Starting /dee2/code/volunteer_pipeline.sh SRR12666910 current disk space = 1540742393856 free memory = 1599150792 SRR12666910 SRAfilesize df40763f04ab4092cb29eb4a7a5754ca SRR12666910.sra SRR12666910.sra file validated SRR12666910 is paired end SRR12666910 is conventional basespace SRR12666910 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666910_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3915 37.0 37.0 37.0 37.0 37.0 2 36.33775 37.0 37.0 37.0 37.0 37.0 3 36.4625 37.0 37.0 37.0 37.0 37.0 4 36.4985 37.0 37.0 37.0 37.0 37.0 5 36.5485 37.0 37.0 37.0 37.0 37.0 6 36.5495 37.0 37.0 37.0 37.0 37.0 7 36.4945 37.0 37.0 37.0 37.0 37.0 8 36.601 37.0 37.0 37.0 37.0 37.0 9 36.5575 37.0 37.0 37.0 37.0 37.0 10-14 36.5375 37.0 37.0 37.0 37.0 37.0 15-19 36.52239999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.4867 37.0 37.0 37.0 37.0 37.0 25-29 36.4738 37.0 37.0 37.0 37.0 37.0 30-34 36.411199999999994 37.0 37.0 37.0 37.0 37.0 35-39 36.4042 37.0 37.0 37.0 37.0 37.0 40-44 36.3948 37.0 37.0 37.0 37.0 37.0 45-49 36.3122 37.0 37.0 37.0 37.0 37.0 50-54 36.304199999999994 37.0 37.0 37.0 37.0 37.0 55-59 36.2738 37.0 37.0 37.0 37.0 37.0 60-64 36.293400000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.2633 37.0 37.0 37.0 37.0 37.0 70-74 36.2562 37.0 37.0 37.0 37.0 37.0 75-79 36.1962 37.0 37.0 37.0 37.0 37.0 80-84 36.1778 37.0 37.0 37.0 37.0 37.0 85-89 36.116 37.0 37.0 37.0 37.0 37.0 90-94 36.1518 37.0 37.0 37.0 37.0 37.0 95-99 36.0775 37.0 37.0 37.0 37.0 37.0 100-104 36.126 37.0 37.0 37.0 37.0 37.0 105-109 36.1404 37.0 37.0 37.0 37.0 37.0 110-114 36.017199999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.979400000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.9933 37.0 37.0 37.0 37.0 37.0 125-129 35.926199999999994 37.0 37.0 37.0 37.0 37.0 130-134 35.9371 37.0 37.0 37.0 37.0 37.0 135-139 35.9319 37.0 37.0 37.0 37.0 37.0 140-144 35.7211 37.0 37.0 37.0 37.0 37.0 145-149 35.605000000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.368750000000006 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 3.0 24 6.0 25 5.0 26 6.0 27 9.0 28 23.0 29 14.0 30 25.0 31 45.0 32 62.0 33 97.0 34 127.0 35 306.0 36 2753.0 37 518.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.575 14.000000000000002 8.7 35.725 2 22.892169126845133 16.86264698523893 35.326494871153365 24.91868901676257 3 21.575 24.5 25.7 28.225 4 26.325 29.775000000000002 21.525 22.375 5 24.55 33.925 22.650000000000002 18.875 6 22.975 32.800000000000004 22.2 22.025 7 16.8 21.7 40.35 21.15 8 19.900000000000002 20.625 29.225 30.25 9 20.925 18.55 32.074999999999996 28.449999999999996 10-14 23.9 25.82 24.87 25.41 15-19 23.494999999999997 25.1 25.419999999999998 25.985000000000003 20-24 23.7 25.385 25.835 25.080000000000002 25-29 23.47 24.88 25.39 26.26 30-34 23.23 25.195 25.775 25.8 35-39 23.799999999999997 25.405 25.419999999999998 25.374999999999996 40-44 23.445 25.28 25.25 26.025 45-49 24.0 25.46 24.805 25.735000000000003 50-54 23.91 25.11 25.15 25.83 55-59 23.985 24.834999999999997 25.495 25.685000000000002 60-64 23.674999999999997 25.45 24.654999999999998 26.22 65-69 23.330000000000002 24.62 25.775 26.275 70-74 23.990000000000002 25.0 24.709999999999997 26.3 75-79 24.08 25.095 24.555 26.27 80-84 23.799999999999997 25.369999999999997 24.815 26.015 85-89 23.755000000000003 24.685000000000002 25.77 25.790000000000003 90-94 24.385 24.985 24.115000000000002 26.515 95-99 24.245 23.990000000000002 25.3 26.465 100-104 24.895 24.715 24.51 25.88 105-109 24.91 25.135 24.82 25.135 110-114 24.4 25.205 24.625 25.77 115-119 24.375 24.665 24.87 26.090000000000003 120-124 24.64 24.615000000000002 24.13 26.615 125-129 24.525 24.765 24.635 26.075 130-134 24.415 24.685000000000002 25.014999999999997 25.885 135-139 24.12 24.34 24.735 26.805 140-144 25.165 24.37 24.525 25.94 145-149 24.85 24.935 24.52 25.695 150-151 26.25 24.525 23.425 25.8 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 1.0 25 2.0 26 2.0 27 1.0 28 2.0 29 4.5 30 6.5 31 12.0 32 13.5 33 16.5 34 26.5 35 33.0 36 47.0 37 63.5 38 83.5 39 110.0 40 132.0 41 140.0 42 151.5 43 169.0 44 172.5 45 176.5 46 194.0 47 199.5 48 183.0 49 172.0 50 169.5 51 159.5 52 140.0 53 125.0 54 103.5 55 101.5 56 103.0 57 89.5 58 84.5 59 80.5 60 79.0 61 76.0 62 74.0 63 68.0 64 58.0 65 52.0 66 50.0 67 53.0 68 47.5 69 40.0 70 31.0 71 22.5 72 21.5 73 15.0 74 12.5 75 11.0 76 6.0 77 4.5 78 3.5 79 1.5 80 0.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.95 #Duplication Level Percentage of deduplicated Percentage of total 1 92.1152800435019 84.7 2 7.096247960848287 13.05 3 0.7069059271343121 1.95 4 0.08156606851549755 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.23750000000000002 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.32499999999999996 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.6625 0.0 0.0 0.0 0.0 98-99 0.75 0.0 0.0 0.0 0.0 100-101 0.8875 0.0 0.0 0.0 0.0 102-103 1.025 0.0 0.0 0.0 0.0 104-105 1.3 0.0 0.0 0.0 0.0 106-107 1.55 0.0 0.0 0.0 0.0 108-109 1.7000000000000002 0.0 0.0 0.0 0.0 110-111 1.975 0.0 0.0 0.0 0.0 112-113 2.1624999999999996 0.0 0.0 0.0 0.0 114-115 2.3625 0.0 0.0 0.0 0.0 116-117 2.775 0.0 0.0 0.0 0.0 118-119 3.0625 0.0 0.0 0.0 0.0 120-121 3.325 0.0 0.0 0.0 0.0 122-123 3.75 0.0 0.0 0.0 0.0 124-125 4.0375 0.0 0.0 0.0 0.0 126-127 4.387499999999999 0.0 0.0 0.0 0.0 128-129 4.699999999999999 0.0 0.0 0.0 0.0 130-131 5.125 0.0 0.0 0.0 0.0 132-133 5.4625 0.0 0.0 0.0 0.0 134-135 5.875 0.0 0.0 0.0 0.0 136-137 6.2625 0.0 0.0 0.0 0.0 138-139 6.487500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TACAGAA 10 0.006830828 145.0 2 GTACAGA 10 0.006830828 145.0 1 CTGCGCA 10 0.006830828 145.0 145 AGAAAGT 10 0.006830828 145.0 5 CAGAAAG 10 0.006830828 145.0 4 AGTTTTT 10 0.006830828 145.0 9 >>END_MODULE SRR12666910 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666910_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0205 37.0 37.0 37.0 37.0 37.0 2 35.9015 37.0 37.0 37.0 37.0 37.0 3 36.0435 37.0 37.0 37.0 37.0 37.0 4 36.1475 37.0 37.0 37.0 37.0 37.0 5 36.1735 37.0 37.0 37.0 37.0 37.0 6 36.064 37.0 37.0 37.0 37.0 37.0 7 36.1105 37.0 37.0 37.0 37.0 37.0 8 36.174 37.0 37.0 37.0 37.0 37.0 9 36.175 37.0 37.0 37.0 37.0 37.0 10-14 36.2548 37.0 37.0 37.0 37.0 37.0 15-19 36.1126 37.0 37.0 37.0 37.0 37.0 20-24 36.2065 37.0 37.0 37.0 37.0 37.0 25-29 36.120999999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.0449 37.0 37.0 37.0 37.0 37.0 35-39 36.0949 37.0 37.0 37.0 37.0 37.0 40-44 36.0287 37.0 37.0 37.0 37.0 37.0 45-49 35.9784 37.0 37.0 37.0 37.0 37.0 50-54 35.945299999999996 37.0 37.0 37.0 37.0 37.0 55-59 35.9843 37.0 37.0 37.0 37.0 37.0 60-64 35.963499999999996 37.0 37.0 37.0 37.0 37.0 65-69 35.91429999999999 37.0 37.0 37.0 37.0 37.0 70-74 35.862300000000005 37.0 37.0 37.0 37.0 37.0 75-79 35.890699999999995 37.0 37.0 37.0 37.0 37.0 80-84 35.8728 37.0 37.0 37.0 37.0 37.0 85-89 35.8725 37.0 37.0 37.0 37.0 37.0 90-94 35.8659 37.0 37.0 37.0 37.0 37.0 95-99 35.82260000000001 37.0 37.0 37.0 37.0 37.0 100-104 35.7882 37.0 37.0 37.0 37.0 37.0 105-109 35.74249999999999 37.0 37.0 37.0 37.0 37.0 110-114 35.7279 37.0 37.0 37.0 37.0 37.0 115-119 35.6623 37.0 37.0 37.0 37.0 37.0 120-124 35.6841 37.0 37.0 37.0 37.0 37.0 125-129 35.6494 37.0 37.0 37.0 37.0 37.0 130-134 35.6445 37.0 37.0 37.0 37.0 37.0 135-139 35.4689 37.0 37.0 37.0 37.0 37.0 140-144 35.3883 37.0 37.0 37.0 37.0 37.0 145-149 35.3351 37.0 37.0 37.0 34.6 37.0 150-151 35.00725 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 2.0 14 4.0 15 2.0 16 2.0 17 1.0 18 2.0 19 2.0 20 6.0 21 4.0 22 8.0 23 10.0 24 10.0 25 6.0 26 10.0 27 16.0 28 17.0 29 16.0 30 25.0 31 40.0 32 68.0 33 91.0 34 186.0 35 490.0 36 2575.0 37 405.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.65 15.9 10.2 29.25 2 28.999999999999996 20.525 28.625 21.85 3 24.775 23.925 26.1 25.2 4 27.900000000000002 31.6 17.5 23.0 5 27.150000000000002 33.5 18.05 21.3 6 22.525000000000002 33.025 21.224999999999998 23.225 7 22.975 15.35 36.225 25.45 8 22.525000000000002 20.125 24.725 32.625 9 25.474999999999998 20.7 24.775 29.049999999999997 10-14 26.290000000000003 25.245 22.605 25.86 15-19 26.284999999999997 23.93 24.485 25.3 20-24 26.19 25.15 23.45 25.21 25-29 26.465 24.54 23.435 25.56 30-34 26.200000000000003 24.57 23.294999999999998 25.935000000000002 35-39 26.119999999999997 24.92 23.415 25.545 40-44 26.205000000000002 24.925 23.44 25.430000000000003 45-49 26.965 24.38 23.77 24.884999999999998 50-54 25.924999999999997 24.725 23.775 25.575 55-59 26.484999999999996 24.495 23.549999999999997 25.47 60-64 26.584999999999997 24.5 23.935000000000002 24.98 65-69 26.07 24.985 23.75 25.195 70-74 26.974999999999998 24.075 24.12 24.83 75-79 26.645000000000003 24.785 23.18 25.39 80-84 26.525 24.645 23.715 25.115 85-89 26.865 24.94 23.57 24.625 90-94 27.13 24.29 23.535 25.045 95-99 26.845000000000002 25.019999999999996 24.07 24.065 100-104 26.31 24.85 24.025 24.815 105-109 26.405 25.369999999999997 24.14 24.085 110-114 26.66 25.564999999999998 23.69 24.085 115-119 26.775 24.915000000000003 23.605 24.705 120-124 27.224999999999998 24.84 23.98 23.955000000000002 125-129 27.325 25.27 23.35 24.055 130-134 27.250000000000004 25.009999999999998 24.275 23.465 135-139 28.03 25.46 23.785 22.725 140-144 28.044999999999998 25.650000000000002 23.345 22.96 145-149 28.79 25.014999999999997 23.294999999999998 22.900000000000002 150-151 28.225 25.837500000000002 23.474999999999998 22.4625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.5 15 1.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.5 25 1.5 26 1.5 27 2.5 28 5.5 29 6.0 30 5.5 31 8.0 32 11.0 33 9.0 34 12.5 35 26.0 36 35.5 37 42.0 38 65.0 39 84.5 40 100.0 41 115.5 42 121.5 43 151.5 44 172.0 45 170.0 46 166.0 47 162.0 48 165.0 49 169.0 50 148.0 51 132.0 52 128.5 53 110.0 54 106.0 55 102.0 56 98.0 57 108.0 58 108.5 59 107.5 60 109.5 61 102.5 62 99.0 63 84.0 64 75.0 65 80.0 66 73.0 67 67.5 68 65.0 69 58.0 70 53.0 71 40.5 72 30.0 73 27.0 74 19.5 75 16.0 76 12.5 77 5.0 78 2.5 79 3.0 80 1.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 1.0 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 2.0 97 1.5 98 1.0 99 1.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.975 #Duplication Level Percentage of deduplicated Percentage of total 1 92.226148409894 84.82499999999999 2 7.012775210655069 12.9 3 0.6251698831204131 1.725 4 0.10872519706441967 0.4 5 0.0 0.0 6 0.02718129926610492 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.07500000000000001 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.3625 0.0 0.0 0.0 0.0 90-91 0.42500000000000004 0.0 0.0 0.0 0.0 92-93 0.4875 0.0 0.0 0.0 0.0 94-95 0.6000000000000001 0.0 0.0 0.0 0.0 96-97 0.7749999999999999 0.0 0.0 0.0 0.0 98-99 0.875 0.0 0.0 0.0 0.0 100-101 1.0125 0.0 0.0 0.0 0.0 102-103 1.1625 0.0 0.0 0.0 0.0 104-105 1.475 0.0 0.0 0.0 0.0 106-107 1.725 0.0 0.0 0.0 0.0 108-109 1.875 0.0 0.0 0.0 0.0 110-111 2.1500000000000004 0.0 0.0 0.0 0.0 112-113 2.35 0.0 0.0 0.0 0.0 114-115 2.5625 0.0 0.0 0.0 0.0 116-117 2.975 0.0 0.0 0.0 0.0 118-119 3.2625 0.0 0.0 0.0 0.0 120-121 3.525 0.0 0.0 0.0 0.0 122-123 3.9625000000000004 0.0 0.0 0.0 0.0125 124-125 4.2875 0.0 0.0 0.0 0.025 126-127 4.637499999999999 0.0 0.0 0.0 0.025 128-129 4.975 0.0 0.0 0.0 0.025 130-131 5.4125 0.0 0.0 0.0 0.025 132-133 5.7375 0.0 0.0 0.0 0.025 134-135 6.15 0.0 0.0 0.0 0.025 136-137 6.5375 0.0 0.0 0.0 0.025 138-139 6.762499999999999 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCTACG 10 0.006830828 145.0 3 CCGTTAA 10 0.006830828 145.0 145 GCTACGA 10 0.006830828 145.0 4 TACGACC 10 0.006830828 145.0 6 ACGACCG 10 0.006830828 145.0 7 >>END_MODULE Read 1507293 spots for SRR12666910.sra Written 1507293 spots for SRR12666910.sra Read 1507293 spots for SRR12666910.sra Written 1507293 spots for SRR12666910.sra Read 1507293 spots for SRR12666910.sra Written 1507293 spots for SRR12666910.sra Read 1507293 spots for SRR12666910.sra Written 1507293 spots for SRR12666910.sra Read 1507293 spots for SRR12666910.sra Written 1507293 spots for SRR12666910.sra Read 1507293 spots for SRR12666910.sra Written 1507293 spots for SRR12666910.sra Read 1507293 spots for SRR12666910.sra Written 1507293 spots for SRR12666910.sra Read 1507293 spots for SRR12666910.sra Written 1507293 spots for SRR12666910.sra Read 1507293 spots for SRR12666910.sra Written 1507293 spots for SRR12666910.sra Read 1507293 spots for SRR12666910.sra Written 1507293 spots for SRR12666910.sra Read 1507307 spots for SRR12666910.sra Written 1507307 spots for SRR12666910.sra Read 1507293 spots for SRR12666910.sra Written 1507293 spots for SRR12666910.sra Read 1507293 spots for SRR12666910.sra Written 1507293 spots for SRR12666910.sra Read 1507293 spots for SRR12666910.sra Written 1507293 spots for SRR12666910.sra Read 1507293 spots for SRR12666910.sra Written 1507293 spots for SRR12666910.sra Read 1507293 spots for SRR12666910.sra Written 1507293 spots for SRR12666910.sra Read 1507293 spots for SRR12666910.sra Written 1507293 spots for SRR12666910.sra Read 1507293 spots for SRR12666910.sra Written 1507293 spots for SRR12666910.sra Read 1507293 spots for SRR12666910.sra Written 1507293 spots for SRR12666910.sra Read 1507293 spots for SRR12666910.sra Written 1507293 spots for SRR12666910.sra SRR ids: ['SRR12666910.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_240veser SRR12666910.sra spots: 30145874 blocks: [[1, 1507293], [1507294, 3014586], [3014587, 4521879], [4521880, 6029172], [6029173, 7536465], [7536466, 9043758], [9043759, 10551051], [10551052, 12058344], [12058345, 13565637], [13565638, 15072930], [15072931, 16580223], [16580224, 18087516], [18087517, 19594809], [19594810, 21102102], [21102103, 22609395], [22609396, 24116688], [24116689, 25623981], [25623982, 27131274], [27131275, 28638567], [28638568, 30145874]] SRR12666910 file size 10223186 SRR12666910 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12666910 SRR12666910_1.fastq SRR12666910_2.fastq Input file: SRR12666910_1.fastq Paired file: SRR12666910_2.fastq trimmed: SRR12666910-trimmed-pair1.fastq, SRR12666910-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 18:03:16 2024 >> started Sat Dec 7 18:03:55 2024 >> done (38.426s) 30145874 read pairs processed; of these: 80 ( 0.00%) short read pairs filtered out after trimming by size control 34930 ( 0.12%) empty read pairs filtered out after trimming by size control 30110864 (99.88%) read pairs available; of these: 2960365 ( 9.83%) trimmed read pairs available after processing 27150499 (90.17%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 18 0.00% 20 10 0.00% 21 17 0.00% 22 12 0.00% 23 15 0.00% 24 12 0.00% 25 17 0.00% 26 35 0.00% 27 34 0.00% 28 36 0.00% 29 30 0.00% 30 29 0.00% 31 32 0.00% 32 55 0.00% 33 42 0.00% 34 50 0.00% 35 47 0.00% 36 70 0.00% 37 68 0.00% 38 71 0.00% 39 84 0.00% 40 80 0.00% 41 83 0.00% 42 98 0.00% 43 97 0.00% 44 115 0.00% 45 108 0.00% 46 103 0.00% 47 138 0.00% 48 127 0.00% 49 171 0.00% 50 170 0.00% 51 203 0.00% 52 249 0.00% 53 241 0.00% 54 254 0.00% 55 274 0.00% 56 276 0.00% 57 318 0.00% 58 366 0.00% 59 396 0.00% 60 467 0.00% 61 553 0.00% 62 583 0.00% 63 632 0.00% 64 723 0.00% 65 762 0.00% 66 849 0.00% 67 843 0.00% 68 934 0.00% 69 1127 0.00% 70 1339 0.00% 71 1537 0.01% 72 1844 0.01% 73 2017 0.01% 74 2235 0.01% 75 2266 0.01% 76 2570 0.01% 77 2673 0.01% 78 2938 0.01% 79 3313 0.01% 80 3699 0.01% 81 4440 0.01% 82 5351 0.02% 83 5800 0.02% 84 6569 0.02% 85 6898 0.02% 86 7150 0.02% 87 7813 0.03% 88 8225 0.03% 89 8679 0.03% 90 9956 0.03% 91 10805 0.04% 92 12676 0.04% 93 13749 0.05% 94 15154 0.05% 95 15506 0.05% 96 16262 0.05% 97 16921 0.06% 98 17275 0.06% 99 18520 0.06% 100 19757 0.07% 101 21126 0.07% 102 22840 0.08% 103 24947 0.08% 104 26055 0.09% 105 27432 0.09% 106 28453 0.09% 107 28259 0.09% 108 29598 0.10% 109 30226 0.10% 110 31041 0.10% 111 32915 0.11% 112 35527 0.12% 113 37410 0.12% 114 40114 0.13% 115 41175 0.14% 116 42044 0.14% 117 42340 0.14% 118 42170 0.14% 119 42822 0.14% 120 44196 0.15% 121 45328 0.15% 122 48143 0.16% 123 51033 0.17% 124 53579 0.18% 125 55435 0.18% 126 56541 0.19% 127 56702 0.19% 128 56734 0.19% 129 57603 0.19% 130 56997 0.19% 131 58742 0.20% 132 61557 0.20% 133 63801 0.21% 134 65757 0.22% 135 69471 0.23% 136 70850 0.24% 137 70464 0.23% 138 71585 0.24% 139 71664 0.24% 140 71549 0.24% 141 72695 0.24% 142 74505 0.25% 143 76433 0.25% 144 80118 0.27% 145 83414 0.28% 146 83746 0.28% 147 84836 0.28% 148 85655 0.28% 149 84365 0.28% 150 84306 0.28% 151 27150499 90.17% 30110864 reads passed initial QC criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=3.68 fanout-score-rank=19 prefix-density=0.74 prefix-fanout=3.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=53.80 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=2.1 sequence=TATATATATTACTGTTCACCAAATGAATATACTCAATATCTTTATATATGAACAAAAACTTTTCATGCCCAGCAATTGCTTGGATGCAATGCGGTACTTAGGTACAAAGAGTGAAACATCAGAATAATTAAAGTGGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTTGGGTCGTAGTTCTCGGCATTCCGGTCAGTGCAACCTTCTGGGACGGGCAAATTACCTTGTTGTGCTCCTTTACCTCCTCCTATGCAGCTAGAGATGGTGTGTGTATGAAGAGTGTTCTAACCGTAGAAGGAACCAGTCTTCATGGCATCTGAGTTAGCATCTCCCAGAGCAGCCTCGCTCATGTACTTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCTTGGACGAGCATGTGGCCGTACTCCAGGAGCTTCTCGATTGTCATCTTTGGCTGCTCAAAGGACACCGGTCCATCCTTCGAGTTCACCAGCTTCTTGCCGATG criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=2.91 fanout-score-rank=23 prefix-density=0.52 prefix-fanout=2.5 sequence=CTTCGACAACACCATGGGAGGCTTCTACATCGCCCCAGCCTTCATGGACAAGCTCGTCGTCCACCTCTCCAAGAACTTCATGACCCTGCCCAACATCAAGGTGCCACTCATCTTGGGTATCTGGGGAGGCAAGGGTCAAGGAAAATCCTTCCAATGTGAGCTTGTCTTCGCCAAGATGGGCATCAACCCAATCATGATGAGTGCCGGAGAGCTGGAGAGCGGAAACGCCGGAGAGCCAGCCAAGCTGATCAGGCAGCGGTACCGTGAGGCCGCAGACTTGATCAAGAAGGGTAAGATGTGCTGCCTCTTCATCAACGATCTCGACGCTGGTGCGGGTCGGATGGGCGGGACCACCCAGTACACTGTCAACAACCAGATGGTTAACGCCACCCTGATGAACATCGCGGATGCCCCCACCAACGTGCAGCTCCCTGGGATGTACAACAAGGAGGAAAACCCCCGTGTGCCCATCATCGTCACTGGTAACGATTTCTCCACGCTCTACGCGCCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=36 fanout-score=108.55 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=8.5 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCACCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTTGGTTC SRR12666910 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 18:05:17 Started mapping on | Dec 07 18:05:17 Finished on | Dec 07 18:08:28 Mapping speed, Million of reads per hour | 567.53 Number of input reads | 30110864 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 28630906 Uniquely mapped reads % | 95.08% Average mapped length | 296.37 Number of splices: Total | 32011067 Number of splices: Annotated (sjdb) | 30200978 Number of splices: GT/AG | 31535192 Number of splices: GC/AG | 409177 Number of splices: AT/AC | 10207 Number of splices: Non-canonical | 56491 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 2.49 Insertion rate per base | 0.01% Insertion average length | 2.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 417577 % of reads mapped to multiple loci | 1.39% Number of reads mapped to too many loci | 43048 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.54% % of reads unmapped: other | 0.85% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1062381 1062381 1062381 N_multimapping 417577 417577 417577 N_noFeature 991550 27811656 1197049 N_ambiguous 730051 3995 118153 UnstrandedReadsAssigned:26909305 PositiveStrandReadsAssigned:815255 NegativeStrandReadsAssigned:27315704 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12666910 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12666910-trimmed-pair1.fastq SRR12666910-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,110,864 reads, 27,629,108 reads pseudoaligned [quant] estimated average fragment length: 280.388 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,156 rounds 52973 SRR12666910.ke.tsv 35125 SRR12666910.se.tsv 88098 total ==> SRR12666910.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 657.677 0 0 PNS24247 1044 764.612 64.171 4.19509 PNS24249 1928 1648.61 61.0746 1.85176 PNS24246 1044 764.612 64.171 4.19509 PNS24248 1044 764.612 64.171 4.19509 PNS24244 1471 1191.61 131.412 5.51245 PNS24243 293 93.5495 0 0 KQK14069 1603 1323.61 1997.71 75.4423 KQK14071 474 227.669 17.5358 3.85003 ==> SRR12666910.se.tsv <== BRADI_1g14170v3 2100 BRADI_1g53295v3 126 BRADI_1g59795v3 687 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 563 BRADI_1g74790v3 160 BRADI_1g09890v3 0 BRADI_1g77505v3 345 BRADI_1g48960v3 0 SRR12666910 completed mapping pipeline successfully