908.sra Written 1283085 spots for SRR12666908.sra Read 1283085 spots for SRR12666908.sra Written 1283085 spots for SRR12666908.sra SRR ids: ['SRR12666908.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_sq9ampym SRR12666908.sra spots: 25661705 blocks: [[1, 1283085], [1283086, 2566170], [2566171, 3849255], [3849256, 5132340], [5132341, 6415425], [6415426, 7698510], [7698511, 8981595], [8981596, 10264680], [10264681, 11547765], [11547766, 12830850], [12830851, 14113935], [14113936, 15397020], [15397021, 16680105], [16680106, 17963190], [17963191, 19246275], [19246276, 20529360], [20529361, 21812445], [21812446, 23095530], [23095531, 24378615], [24378616, 25661705]] SRR12666908 file size 8699269 SRR12666908 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12666908 SRR12666908_1.fastq SRR12666908_2.fastq Input file: SRR12666908_1.fastq Paired file: SRR12666908_2.fastq trimmed: SRR12666908-trimmed-pair1.fastq, SRR12666908-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 17:54:14 2024 >> started Sat Dec 7 17:54:42 2024 >> done (28.671s) 25661705 read pairs processed; of these: 53 ( 0.00%) short read pairs filtered out after trimming by size control 20795 ( 0.08%) empty read pairs filtered out after trimming by size control 25640857 (99.92%) read pairs available; of these: 3292670 (12.84%) trimmed read pairs available after processing 22348187 (87.16%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 9 0.00% 20 7 0.00% 21 8 0.00% 22 13 0.00% 23 14 0.00% 24 12 0.00% 25 7 0.00% 26 15 0.00% 27 15 0.00% 28 18 0.00% 29 21 0.00% 30 20 0.00% 31 31 0.00% 32 28 0.00% 33 20 0.00% 34 36 0.00% 35 24 0.00% 36 45 0.00% 37 25 0.00% 38 43 0.00% 39 46 0.00% 40 45 0.00% 41 43 0.00% 42 60 0.00% 43 55 0.00% 44 53 0.00% 45 81 0.00% 46 76 0.00% 47 84 0.00% 48 80 0.00% 49 121 0.00% 50 118 0.00% 51 126 0.00% 52 139 0.00% 53 177 0.00% 54 159 0.00% 55 224 0.00% 56 187 0.00% 57 251 0.00% 58 298 0.00% 59 349 0.00% 60 423 0.00% 61 443 0.00% 62 416 0.00% 63 550 0.00% 64 573 0.00% 65 583 0.00% 66 701 0.00% 67 790 0.00% 68 903 0.00% 69 1048 0.00% 70 1227 0.00% 71 1414 0.01% 72 1655 0.01% 73 1907 0.01% 74 2078 0.01% 75 2341 0.01% 76 2613 0.01% 77 2862 0.01% 78 3147 0.01% 79 3719 0.01% 80 4222 0.02% 81 4874 0.02% 82 5378 0.02% 83 6096 0.02% 84 6774 0.03% 85 7389 0.03% 86 8221 0.03% 87 8636 0.03% 88 9767 0.04% 89 10245 0.04% 90 11541 0.05% 91 12876 0.05% 92 13942 0.05% 93 15544 0.06% 94 16760 0.07% 95 18015 0.07% 96 19065 0.07% 97 20084 0.08% 98 20500 0.08% 99 22483 0.09% 100 23651 0.09% 101 25029 0.10% 102 27215 0.11% 103 28759 0.11% 104 30520 0.12% 105 32355 0.13% 106 33234 0.13% 107 33518 0.13% 108 35128 0.14% 109 36531 0.14% 110 37815 0.15% 111 40274 0.16% 112 42299 0.16% 113 43564 0.17% 114 46642 0.18% 115 47061 0.18% 116 48030 0.19% 117 50082 0.20% 118 50027 0.20% 119 51379 0.20% 120 52160 0.20% 121 54272 0.21% 122 56112 0.22% 123 58089 0.23% 124 60466 0.24% 125 62293 0.24% 126 62922 0.25% 127 64364 0.25% 128 64237 0.25% 129 64807 0.25% 130 65164 0.25% 131 66030 0.26% 132 68025 0.27% 133 71789 0.28% 134 72503 0.28% 135 75305 0.29% 136 75072 0.29% 137 74996 0.29% 138 76761 0.30% 139 77048 0.30% 140 77187 0.30% 141 78523 0.31% 142 80446 0.31% 143 81822 0.32% 144 85519 0.33% 145 88140 0.34% 146 88423 0.34% 147 88185 0.34% 148 88156 0.34% 149 87250 0.34% 150 88492 0.35% 151 22348187 87.16% 25640857 reads passed initial QC criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=3.75 fanout-score-rank=22 prefix-density=0.75 prefix-fanout=3.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=36 fanout-score=239.09 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=12.8 sequence=ATCATCATCGTCACAAGATACTGCAACACTGAACCATCAGCTTCCTCTGTAATGTACATACCAATCACATCCACTCCTCGATCCACCATGCATCCATACAAATAGCATGCATAACACTAGCACGGAGTAGTACTTTACAACACAAATTAAGTGCATTGTCGACCATTTCAACTAGAGAGACATATCGTCCCATCAATCAATTTTACATGCATGCAT criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=1.70 fanout-score-rank=35 prefix-density=0.59 prefix-fanout=1.4 sequence=AGAGAGAGAGATCGAGATGGCAGCGTCCATGATCACGTCGCCTCTGGTGGCGCCGACGAGCCTGCCGTCGCTGTCGCGGCGGGGCTCCAACTTCGCCGTCGTCTGCAGCGGCGGCAAGAAGATCAAGGTCGACAAGCCCCTCGGGATCGGAGGTGGCTTGACGGTGGACATCGACGCCAACGGCAGGAAGGGCACGGGAAAGGGTGTGTACCAGTTTGTTGACAAGTACGGCGCCAACGTCGACGGCTACAGCCCGATCTACACGCCGGAGGTATGGTCCGAATCTGGCGACCGCTACGCCGGTGGGACGACGGGGCTCCTGATCTGGGCCGTCACCCTGGCCGGCCTCCTCGGCGGCGGCGCCCTCCTCGTCTACAACACCAGCGCTCTCGCCGGCTAATTAAGAATCAAGTCATCTCATTCTCATCTATGCAATTGCAAACACAACACAGGGCCGGGTATCTCTCTGCATGTACGTATGCCTGTAATGTACGTAGCTACCTGCTGTGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=129.94 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=6.1 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCACCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTTGGTTC SRR12666908 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 17:55:52 Started mapping on | Dec 07 17:55:53 Finished on | Dec 07 17:58:32 Mapping speed, Million of reads per hour | 580.55 Number of input reads | 25640857 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 23937688 Uniquely mapped reads % | 93.36% Average mapped length | 294.59 Number of splices: Total | 25498922 Number of splices: Annotated (sjdb) | 24043639 Number of splices: GT/AG | 25110868 Number of splices: GC/AG | 332312 Number of splices: AT/AC | 8979 Number of splices: Non-canonical | 46763 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 314104 % of reads mapped to multiple loci | 1.23% Number of reads mapped to too many loci | 33647 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.53% % of reads unmapped: other | 0.75% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1389065 1389065 1389065 N_multimapping 314104 314104 314104 N_noFeature 727399 23203453 880509 N_ambiguous 687189 3314 106556 UnstrandedReadsAssigned:22523100 PositiveStrandReadsAssigned:730921 NegativeStrandReadsAssigned:22950623 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12666908 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12666908-trimmed-pair1.fastq SRR12666908-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,640,857 reads, 23,477,793 reads pseudoaligned [quant] estimated average fragment length: 259.446 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,190 rounds 52973 SRR12666908.ke.tsv 35125 SRR12666908.se.tsv 88098 total ==> SRR12666908.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 677.968 0 0 PNS24247 1044 785.554 19.8265 1.3272 PNS24249 1928 1669.55 25.5599 0.805055 PNS24246 1044 785.554 19.8265 1.3272 PNS24248 1044 785.554 19.8265 1.3272 PNS24244 1471 1212.55 258.961 11.2305 PNS24243 293 99.017 0 0 KQK14069 1603 1344.55 583.131 22.8063 KQK14071 474 239.323 40.0505 8.80014 ==> SRR12666908.se.tsv <== BRADI_1g14170v3 660 BRADI_1g53295v3 123 BRADI_1g59795v3 833 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 276 BRADI_1g74790v3 269 BRADI_1g09890v3 0 BRADI_1g77505v3 390 BRADI_1g48960v3 0 SRR12666908 completed mapping pipeline successfully