Starting /dee2/code/volunteer_pipeline.sh SRR12666911 current disk space = 1540756819968 free memory = 1600782612 SRR12666911 SRAfilesize aca109eab5d131985e0e3497d53b8cdf SRR12666911.sra SRR12666911.sra file validated SRR12666911 is paired end SRR12666911 is conventional basespace SRR12666911 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666911_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5945 37.0 37.0 37.0 37.0 37.0 2 36.4495 37.0 37.0 37.0 37.0 37.0 3 36.5295 37.0 37.0 37.0 37.0 37.0 4 36.6435 37.0 37.0 37.0 37.0 37.0 5 36.642 37.0 37.0 37.0 37.0 37.0 6 36.6545 37.0 37.0 37.0 37.0 37.0 7 36.6015 37.0 37.0 37.0 37.0 37.0 8 36.6025 37.0 37.0 37.0 37.0 37.0 9 36.6155 37.0 37.0 37.0 37.0 37.0 10-14 36.6562 37.0 37.0 37.0 37.0 37.0 15-19 36.612399999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.585899999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.5882 37.0 37.0 37.0 37.0 37.0 30-34 36.5093 37.0 37.0 37.0 37.0 37.0 35-39 36.4862 37.0 37.0 37.0 37.0 37.0 40-44 36.4704 37.0 37.0 37.0 37.0 37.0 45-49 36.4497 37.0 37.0 37.0 37.0 37.0 50-54 36.461999999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.4283 37.0 37.0 37.0 37.0 37.0 60-64 36.46079999999999 37.0 37.0 37.0 37.0 37.0 65-69 36.3952 37.0 37.0 37.0 37.0 37.0 70-74 36.3682 37.0 37.0 37.0 37.0 37.0 75-79 36.3664 37.0 37.0 37.0 37.0 37.0 80-84 36.2996 37.0 37.0 37.0 37.0 37.0 85-89 36.3165 37.0 37.0 37.0 37.0 37.0 90-94 36.2762 37.0 37.0 37.0 37.0 37.0 95-99 36.250800000000005 37.0 37.0 37.0 37.0 37.0 100-104 36.236399999999996 37.0 37.0 37.0 37.0 37.0 105-109 36.292199999999994 37.0 37.0 37.0 37.0 37.0 110-114 36.182 37.0 37.0 37.0 37.0 37.0 115-119 36.1318 37.0 37.0 37.0 37.0 37.0 120-124 36.1012 37.0 37.0 37.0 37.0 37.0 125-129 36.099900000000005 37.0 37.0 37.0 37.0 37.0 130-134 36.078700000000005 37.0 37.0 37.0 37.0 37.0 135-139 36.0519 37.0 37.0 37.0 37.0 37.0 140-144 35.879599999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.7882 37.0 37.0 37.0 37.0 37.0 150-151 35.415000000000006 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 2.0 22 0.0 23 3.0 24 3.0 25 1.0 26 2.0 27 5.0 28 10.0 29 14.0 30 18.0 31 30.0 32 43.0 33 83.0 34 109.0 35 287.0 36 2867.0 37 522.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 49.825 12.85 6.925000000000001 30.4 2 21.710855427713856 16.3831915957979 34.69234617308654 27.213606803401703 3 19.875 23.175 27.575 29.375 4 24.425 30.45 23.150000000000002 21.975 5 25.074999999999996 32.975 22.325 19.625 6 21.125 35.575 22.3 21.0 7 16.5 22.075 41.05 20.375 8 18.475 21.975 29.525000000000002 30.025000000000002 9 19.075 21.775 31.175000000000004 27.975 10-14 22.365 26.935 24.755 25.945 15-19 22.37 25.715 26.11 25.805 20-24 21.834999999999997 26.83 26.135 25.2 25-29 22.575 25.77 25.905 25.75 30-34 22.845 26.545 25.740000000000002 24.87 35-39 22.485 26.314999999999998 25.465 25.735000000000003 40-44 22.59 26.25 26.040000000000003 25.119999999999997 45-49 22.575 26.009999999999998 25.650000000000002 25.765 50-54 22.97 26.229999999999997 25.935000000000002 24.865000000000002 55-59 22.84 26.279999999999998 25.535000000000004 25.345000000000002 60-64 23.095 25.285000000000004 25.629999999999995 25.990000000000002 65-69 22.485 25.86 25.66 25.995 70-74 22.48 26.115 25.635 25.77 75-79 23.23 25.924999999999997 25.669999999999998 25.174999999999997 80-84 22.825 26.484999999999996 25.25 25.44 85-89 23.849999999999998 25.555 25.635 24.959999999999997 90-94 23.685000000000002 26.090000000000003 25.165 25.06 95-99 22.770000000000003 25.555 25.785000000000004 25.89 100-104 23.169999999999998 25.945 25.419999999999998 25.465 105-109 23.325000000000003 25.905 24.94 25.83 110-114 23.189999999999998 26.284999999999997 25.185000000000002 25.34 115-119 23.505000000000003 25.669999999999998 25.740000000000002 25.085 120-124 23.674999999999997 25.88 25.1 25.345000000000002 125-129 23.62 26.44 24.75 25.19 130-134 24.01 24.985 24.685000000000002 26.32 135-139 22.945 26.279999999999998 24.490000000000002 26.284999999999997 140-144 23.5 25.855 24.94 25.705 145-149 23.73 26.27 24.365000000000002 25.635 150-151 23.9375 25.025 24.712500000000002 26.325 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 1.0 15 1.0 16 1.0 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 1.0 25 1.5 26 1.5 27 2.0 28 4.5 29 7.0 30 7.0 31 11.5 32 19.5 33 22.0 34 23.5 35 33.0 36 49.5 37 79.5 38 103.5 39 112.0 40 121.5 41 144.0 42 175.5 43 185.0 44 186.5 45 189.5 46 197.5 47 216.0 48 201.5 49 185.0 50 186.5 51 181.5 52 162.0 53 127.0 54 129.0 55 131.0 56 99.0 57 77.0 58 66.0 59 59.0 60 61.5 61 64.0 62 63.5 63 49.5 64 38.5 65 44.0 66 40.5 67 34.0 68 25.5 69 18.5 70 15.5 71 14.0 72 9.5 73 4.5 74 3.5 75 2.5 76 2.0 77 2.5 78 2.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.57499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 91.53699153699154 83.825 2 7.780507780507781 14.249999999999998 3 0.627900627900628 1.725 4 0.054600054600054605 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0125 16-17 0.0 0.0 0.0 0.0 0.025 18-19 0.0 0.0 0.0 0.0 0.025 20-21 0.0 0.0 0.0 0.0 0.025 22-23 0.0 0.0 0.0 0.0 0.025 24-25 0.0 0.0 0.0 0.0 0.025 26-27 0.0 0.0 0.0 0.0 0.025 28-29 0.0 0.0 0.0 0.0 0.025 30-31 0.0 0.0 0.0 0.0 0.025 32-33 0.0 0.0 0.0 0.0 0.025 34-35 0.0 0.0 0.0 0.0 0.025 36-37 0.0 0.0 0.0 0.0 0.025 38-39 0.0 0.0 0.0 0.0 0.025 40-41 0.0 0.0 0.0 0.0 0.025 42-43 0.0 0.0 0.0 0.0 0.025 44-45 0.0 0.0 0.0 0.0 0.025 46-47 0.0 0.0 0.0 0.0 0.025 48-49 0.0 0.0 0.0 0.0 0.025 50-51 0.0 0.0 0.0 0.0 0.025 52-53 0.0 0.0 0.0 0.0 0.025 54-55 0.0 0.0 0.0 0.0 0.025 56-57 0.0 0.0 0.0 0.0 0.025 58-59 0.0 0.0 0.0 0.0 0.025 60-61 0.0 0.0 0.0 0.0 0.025 62-63 0.0 0.0 0.0 0.0 0.025 64-65 0.0 0.0 0.0 0.0 0.025 66-67 0.0 0.0 0.0 0.0 0.025 68-69 0.0 0.0 0.0 0.0 0.025 70-71 0.0 0.0 0.0 0.0 0.025 72-73 0.0 0.0 0.0 0.0 0.025 74-75 0.0 0.0 0.0 0.0 0.025 76-77 0.0 0.0 0.0 0.0 0.025 78-79 0.0 0.0 0.0 0.0 0.025 80-81 0.0 0.0 0.0 0.0 0.025 82-83 0.025 0.0 0.0 0.0 0.025 84-85 0.05 0.0 0.0 0.0 0.025 86-87 0.075 0.0 0.0 0.0 0.025 88-89 0.125 0.0 0.0 0.0 0.025 90-91 0.15 0.0 0.0 0.0 0.025 92-93 0.2125 0.0 0.0 0.0 0.025 94-95 0.3125 0.0 0.0 0.0 0.025 96-97 0.325 0.0 0.0 0.0 0.025 98-99 0.375 0.0 0.0 0.0 0.025 100-101 0.42500000000000004 0.0 0.0 0.0 0.025 102-103 0.6 0.0 0.0 0.0 0.025 104-105 0.75 0.0 0.0 0.0 0.025 106-107 0.975 0.0 0.0 0.0 0.025 108-109 1.125 0.0 0.0 0.0 0.025 110-111 1.325 0.0 0.0 0.0 0.025 112-113 1.5625 0.0 0.0 0.0 0.025 114-115 1.75 0.0 0.0 0.0 0.025 116-117 1.9375 0.0 0.0 0.0 0.025 118-119 2.2125 0.0 0.0 0.0 0.025 120-121 2.5250000000000004 0.0 0.0 0.0 0.025 122-123 2.875 0.0 0.0 0.0 0.025 124-125 3.2 0.0 0.0 0.0 0.025 126-127 3.6 0.0 0.0 0.0 0.025 128-129 4.0125 0.0 0.0 0.0 0.025 130-131 4.3875 0.0 0.0 0.0 0.025 132-133 4.6625 0.0 0.0 0.0 0.025 134-135 4.975 0.0 0.0 0.0 0.025 136-137 5.237500000000001 0.0 0.0 0.0 0.025 138-139 5.7375 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACATCCT 10 0.006830828 145.0 7 CGGGAAC 10 0.006830828 145.0 4 >>END_MODULE SRR12666911 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666911_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0795 37.0 37.0 37.0 37.0 37.0 2 35.9305 37.0 37.0 37.0 37.0 37.0 3 36.204 37.0 37.0 37.0 37.0 37.0 4 36.2785 37.0 37.0 37.0 37.0 37.0 5 36.2285 37.0 37.0 37.0 37.0 37.0 6 36.223 37.0 37.0 37.0 37.0 37.0 7 36.2735 37.0 37.0 37.0 37.0 37.0 8 36.3775 37.0 37.0 37.0 37.0 37.0 9 36.2035 37.0 37.0 37.0 37.0 37.0 10-14 36.296499999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.2097 37.0 37.0 37.0 37.0 37.0 20-24 36.165800000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.150600000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.125 37.0 37.0 37.0 37.0 37.0 35-39 36.0662 37.0 37.0 37.0 37.0 37.0 40-44 36.0209 37.0 37.0 37.0 37.0 37.0 45-49 36.056799999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.023199999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.0424 37.0 37.0 37.0 37.0 37.0 60-64 35.9225 37.0 37.0 37.0 37.0 37.0 65-69 35.9579 37.0 37.0 37.0 37.0 37.0 70-74 35.996300000000005 37.0 37.0 37.0 37.0 37.0 75-79 35.9101 37.0 37.0 37.0 37.0 37.0 80-84 35.968599999999995 37.0 37.0 37.0 37.0 37.0 85-89 35.8899 37.0 37.0 37.0 37.0 37.0 90-94 35.8735 37.0 37.0 37.0 37.0 37.0 95-99 35.9072 37.0 37.0 37.0 37.0 37.0 100-104 35.8794 37.0 37.0 37.0 37.0 37.0 105-109 35.82430000000001 37.0 37.0 37.0 37.0 37.0 110-114 35.718 37.0 37.0 37.0 37.0 37.0 115-119 35.738 37.0 37.0 37.0 37.0 37.0 120-124 35.8215 37.0 37.0 37.0 37.0 37.0 125-129 35.752500000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.6492 37.0 37.0 37.0 37.0 37.0 135-139 35.5869 37.0 37.0 37.0 37.0 37.0 140-144 35.557900000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.4331 37.0 37.0 37.0 37.0 37.0 150-151 34.999750000000006 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 7.0 15 5.0 16 7.0 17 3.0 18 3.0 19 1.0 20 9.0 21 5.0 22 9.0 23 5.0 24 9.0 25 4.0 26 7.0 27 7.0 28 7.0 29 21.0 30 16.0 31 33.0 32 49.0 33 83.0 34 160.0 35 424.0 36 2688.0 37 435.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 51.824999999999996 15.425 8.225 24.525 2 28.575 19.1 30.349999999999998 21.975 3 24.575 21.2 30.375000000000004 23.849999999999998 4 26.950000000000003 30.599999999999998 19.8 22.650000000000002 5 25.924999999999997 33.975 19.475 20.625 6 23.150000000000002 34.0 18.95 23.9 7 21.175 16.45 37.225 25.15 8 22.375 20.025000000000002 24.4 33.2 9 23.3 22.925 25.275 28.499999999999996 10-14 26.21 25.1 23.61 25.080000000000002 15-19 25.535000000000004 24.86 25.174999999999997 24.43 20-24 25.81 24.779999999999998 24.88 24.529999999999998 25-29 26.165 25.91 23.97 23.955000000000002 30-34 26.455000000000002 25.53 24.085 23.93 35-39 25.485000000000003 25.629999999999995 24.65 24.235 40-44 25.86 25.569999999999997 24.395 24.175 45-49 25.965 25.535000000000004 24.64 23.86 50-54 25.775 25.795 25.025 23.405 55-59 25.85 24.92 25.525 23.705000000000002 60-64 25.624999999999996 24.735 25.874999999999996 23.765 65-69 26.115 25.669999999999998 24.44 23.775 70-74 26.115 25.765 24.395 23.724999999999998 75-79 26.22 25.895000000000003 24.43 23.455000000000002 80-84 25.865 25.66 24.779999999999998 23.695 85-89 26.135 25.22 25.28 23.365 90-94 25.965 25.21 25.155 23.669999999999998 95-99 25.874999999999996 26.450000000000003 24.375 23.3 100-104 25.485000000000003 26.290000000000003 25.1 23.125 105-109 25.974999999999998 26.279999999999998 24.88 22.865 110-114 26.36 25.895000000000003 24.865000000000002 22.88 115-119 26.085 26.545 24.834999999999997 22.535 120-124 26.119999999999997 25.805 24.73 23.345 125-129 26.419999999999998 26.395000000000003 24.529999999999998 22.655 130-134 26.400000000000002 27.034999999999997 24.845 21.72 135-139 26.040000000000003 25.915 25.005 23.04 140-144 26.93 26.155 25.035 21.88 145-149 27.58 26.465 24.115000000000002 21.84 150-151 28.125 25.5125 23.974999999999998 22.3875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.5 10 1.5 11 0.5 12 0.5 13 1.5 14 2.0 15 0.5 16 0.5 17 1.0 18 1.5 19 1.5 20 0.5 21 0.0 22 0.0 23 1.5 24 2.0 25 1.5 26 2.0 27 3.5 28 5.0 29 5.0 30 5.0 31 6.0 32 8.5 33 17.0 34 24.5 35 29.5 36 40.5 37 51.0 38 77.5 39 104.0 40 110.0 41 118.5 42 140.0 43 174.0 44 187.0 45 180.0 46 195.0 47 191.0 48 185.5 49 186.0 50 161.5 51 156.0 52 144.0 53 127.0 54 124.5 55 121.0 56 103.5 57 83.0 58 76.0 59 74.5 60 91.5 61 87.5 62 75.0 63 72.0 64 61.5 65 51.0 66 52.5 67 58.0 68 52.0 69 41.0 70 30.5 71 26.5 72 16.0 73 7.0 74 5.5 75 6.0 76 5.5 77 3.5 78 0.5 79 1.5 80 1.5 81 0.5 82 1.5 83 1.0 84 0.0 85 0.0 86 0.0 87 1.0 88 1.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 2.0 96 2.0 97 0.5 98 2.0 99 2.5 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.5 #Duplication Level Percentage of deduplicated Percentage of total 1 91.77595628415301 83.975 2 7.4590163934426235 13.65 3 0.6284153005464481 1.725 4 0.1092896174863388 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0273224043715847 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 10 0.25 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.23750000000000002 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.44999999999999996 0.0 0.0 0.0 0.0 102-103 0.625 0.0 0.0 0.0 0.0 104-105 0.7749999999999999 0.0 0.0 0.0 0.0 106-107 1.0 0.0 0.0 0.0 0.0 108-109 1.15 0.0 0.0 0.0 0.0 110-111 1.35 0.0 0.0 0.0 0.0 112-113 1.5875 0.0 0.0 0.0 0.0 114-115 1.775 0.0 0.0 0.0 0.0 116-117 1.9625 0.0 0.0 0.0 0.0 118-119 2.25 0.0 0.0 0.0 0.0 120-121 2.575 0.0 0.0 0.0 0.0 122-123 2.9375 0.0 0.0 0.0 0.0 124-125 3.2750000000000004 0.0 0.0 0.0 0.0 126-127 3.6875 0.0 0.0 0.0 0.0 128-129 4.1 0.0 0.0 0.0 0.0 130-131 4.4875 0.0 0.0 0.0 0.0 132-133 4.762499999999999 0.0 0.0 0.0 0.0 134-135 5.0625 0.0 0.0 0.0 0.0 136-137 5.3125 0.0 0.0 0.0 0.0 138-139 5.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 35 0.0035366106 20.714287 140-144 >>END_MODULE Read 1319521 spots for SRR12666911.sra Written 1319521 spots for SRR12666911.sra Read 1319521 spots for SRR12666911.sra Written 1319521 spots for SRR12666911.sra Read 1319521 spots for SRR12666911.sra Written 1319521 spots for SRR12666911.sra Read 1319535 spots for SRR12666911.sra Written 1319535 spots for SRR12666911.sra Read 1319521 spots for SRR12666911.sra Written 1319521 spots for SRR12666911.sra Read 1319521 spots for SRR12666911.sra Written 1319521 spots for SRR12666911.sra Read 1319521 spots for SRR12666911.sra Written 1319521 spots for SRR12666911.sra Read 1319521 spots for SRR12666911.sra Written 1319521 spots for SRR12666911.sra Read 1319521 spots for SRR12666911.sra Written 1319521 spots for SRR12666911.sra Read 1319521 spots for SRR12666911.sra Written 1319521 spots for SRR12666911.sra Read 1319521 spots for SRR12666911.sra Written 1319521 spots for SRR12666911.sra Read 1319521 spots for SRR12666911.sra Written 1319521 spots for SRR12666911.sra Read 1319521 spots for SRR12666911.sra Written 1319521 spots for SRR12666911.sra Read 1319521 spots for SRR12666911.sra Written 1319521 spots for SRR12666911.sra Read 1319521 spots for SRR12666911.sra Written 1319521 spots for SRR12666911.sra Read 1319521 spots for SRR12666911.sra Written 1319521 spots for SRR12666911.sra Read 1319521 spots for SRR12666911.sra Written 1319521 spots for SRR12666911.sra Read 1319521 spots for SRR12666911.sra Written 1319521 spots for SRR12666911.sra Read 1319521 spots for SRR12666911.sra Written 1319521 spots for SRR12666911.sra Read 1319521 spots for SRR12666911.sra Written 1319521 spots for SRR12666911.sra SRR ids: ['SRR12666911.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dq59gt8_ SRR12666911.sra spots: 26390434 blocks: [[1, 1319521], [1319522, 2639042], [2639043, 3958563], [3958564, 5278084], [5278085, 6597605], [6597606, 7917126], [7917127, 9236647], [9236648, 10556168], [10556169, 11875689], [11875690, 13195210], [13195211, 14514731], [14514732, 15834252], [15834253, 17153773], [17153774, 18473294], [18473295, 19792815], [19792816, 21112336], [21112337, 22431857], [22431858, 23751378], [23751379, 25070899], [25070900, 26390434]] SRR12666911 file size 8946923 SRR12666911 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12666911 SRR12666911_1.fastq SRR12666911_2.fastq Input file: SRR12666911_1.fastq Paired file: SRR12666911_2.fastq trimmed: SRR12666911-trimmed-pair1.fastq, SRR12666911-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 18:04:10 2024 >> started Sat Dec 7 18:04:44 2024 >> done (33.838s) 26390434 read pairs processed; of these: 60 ( 0.00%) short read pairs filtered out after trimming by size control 10349 ( 0.04%) empty read pairs filtered out after trimming by size control 26380025 (99.96%) read pairs available; of these: 2457573 ( 9.32%) trimmed read pairs available after processing 23922452 (90.68%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 6 0.00% 20 10 0.00% 21 7 0.00% 22 14 0.00% 23 19 0.00% 24 18 0.00% 25 18 0.00% 26 21 0.00% 27 20 0.00% 28 18 0.00% 29 27 0.00% 30 22 0.00% 31 30 0.00% 32 34 0.00% 33 39 0.00% 34 33 0.00% 35 30 0.00% 36 33 0.00% 37 33 0.00% 38 59 0.00% 39 49 0.00% 40 50 0.00% 41 56 0.00% 42 43 0.00% 43 53 0.00% 44 61 0.00% 45 50 0.00% 46 65 0.00% 47 54 0.00% 48 84 0.00% 49 74 0.00% 50 99 0.00% 51 89 0.00% 52 97 0.00% 53 100 0.00% 54 97 0.00% 55 124 0.00% 56 131 0.00% 57 139 0.00% 58 142 0.00% 59 181 0.00% 60 184 0.00% 61 225 0.00% 62 219 0.00% 63 267 0.00% 64 302 0.00% 65 282 0.00% 66 386 0.00% 67 375 0.00% 68 455 0.00% 69 549 0.00% 70 603 0.00% 71 724 0.00% 72 874 0.00% 73 956 0.00% 74 1090 0.00% 75 1191 0.00% 76 1310 0.00% 77 1433 0.01% 78 1620 0.01% 79 1871 0.01% 80 2094 0.01% 81 2501 0.01% 82 2860 0.01% 83 3284 0.01% 84 3681 0.01% 85 3933 0.01% 86 4288 0.02% 87 4757 0.02% 88 5159 0.02% 89 5795 0.02% 90 6424 0.02% 91 7369 0.03% 92 8089 0.03% 93 8912 0.03% 94 9768 0.04% 95 10556 0.04% 96 10939 0.04% 97 11922 0.05% 98 12389 0.05% 99 13333 0.05% 100 14352 0.05% 101 15359 0.06% 102 17248 0.07% 103 18300 0.07% 104 19645 0.07% 105 20924 0.08% 106 21212 0.08% 107 21895 0.08% 108 23242 0.09% 109 24111 0.09% 110 24964 0.09% 111 27076 0.10% 112 28517 0.11% 113 29925 0.11% 114 31715 0.12% 115 32778 0.12% 116 33914 0.13% 117 34685 0.13% 118 34969 0.13% 119 36289 0.14% 120 37210 0.14% 121 38735 0.15% 122 40056 0.15% 123 42861 0.16% 124 44778 0.17% 125 46505 0.18% 126 47713 0.18% 127 47908 0.18% 128 48218 0.18% 129 49191 0.19% 130 49951 0.19% 131 50938 0.19% 132 53843 0.20% 133 55945 0.21% 134 57515 0.22% 135 59126 0.22% 136 60782 0.23% 137 61487 0.23% 138 62484 0.24% 139 62475 0.24% 140 62524 0.24% 141 64219 0.24% 142 66123 0.25% 143 66996 0.25% 144 70094 0.27% 145 72061 0.27% 146 73615 0.28% 147 74608 0.28% 148 74588 0.28% 149 73765 0.28% 150 74831 0.28% 151 23922452 90.68% 26380025 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=4.78 fanout-score-rank=27 prefix-density=0.20 prefix-fanout=3.9 sequence=GTGATGGTCTTGCC criterion=fanout-score sequence-density=0.06 sequence-density-rank=19 fanout-score=123.68 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=15.6 sequence=CCTTCTTGAGGTAGGAAGAGACTTCCTTAACAATTTCATCATAACGGGCCTTCGAGTACTTGGGAGTGGTGGCATCCATCTTGTTGCAGCAGCAGATCATCTGCTTCACTCCAAGAGTGAAAGCAAGGAGGGCATGCTCACGGGTCTGGCCATCCTTGGAGATACCAGCCTCAAAACCTCCAGTCGTGGAGTCAATGATAAGCACGGCACAGTCAGCCTGGGAGGTACCGGTAATCATGTTCTTGATGAAGTCACGGTGTCCAGGGGCATCAATGACGGTGCAGTAGTACTTGGTGGTCTCGAACTTCCACAAGGCAATATCGATGGTGATACCTCTCTCACGCTCAGCCTTCAGCTTGTCAAGCACCCACGCGTACTTGAATGACCTCTTGTTCATCTCAGCAGCCTCCTTCTCGAACCTCTCGATCACACGCTTGTCAATACCTCCAAGCTTGTAGATCAGGTGGCCAGTGGTGGT criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=33 prefix-density=0.47 prefix-fanout=2.2 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=606.54 fanout-score-rank=1 prefix-density=0.67 prefix-fanout=19.4 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGACACCGTGACTTCATCAAGAACATGATTACCGGTACCTCCCAGGCTGACTGTGCCGTGCTTATCATTGACTCCACGACTGGAGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCATGCCCTCCTTGCTTTCACTCTTGGAGTGAAGCAGATGATCTGCTGCTGCAACAAGATGGA SRR12666911 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 18:06:13 Started mapping on | Dec 07 18:06:14 Finished on | Dec 07 18:08:40 Mapping speed, Million of reads per hour | 650.47 Number of input reads | 26380025 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 23247685 Uniquely mapped reads % | 88.13% Average mapped length | 294.19 Number of splices: Total | 25863067 Number of splices: Annotated (sjdb) | 24338888 Number of splices: GT/AG | 25511576 Number of splices: GC/AG | 289641 Number of splices: AT/AC | 18508 Number of splices: Non-canonical | 43342 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 2.42 Insertion rate per base | 0.01% Insertion average length | 2.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 324622 % of reads mapped to multiple loci | 1.23% Number of reads mapped to too many loci | 52525 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.65% % of reads unmapped: other | 0.79% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2807718 2807718 2807718 N_multimapping 324622 324622 324622 N_noFeature 786987 22688989 968253 N_ambiguous 483499 4270 106595 UnstrandedReadsAssigned:21977199 PositiveStrandReadsAssigned:554426 NegativeStrandReadsAssigned:22172837 Dataset is classified negative stranded MeadianReadLen=147 20thPercentileLength=147 echo kmer=143 SRR12666911 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12666911-trimmed-pair1.fastq SRR12666911-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,380,025 reads, 24,103,202 reads pseudoaligned [quant] estimated average fragment length: 275.892 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,219 rounds 52973 SRR12666911.ke.tsv 35125 SRR12666911.se.tsv 88098 total ==> SRR12666911.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 662.207 0 0 PNS24247 1044 769.108 118.609 10.0461 PNS24249 1928 1653.11 95.3457 3.75722 PNS24246 1044 769.108 118.609 10.0461 PNS24248 1044 769.108 118.609 10.0461 PNS24244 1471 1196.11 252.826 13.7695 PNS24243 293 94.8962 0 0 KQK14069 1603 1328.11 3790.72 185.932 KQK14071 474 230.993 71.1432 20.0632 ==> SRR12666911.se.tsv <== BRADI_1g14170v3 3913 BRADI_1g53295v3 128 BRADI_1g59795v3 527 BRADI_1g07683v3 0 BRADI_1g00485v3 75 BRADI_1g20270v3 1815 BRADI_1g74790v3 84 BRADI_1g09890v3 0 BRADI_1g77505v3 179 BRADI_1g48960v3 0 SRR12666911 completed mapping pipeline successfully