Starting /dee2/code/volunteer_pipeline.sh SRR12666909 current disk space = 1516103086080 free memory = 1607717536 SRR12666909 SRAfilesize 73ce1607b4e4dcbf8fc24bd4d23de03d SRR12666909.sra SRR12666909.sra file validated SRR12666909 is paired end SRR12666909 is conventional basespace SRR12666909 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666909_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.406 37.0 37.0 37.0 37.0 37.0 2 36.392 37.0 37.0 37.0 37.0 37.0 3 36.572 37.0 37.0 37.0 37.0 37.0 4 36.505 37.0 37.0 37.0 37.0 37.0 5 36.611 37.0 37.0 37.0 37.0 37.0 6 36.5195 37.0 37.0 37.0 37.0 37.0 7 36.571 37.0 37.0 37.0 37.0 37.0 8 36.5515 37.0 37.0 37.0 37.0 37.0 9 36.6035 37.0 37.0 37.0 37.0 37.0 10-14 36.5749 37.0 37.0 37.0 37.0 37.0 15-19 36.5418 37.0 37.0 37.0 37.0 37.0 20-24 36.5151 37.0 37.0 37.0 37.0 37.0 25-29 36.4806 37.0 37.0 37.0 37.0 37.0 30-34 36.462399999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.4584 37.0 37.0 37.0 37.0 37.0 40-44 36.4398 37.0 37.0 37.0 37.0 37.0 45-49 36.369099999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.3787 37.0 37.0 37.0 37.0 37.0 55-59 36.364000000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.3331 37.0 37.0 37.0 37.0 37.0 65-69 36.3337 37.0 37.0 37.0 37.0 37.0 70-74 36.2605 37.0 37.0 37.0 37.0 37.0 75-79 36.287400000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.2239 37.0 37.0 37.0 37.0 37.0 85-89 36.2172 37.0 37.0 37.0 37.0 37.0 90-94 36.2014 37.0 37.0 37.0 37.0 37.0 95-99 36.084900000000005 37.0 37.0 37.0 37.0 37.0 100-104 36.0935 37.0 37.0 37.0 37.0 37.0 105-109 36.14110000000001 37.0 37.0 37.0 37.0 37.0 110-114 36.0824 37.0 37.0 37.0 37.0 37.0 115-119 36.005300000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.98729999999999 37.0 37.0 37.0 37.0 37.0 125-129 35.9893 37.0 37.0 37.0 37.0 37.0 130-134 35.9995 37.0 37.0 37.0 37.0 37.0 135-139 36.0048 37.0 37.0 37.0 37.0 37.0 140-144 35.810500000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.7588 37.0 37.0 37.0 37.0 37.0 150-151 35.5015 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 2.0 24 1.0 25 4.0 26 7.0 27 7.0 28 14.0 29 22.0 30 30.0 31 31.0 32 49.0 33 76.0 34 140.0 35 310.0 36 2810.0 37 496.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.375 11.975 8.7 37.95 2 21.375 17.8 36.9 23.925 3 21.075 22.775000000000002 25.174999999999997 30.975 4 24.675 31.974999999999998 20.175 23.175 5 25.324999999999996 33.025 21.675 19.975 6 20.549999999999997 33.875 23.525 22.05 7 17.599999999999998 21.8 40.2 20.4 8 20.525 21.15 28.475 29.849999999999998 9 21.175 20.424999999999997 30.65 27.750000000000004 10-14 22.81 26.840000000000003 24.75 25.6 15-19 23.075000000000003 25.885 25.775 25.264999999999997 20-24 22.745 25.95 25.705 25.6 25-29 22.355 25.82 25.82 26.005 30-34 22.78 25.85 25.6 25.77 35-39 22.435 26.075 25.7 25.790000000000003 40-44 22.515 26.669999999999998 24.8 26.015 45-49 22.46 26.119999999999997 25.16 26.26 50-54 23.285 25.945 25.775 24.995 55-59 22.564999999999998 25.979999999999997 25.795 25.66 60-64 23.285 25.4 25.145 26.169999999999998 65-69 22.945 25.474999999999998 25.619999999999997 25.96 70-74 22.900000000000002 26.085 25.535000000000004 25.480000000000004 75-79 23.189999999999998 25.655 25.94 25.215 80-84 22.865 26.575 25.31 25.25 85-89 23.265 26.25 25.34 25.145 90-94 23.89 25.064999999999998 24.845 26.200000000000003 95-99 22.71 26.195 25.775 25.319999999999997 100-104 23.494999999999997 25.545 25.314999999999998 25.645 105-109 23.18 26.185000000000002 25.4 25.235000000000003 110-114 23.94 25.515 25.655 24.89 115-119 23.61 25.900000000000002 24.93 25.56 120-124 23.695 25.81 25.0 25.495 125-129 23.599999999999998 25.845000000000002 24.865000000000002 25.69 130-134 24.4 25.005 24.945 25.650000000000002 135-139 23.945 26.115 24.279999999999998 25.66 140-144 23.625 26.13 24.68 25.564999999999998 145-149 23.595 25.77 25.235000000000003 25.4 150-151 24.375 24.8125 25.0625 25.75 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 0.5 26 2.0 27 3.0 28 3.5 29 4.0 30 5.5 31 10.0 32 12.5 33 16.5 34 23.0 35 33.5 36 46.5 37 62.0 38 79.5 39 113.0 40 132.5 41 149.0 42 184.5 43 197.5 44 203.5 45 212.5 46 218.5 47 204.0 48 184.0 49 194.0 50 183.0 51 166.5 52 151.5 53 125.5 54 114.5 55 101.5 56 94.5 57 89.5 58 81.5 59 67.5 60 59.5 61 55.0 62 48.5 63 55.0 64 56.5 65 42.5 66 38.0 67 41.5 68 32.0 69 24.0 70 20.0 71 14.5 72 11.5 73 7.5 74 7.0 75 6.0 76 3.5 77 1.5 78 0.0 79 0.5 80 1.0 81 0.5 82 0.0 83 1.0 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.45 #Duplication Level Percentage of deduplicated Percentage of total 1 90.60254284134881 81.95 2 8.45771144278607 15.299999999999999 3 0.7186290768380321 1.95 4 0.22111663902708678 0.8 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.42500000000000004 0.0 0.0 0.0 0.0 102-103 0.4875 0.0 0.0 0.0 0.0 104-105 0.625 0.0 0.0 0.0 0.0 106-107 0.7 0.0 0.0 0.0 0.0 108-109 0.825 0.0 0.0 0.0 0.0 110-111 1.125 0.0 0.0 0.0 0.0 112-113 1.3375 0.0 0.0 0.0 0.0 114-115 1.5625 0.0 0.0 0.0 0.0 116-117 1.7125 0.0 0.0 0.0 0.0 118-119 1.9500000000000002 0.0 0.0 0.0 0.0 120-121 2.1125 0.0 0.0 0.0 0.0 122-123 2.3875 0.0 0.0 0.0 0.0 124-125 2.6875 0.0 0.0 0.0 0.0 126-127 3.025 0.0 0.0 0.0 0.0 128-129 3.3375000000000004 0.0 0.0 0.0 0.0 130-131 3.675 0.0 0.0 0.0 0.0 132-133 4.15 0.0 0.0 0.0 0.0 134-135 4.5375 0.0 0.0 0.0 0.0 136-137 4.825 0.0 0.0 0.0 0.0 138-139 5.199999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12666909 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666909_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.13 37.0 37.0 37.0 37.0 37.0 2 35.9255 37.0 37.0 37.0 37.0 37.0 3 36.2165 37.0 37.0 37.0 37.0 37.0 4 36.2485 37.0 37.0 37.0 37.0 37.0 5 36.2515 37.0 37.0 37.0 37.0 37.0 6 36.1795 37.0 37.0 37.0 37.0 37.0 7 36.1895 37.0 37.0 37.0 37.0 37.0 8 36.3455 37.0 37.0 37.0 37.0 37.0 9 36.3085 37.0 37.0 37.0 37.0 37.0 10-14 36.2816 37.0 37.0 37.0 37.0 37.0 15-19 36.211800000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.2089 37.0 37.0 37.0 37.0 37.0 25-29 36.1788 37.0 37.0 37.0 37.0 37.0 30-34 36.128099999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.1425 37.0 37.0 37.0 37.0 37.0 40-44 36.0954 37.0 37.0 37.0 37.0 37.0 45-49 36.105399999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.079699999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.0891 37.0 37.0 37.0 37.0 37.0 60-64 35.9576 37.0 37.0 37.0 37.0 37.0 65-69 35.9531 37.0 37.0 37.0 37.0 37.0 70-74 35.9268 37.0 37.0 37.0 37.0 37.0 75-79 35.9337 37.0 37.0 37.0 37.0 37.0 80-84 35.92530000000001 37.0 37.0 37.0 37.0 37.0 85-89 35.9154 37.0 37.0 37.0 37.0 37.0 90-94 35.9182 37.0 37.0 37.0 37.0 37.0 95-99 35.8543 37.0 37.0 37.0 37.0 37.0 100-104 35.85719999999999 37.0 37.0 37.0 37.0 37.0 105-109 35.8527 37.0 37.0 37.0 37.0 37.0 110-114 35.759 37.0 37.0 37.0 37.0 37.0 115-119 35.776 37.0 37.0 37.0 37.0 37.0 120-124 35.7962 37.0 37.0 37.0 37.0 37.0 125-129 35.825900000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.7971 37.0 37.0 37.0 37.0 37.0 135-139 35.62829999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.643899999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.563 37.0 37.0 37.0 37.0 37.0 150-151 35.19 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 6.0 14 5.0 15 1.0 16 0.0 17 2.0 18 1.0 19 3.0 20 3.0 21 8.0 22 7.0 23 6.0 24 9.0 25 6.0 26 8.0 27 13.0 28 11.0 29 15.0 30 16.0 31 34.0 32 51.0 33 87.0 34 164.0 35 456.0 36 2651.0 37 436.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.25 16.400000000000002 9.925 31.424999999999997 2 27.05 22.425 31.95 18.575 3 22.8 23.95 27.125 26.125 4 25.7 32.925 18.9 22.475 5 27.825 33.050000000000004 18.65 20.474999999999998 6 22.0 35.175 19.85 22.975 7 21.4 16.075 37.175000000000004 25.35 8 22.125 20.525 24.85 32.5 9 25.674999999999997 20.7 25.75 27.875 10-14 25.755 24.975 23.805 25.465 15-19 25.419999999999998 25.430000000000003 23.89 25.259999999999998 20-24 25.825 25.014999999999997 24.01 25.15 25-29 25.735000000000003 25.45 24.23 24.585 30-34 25.88 25.230000000000004 24.295 24.595 35-39 25.759999999999998 25.424999999999997 24.560000000000002 24.255 40-44 25.369999999999997 25.585 24.72 24.325 45-49 25.779999999999998 25.455 24.82 23.945 50-54 25.82 25.545 24.075 24.560000000000002 55-59 25.56 24.79 24.535 25.115 60-64 26.369999999999997 25.629999999999995 24.38 23.62 65-69 26.145000000000003 25.36 24.73 23.765 70-74 26.0 25.53 24.740000000000002 23.73 75-79 26.1 25.16 24.72 24.02 80-84 26.119999999999997 25.595000000000002 24.52 23.765 85-89 25.53 25.21 25.105 24.154999999999998 90-94 26.39 25.14 24.279999999999998 24.19 95-99 25.655 25.77 24.834999999999997 23.74 100-104 26.47 25.395 24.69 23.445 105-109 26.384999999999998 25.27 24.635 23.71 110-114 26.82 25.39 24.37 23.419999999999998 115-119 26.484999999999996 25.215 24.82 23.48 120-124 26.195 25.669999999999998 24.455 23.68 125-129 26.265 25.255 25.324999999999996 23.155 130-134 26.47 26.029999999999998 24.605 22.895 135-139 26.415 25.995 24.645 22.945 140-144 26.695 25.855 24.665 22.785 145-149 26.279999999999998 26.205000000000002 24.610000000000003 22.905 150-151 26.737499999999997 26.0125 24.3625 22.8875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 0.5 17 1.0 18 1.5 19 0.5 20 0.5 21 0.5 22 0.0 23 0.0 24 1.0 25 1.5 26 1.5 27 2.0 28 3.5 29 5.0 30 4.5 31 8.5 32 15.0 33 17.0 34 18.5 35 29.0 36 36.0 37 47.0 38 59.0 39 80.5 40 119.5 41 136.0 42 153.5 43 167.5 44 175.0 45 202.5 46 197.5 47 166.0 48 176.5 49 187.5 50 158.5 51 144.5 52 150.0 53 137.0 54 128.0 55 114.5 56 97.0 57 97.0 58 92.5 59 88.5 60 75.5 61 73.5 62 77.0 63 68.0 64 66.0 65 61.0 66 58.5 67 54.5 68 51.0 69 47.0 70 34.5 71 33.5 72 30.5 73 17.5 74 8.5 75 2.0 76 2.0 77 3.0 78 1.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 1.0 88 1.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 1.0 95 1.5 96 0.5 97 0.0 98 0.5 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.625 #Duplication Level Percentage of deduplicated Percentage of total 1 90.81379310344828 82.3 2 8.386206896551725 15.2 3 0.5241379310344828 1.425 4 0.2206896551724138 0.8 5 0.027586206896551724 0.125 6 0.027586206896551724 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit GTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCCGGTTCGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.44999999999999996 0.0 0.0 0.0 0.0 102-103 0.5125 0.0 0.0 0.0 0.0 104-105 0.6625000000000001 0.0 0.0 0.0 0.0 106-107 0.75 0.0 0.0 0.0 0.0 108-109 0.9 0.0 0.0 0.0 0.0 110-111 1.1749999999999998 0.0 0.0 0.0 0.0 112-113 1.4125 0.0 0.0 0.0 0.0 114-115 1.6375000000000002 0.0 0.0 0.0 0.0 116-117 1.7875 0.0 0.0 0.0 0.0 118-119 2.025 0.0 0.0 0.0 0.0 120-121 2.175 0.0 0.0 0.0 0.0 122-123 2.4375 0.0 0.0 0.0 0.0 124-125 2.7375 0.0 0.0 0.0 0.0 126-127 3.0625 0.0 0.0 0.0 0.0 128-129 3.3625 0.0 0.0 0.0 0.0 130-131 3.7 0.0 0.0 0.0 0.0 132-133 4.1625 0.0 0.0 0.0 0.0 134-135 4.5375 0.0 0.0 0.0 0.0 136-137 4.8125 0.0 0.0 0.0 0.0 138-139 5.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1848709 spots for SRR12666909.sra Written 1848709 spots for SRR12666909.sra Read 1848709 spots for SRR12666909.sra Written 1848709 spots for SRR12666909.sra Read 1848719 spots for SRR12666909.sra Written 1848719 spots for SRR12666909.sra Read 1848709 spots for SRR12666909.sra Written 1848709 spots for SRR12666909.sra Read 1848709 spots for SRR12666909.sra Written 1848709 spots for SRR12666909.sra Read 1848709 spots for SRR12666909.sra Written 1848709 spots for SRR12666909.sra Read 1848709 spots for SRR12666909.sra Written 1848709 spots for SRR12666909.sra Read 1848709 spots for SRR12666909.sra Written 1848709 spots for SRR12666909.sra Read 1848709 spots for SRR12666909.sra Written 1848709 spots for SRR12666909.sra Read 1848709 spots for SRR12666909.sra Written 1848709 spots for SRR12666909.sra Read 1848709 spots for SRR12666909.sra Written 1848709 spots for SRR12666909.sra Read 1848709 spots for SRR12666909.sra Written 1848709 spots for SRR12666909.sra Read 1848709 spots for SRR12666909.sra Written 1848709 spots for SRR12666909.sra Read 1848709 spots for SRR12666909.sra Written 1848709 spots for SRR12666909.sra Read 1848709 spots for SRR12666909.sra Written 1848709 spots for SRR12666909.sra Read 1848709 spots for SRR12666909.sra Written 1848709 spots for SRR12666909.sra Read 1848709 spots for SRR12666909.sra Written 1848709 spots for SRR12666909.sra Read 1848709 spots for SRR12666909.sra Written 1848709 spots for SRR12666909.sra Read 1848709 spots for SRR12666909.sra Written 1848709 spots for SRR12666909.sra Read 1848709 spots for SRR12666909.sra Written 1848709 spots for SRR12666909.sra SRR ids: ['SRR12666909.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qgr5kq9u SRR12666909.sra spots: 36974190 blocks: [[1, 1848709], [1848710, 3697418], [3697419, 5546127], [5546128, 7394836], [7394837, 9243545], [9243546, 11092254], [11092255, 12940963], [12940964, 14789672], [14789673, 16638381], [16638382, 18487090], [18487091, 20335799], [20335800, 22184508], [22184509, 24033217], [24033218, 25881926], [25881927, 27730635], [27730636, 29579344], [29579345, 31428053], [31428054, 33276762], [33276763, 35125471], [35125472, 36974190]] SRR12666909 file size 12543747 SRR12666909 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12666909 SRR12666909_1.fastq SRR12666909_2.fastq Input file: SRR12666909_1.fastq Paired file: SRR12666909_2.fastq trimmed: SRR12666909-trimmed-pair1.fastq, SRR12666909-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Dec 12 02:17:41 2024 >> started Thu Dec 12 02:18:39 2024 >> done (58.226s) 36974190 read pairs processed; of these: 102 ( 0.00%) short read pairs filtered out after trimming by size control 2486 ( 0.01%) empty read pairs filtered out after trimming by size control 36971602 (99.99%) read pairs available; of these: 2989137 ( 8.08%) trimmed read pairs available after processing 33982465 (91.92%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 15 0.00% 20 18 0.00% 21 15 0.00% 22 37 0.00% 23 26 0.00% 24 31 0.00% 25 34 0.00% 26 33 0.00% 27 36 0.00% 28 45 0.00% 29 43 0.00% 30 46 0.00% 31 47 0.00% 32 52 0.00% 33 47 0.00% 34 46 0.00% 35 76 0.00% 36 51 0.00% 37 64 0.00% 38 75 0.00% 39 49 0.00% 40 56 0.00% 41 64 0.00% 42 86 0.00% 43 78 0.00% 44 62 0.00% 45 101 0.00% 46 78 0.00% 47 75 0.00% 48 90 0.00% 49 88 0.00% 50 108 0.00% 51 105 0.00% 52 114 0.00% 53 126 0.00% 54 151 0.00% 55 158 0.00% 56 146 0.00% 57 201 0.00% 58 163 0.00% 59 244 0.00% 60 272 0.00% 61 282 0.00% 62 308 0.00% 63 302 0.00% 64 343 0.00% 65 374 0.00% 66 463 0.00% 67 472 0.00% 68 507 0.00% 69 613 0.00% 70 705 0.00% 71 766 0.00% 72 913 0.00% 73 1092 0.00% 74 1200 0.00% 75 1287 0.00% 76 1475 0.00% 77 1555 0.00% 78 1871 0.01% 79 2134 0.01% 80 2327 0.01% 81 2795 0.01% 82 3265 0.01% 83 3680 0.01% 84 4060 0.01% 85 4568 0.01% 86 5014 0.01% 87 5414 0.01% 88 5981 0.02% 89 6310 0.02% 90 7333 0.02% 91 8153 0.02% 92 9029 0.02% 93 9996 0.03% 94 11016 0.03% 95 11881 0.03% 96 12837 0.03% 97 13716 0.04% 98 14498 0.04% 99 15580 0.04% 100 16684 0.05% 101 18106 0.05% 102 19409 0.05% 103 21015 0.06% 104 22359 0.06% 105 23818 0.06% 106 25159 0.07% 107 26001 0.07% 108 27093 0.07% 109 28804 0.08% 110 29367 0.08% 111 31572 0.09% 112 33722 0.09% 113 34983 0.09% 114 36737 0.10% 115 38587 0.10% 116 39925 0.11% 117 41355 0.11% 118 42584 0.12% 119 43395 0.12% 120 45081 0.12% 121 46780 0.13% 122 48349 0.13% 123 51190 0.14% 124 53470 0.14% 125 54994 0.15% 126 56792 0.15% 127 57576 0.16% 128 58700 0.16% 129 60802 0.16% 130 61543 0.17% 131 62755 0.17% 132 65432 0.18% 133 67841 0.18% 134 70170 0.19% 135 72773 0.20% 136 74858 0.20% 137 75766 0.20% 138 77160 0.21% 139 78490 0.21% 140 78424 0.21% 141 80291 0.22% 142 83035 0.22% 143 84872 0.23% 144 86880 0.23% 145 89777 0.24% 146 91386 0.25% 147 92727 0.25% 148 93983 0.25% 149 93427 0.25% 150 95556 0.26% 151 33982465 91.92% 36971602 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=4.81 fanout-score-rank=23 prefix-density=0.25 prefix-fanout=3.3 sequence=GATCTCGCCGAAG criterion=fanout-score sequence-density=0.05 sequence-density-rank=23 fanout-score=329.32 fanout-score-rank=1 prefix-density=0.61 prefix-fanout=28.9 sequence=TCTTCTTCTTGTC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.28 fanout-score-rank=34 prefix-density=0.43 prefix-fanout=2.2 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=35 fanout-score=607.34 fanout-score-rank=1 prefix-density=0.82 prefix-fanout=19.4 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGACACCGTGACTTCATCAAGAACATGATTACCGGTACCTCCCAGGCTGACTGTGCCGTGCTTATCATTGACTCCACGACTGGAGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCATGCCCTCCTTGCTTTCACTCTTGGAGTGAAGCAGATGATCTGCTGCTGCAACAAGATGGA SRR12666909 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 12 02:19:24 Started mapping on | Dec 12 02:19:25 Finished on | Dec 12 02:23:07 Mapping speed, Million of reads per hour | 599.54 Number of input reads | 36971602 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 35259191 Uniquely mapped reads % | 95.37% Average mapped length | 297.49 Number of splices: Total | 38827932 Number of splices: Annotated (sjdb) | 36438592 Number of splices: GT/AG | 38295865 Number of splices: GC/AG | 436727 Number of splices: AT/AC | 28132 Number of splices: Non-canonical | 67208 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 2.49 Insertion rate per base | 0.01% Insertion average length | 2.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 498079 % of reads mapped to multiple loci | 1.35% Number of reads mapped to too many loci | 48449 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.36% % of reads unmapped: other | 0.79% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1214332 1214332 1214332 N_multimapping 498079 498079 498079 N_noFeature 1186331 34417912 1458412 N_ambiguous 676491 4877 108439 UnstrandedReadsAssigned:33396369 PositiveStrandReadsAssigned:836402 NegativeStrandReadsAssigned:33692340 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12666909 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12666909-trimmed-pair1.fastq SRR12666909-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 36,971,602 reads, 34,090,417 reads pseudoaligned [quant] estimated average fragment length: 289 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,332 rounds 52973 SRR12666909.ke.tsv 35125 SRR12666909.se.tsv 88098 total ==> SRR12666909.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 648.859 0 0 PNS24247 1044 756 191.214 11.221 PNS24249 1928 1640 150.989 4.08445 PNS24246 1044 756 191.214 11.221 PNS24248 1044 756 191.214 11.221 PNS24244 1471 1183 262.37 9.83923 PNS24243 293 89.7873 0 0 KQK14069 1603 1315 5015.06 169.193 KQK14071 474 220.95 63.2754 12.705 ==> SRR12666909.se.tsv <== BRADI_1g14170v3 5419 BRADI_1g53295v3 202 BRADI_1g59795v3 829 BRADI_1g07683v3 0 BRADI_1g00485v3 120 BRADI_1g20270v3 2745 BRADI_1g74790v3 114 BRADI_1g09890v3 0 BRADI_1g77505v3 246 BRADI_1g48960v3 0 SRR12666909 completed mapping pipeline successfully