Starting /dee2/code/volunteer_pipeline.sh SRR12667006 current disk space = 1516051394560 free memory = 1570828640 SRR12667006 SRAfilesize aad4682d1305d8e0b19eaa4172f24f81 SRR12667006.sra SRR12667006.sra file validated SRR12667006 is paired end SRR12667006 is conventional basespace SRR12667006 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12667006_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.454 37.0 37.0 37.0 37.0 37.0 2 36.3345 37.0 37.0 37.0 37.0 37.0 3 36.484 37.0 37.0 37.0 37.0 37.0 4 36.5385 37.0 37.0 37.0 37.0 37.0 5 36.5355 37.0 37.0 37.0 37.0 37.0 6 36.602 37.0 37.0 37.0 37.0 37.0 7 36.555 37.0 37.0 37.0 37.0 37.0 8 36.6035 37.0 37.0 37.0 37.0 37.0 9 36.5775 37.0 37.0 37.0 37.0 37.0 10-14 36.578399999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.5707 37.0 37.0 37.0 37.0 37.0 20-24 36.53090000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.48909999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.4546 37.0 37.0 37.0 37.0 37.0 35-39 36.440099999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.3464 37.0 37.0 37.0 37.0 37.0 45-49 36.3378 37.0 37.0 37.0 37.0 37.0 50-54 36.36579999999999 37.0 37.0 37.0 37.0 37.0 55-59 36.3636 37.0 37.0 37.0 37.0 37.0 60-64 36.3429 37.0 37.0 37.0 37.0 37.0 65-69 36.347300000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.288399999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.28490000000001 37.0 37.0 37.0 37.0 37.0 80-84 36.291799999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.176899999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.2291 37.0 37.0 37.0 37.0 37.0 95-99 36.119 37.0 37.0 37.0 37.0 37.0 100-104 36.1732 37.0 37.0 37.0 37.0 37.0 105-109 36.1262 37.0 37.0 37.0 37.0 37.0 110-114 36.0984 37.0 37.0 37.0 37.0 37.0 115-119 36.0451 37.0 37.0 37.0 37.0 37.0 120-124 36.076100000000004 37.0 37.0 37.0 37.0 37.0 125-129 36.0597 37.0 37.0 37.0 37.0 37.0 130-134 36.1113 37.0 37.0 37.0 37.0 37.0 135-139 36.058299999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.910799999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.7248 37.0 37.0 37.0 37.0 37.0 150-151 35.39275000000001 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 4.0 25 4.0 26 6.0 27 15.0 28 14.0 29 17.0 30 37.0 31 34.0 32 38.0 33 70.0 34 111.0 35 301.0 36 2868.0 37 481.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.15 11.5 9.975000000000001 37.375 2 21.42142142142142 17.067067067067068 35.310310310310314 26.2012012012012 3 22.275 23.65 24.275 29.799999999999997 4 27.900000000000002 29.7 20.025000000000002 22.375 5 25.35 34.1 21.45 19.1 6 20.724999999999998 32.7 24.55 22.025 7 17.175 20.875 41.025 20.925 8 21.075 21.775 27.125 30.025000000000002 9 19.8 20.075000000000003 32.15 27.975 10-14 23.25 26.22 24.765 25.765 15-19 23.48 24.72 26.105 25.695 20-24 23.03 26.115 25.47 25.385 25-29 22.945 26.205000000000002 25.564999999999998 25.285000000000004 30-34 23.45 25.805 25.445 25.3 35-39 23.29 25.290000000000003 25.785000000000004 25.635 40-44 23.055 25.264999999999997 25.374999999999996 26.305 45-49 23.525 25.430000000000003 24.995 26.05 50-54 23.255 25.740000000000002 25.419999999999998 25.585 55-59 23.799999999999997 25.745 24.89 25.564999999999998 60-64 23.775 25.215 25.555 25.455 65-69 23.59 24.895 25.759999999999998 25.755 70-74 23.695 25.345000000000002 24.66 26.3 75-79 23.22 25.575 25.314999999999998 25.89 80-84 23.799999999999997 24.48 25.564999999999998 26.155 85-89 24.115000000000002 24.834999999999997 25.745 25.305 90-94 23.705000000000002 25.75 24.925 25.619999999999997 95-99 24.044999999999998 25.424999999999997 24.64 25.89 100-104 24.404999999999998 25.16 25.155 25.28 105-109 23.565 25.685000000000002 24.834999999999997 25.915 110-114 23.785 25.275 24.88 26.06 115-119 24.16 25.4 24.745 25.695 120-124 23.915 25.965 24.25 25.869999999999997 125-129 24.240000000000002 25.564999999999998 25.019999999999996 25.174999999999997 130-134 24.52 25.025 24.565 25.89 135-139 24.84 25.1 24.345 25.715 140-144 23.94 25.979999999999997 24.165 25.915 145-149 23.9 25.900000000000002 24.14 26.06 150-151 24.337500000000002 24.425 24.825 26.4125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 2.0 27 3.5 28 6.0 29 8.0 30 10.0 31 13.5 32 15.5 33 19.0 34 25.5 35 35.0 36 52.0 37 68.5 38 87.0 39 117.5 40 136.0 41 145.5 42 173.0 43 185.0 44 172.5 45 188.5 46 197.5 47 189.0 48 177.0 49 160.5 50 146.5 51 133.5 52 128.5 53 137.0 54 129.5 55 102.0 56 90.5 57 86.5 58 81.5 59 76.5 60 78.5 61 81.5 62 73.5 63 54.5 64 58.5 65 67.0 66 50.5 67 42.0 68 44.0 69 35.5 70 25.5 71 22.0 72 19.0 73 14.0 74 12.5 75 9.5 76 4.5 77 2.5 78 1.5 79 0.5 80 1.0 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.64999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 90.9542195256481 82.45 2 8.052950910093767 14.6 3 0.7722007722007722 2.1 4 0.1654715940430226 0.6 5 0.05515719801434087 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAACTTTGTAATCTGATGTCGTGTACGAATAAGATCTTTTGCCATTACTT 5 0.125 No Hit GTGGGCTAGAGCACGGGGACACAGGAAGAGACATGTTTGTTCTCACAGGA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.23750000000000002 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.6625 0.0 0.0 0.0 0.0 106-107 0.8374999999999999 0.0 0.0 0.0 0.0 108-109 1.0375 0.0 0.0 0.0 0.0 110-111 1.2125 0.0 0.0 0.0 0.0 112-113 1.35 0.0 0.0 0.0 0.0 114-115 1.5875 0.0 0.0 0.0 0.0 116-117 1.9 0.0 0.0 0.0 0.0 118-119 2.2125000000000004 0.0 0.0 0.0 0.0 120-121 2.4875 0.0 0.0 0.0 0.0 122-123 2.7 0.0 0.0 0.0 0.0 124-125 3.1624999999999996 0.0 0.0 0.0 0.0 126-127 3.55 0.0 0.0 0.0 0.0 128-129 3.825 0.0 0.0 0.0 0.0 130-131 4.362500000000001 0.0 0.0 0.0 0.0 132-133 4.825 0.0 0.0 0.0 0.0 134-135 5.25 0.0 0.0 0.0 0.0 136-137 5.6875 0.0 0.0 0.0 0.0 138-139 5.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGATTT 10 0.006830828 145.0 1 >>END_MODULE SRR12667006 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12667006_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0535 37.0 37.0 37.0 37.0 37.0 2 35.9285 37.0 37.0 37.0 37.0 37.0 3 36.0935 37.0 37.0 37.0 37.0 37.0 4 36.281 37.0 37.0 37.0 37.0 37.0 5 36.1885 37.0 37.0 37.0 37.0 37.0 6 36.154 37.0 37.0 37.0 37.0 37.0 7 36.177 37.0 37.0 37.0 37.0 37.0 8 36.216 37.0 37.0 37.0 37.0 37.0 9 36.292 37.0 37.0 37.0 37.0 37.0 10-14 36.24739999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.1856 37.0 37.0 37.0 37.0 37.0 20-24 36.089 37.0 37.0 37.0 37.0 37.0 25-29 36.1513 37.0 37.0 37.0 37.0 37.0 30-34 36.06080000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.112100000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.1286 37.0 37.0 37.0 37.0 37.0 45-49 36.053999999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.0302 37.0 37.0 37.0 37.0 37.0 55-59 35.9757 37.0 37.0 37.0 37.0 37.0 60-64 35.959500000000006 37.0 37.0 37.0 37.0 37.0 65-69 35.9501 37.0 37.0 37.0 37.0 37.0 70-74 35.965500000000006 37.0 37.0 37.0 37.0 37.0 75-79 35.8837 37.0 37.0 37.0 37.0 37.0 80-84 35.8717 37.0 37.0 37.0 37.0 37.0 85-89 35.8782 37.0 37.0 37.0 37.0 37.0 90-94 35.903499999999994 37.0 37.0 37.0 37.0 37.0 95-99 35.8364 37.0 37.0 37.0 37.0 37.0 100-104 35.8473 37.0 37.0 37.0 37.0 37.0 105-109 35.7923 37.0 37.0 37.0 37.0 37.0 110-114 35.716899999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.7484 37.0 37.0 37.0 37.0 37.0 120-124 35.7603 37.0 37.0 37.0 37.0 37.0 125-129 35.7328 37.0 37.0 37.0 37.0 37.0 130-134 35.7031 37.0 37.0 37.0 37.0 37.0 135-139 35.616899999999994 37.0 37.0 37.0 37.0 37.0 140-144 35.4987 37.0 37.0 37.0 37.0 37.0 145-149 35.4388 37.0 37.0 37.0 37.0 37.0 150-151 35.04725 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 7.0 13 6.0 14 4.0 15 4.0 16 1.0 17 1.0 18 1.0 19 1.0 20 4.0 21 3.0 22 5.0 23 6.0 24 5.0 25 12.0 26 9.0 27 15.0 28 23.0 29 14.0 30 24.0 31 34.0 32 47.0 33 90.0 34 142.0 35 446.0 36 2650.0 37 446.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.55 14.649999999999999 11.600000000000001 32.2 2 28.499999999999996 20.5 29.125 21.875 3 25.7 24.025 26.224999999999998 24.05 4 27.975 30.95 18.575 22.5 5 28.575 32.45 18.875 20.1 6 22.925 34.55 19.8 22.725 7 21.8 16.775000000000002 35.875 25.55 8 23.1 20.825 23.375 32.7 9 24.425 20.775 25.900000000000002 28.9 10-14 26.119999999999997 24.625 23.43 25.825 15-19 26.66 24.46 24.05 24.83 20-24 26.08 25.324999999999996 23.805 24.79 25-29 26.305 25.335 23.665 24.695 30-34 26.275 25.205 23.71 24.81 35-39 25.85 25.374999999999996 23.810000000000002 24.965 40-44 25.785000000000004 24.57 24.5 25.145 45-49 26.200000000000003 25.040000000000003 23.875 24.884999999999998 50-54 25.72 25.095 24.27 24.915000000000003 55-59 25.865 25.145 23.74 25.25 60-64 25.96 25.319999999999997 24.044999999999998 24.675 65-69 26.41 24.990000000000002 24.104999999999997 24.495 70-74 25.6 24.84 24.5 25.06 75-79 25.424999999999997 24.87 24.685000000000002 25.019999999999996 80-84 25.88 24.815 24.349999999999998 24.955 85-89 26.279999999999998 24.825 24.185000000000002 24.709999999999997 90-94 26.724999999999998 25.230000000000004 24.305 23.74 95-99 25.69 25.14 24.39 24.779999999999998 100-104 26.46 25.005 24.355 24.18 105-109 26.56 24.709999999999997 24.005000000000003 24.725 110-114 25.86 26.345000000000002 23.849999999999998 23.945 115-119 26.424999999999997 25.245 23.94 24.39 120-124 26.435 25.27 24.085 24.21 125-129 26.340000000000003 25.64 24.275 23.745 130-134 27.025 25.195 24.745 23.035 135-139 27.034999999999997 25.624999999999996 24.355 22.985 140-144 26.69 25.885 23.825 23.599999999999998 145-149 27.24 25.264999999999997 24.7 22.795 150-151 27.712500000000002 25.2625 23.7625 23.2625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 0.5 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 1.5 17 1.5 18 1.0 19 1.5 20 2.5 21 1.5 22 0.5 23 0.5 24 1.0 25 1.0 26 0.0 27 1.5 28 3.5 29 5.5 30 9.0 31 14.0 32 11.0 33 13.0 34 23.0 35 28.0 36 41.5 37 52.0 38 53.0 39 71.0 40 102.5 41 129.5 42 137.0 43 138.0 44 164.0 45 183.5 46 162.5 47 168.5 48 183.5 49 166.5 50 154.0 51 155.0 52 149.0 53 129.5 54 116.5 55 103.0 56 97.0 57 93.0 58 92.5 59 102.5 60 99.0 61 89.5 62 92.0 63 97.0 64 89.0 65 74.0 66 68.5 67 59.0 68 48.5 69 46.5 70 40.5 71 32.0 72 23.5 73 17.0 74 14.0 75 12.0 76 8.0 77 3.5 78 3.0 79 1.5 80 0.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.5 90 0.5 91 0.5 92 0.5 93 1.0 94 1.0 95 0.5 96 0.5 97 0.0 98 1.0 99 2.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.625 #Duplication Level Percentage of deduplicated Percentage of total 1 91.00689655172414 82.475 2 7.9172413793103456 14.35 3 0.8551724137931035 2.325 4 0.16551724137931034 0.6 5 0.05517241379310345 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAAAAGTTTCTTGCAGATGTGCTTAAAACGTGATCCAGCAGCTCGTGCCT 5 0.125 No Hit ATCCAATTCAATCCAAGATGAGTTTCTTGTTCGGGAAGCGGAAGACGCCC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.23750000000000002 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.6625 0.0 0.0 0.0 0.0 106-107 0.8374999999999999 0.0 0.0 0.0 0.0 108-109 1.0125 0.0 0.0 0.0 0.0 110-111 1.1875 0.0 0.0 0.0 0.0 112-113 1.325 0.0 0.0 0.0 0.0 114-115 1.5625 0.0 0.0 0.0 0.0 116-117 1.8624999999999998 0.0 0.0 0.0 0.0 118-119 2.1624999999999996 0.0 0.0 0.0 0.0 120-121 2.4375 0.0 0.0 0.0 0.0 122-123 2.6500000000000004 0.0 0.0 0.0 0.0 124-125 3.1375 0.0 0.0 0.0 0.0 126-127 3.5250000000000004 0.0 0.0 0.0 0.0 128-129 3.8 0.0 0.0 0.0 0.0 130-131 4.375 0.0 0.0 0.0 0.0 132-133 4.875 0.0 0.0 0.0 0.0 134-135 5.3375 0.0 0.0 0.0 0.0 136-137 5.7875 0.0 0.0 0.0 0.0 138-139 6.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1939835 spots for SRR12667006.sra Written 1939835 spots for SRR12667006.sra Read 1939854 spots for SRR12667006.sra Written 1939854 spots for SRR12667006.sra Read 1939835 spots for SRR12667006.sra Written 1939835 spots for SRR12667006.sra Read 1939835 spots for SRR12667006.sra Written 1939835 spots for SRR12667006.sra Read 1939835 spots for SRR12667006.sra Written 1939835 spots for SRR12667006.sra Read 1939835 spots for SRR12667006.sra Written 1939835 spots for SRR12667006.sra Read 1939835 spots for SRR12667006.sra Written 1939835 spots for SRR12667006.sra Read 1939835 spots for SRR12667006.sra Written 1939835 spots for SRR12667006.sra Read 1939835 spots for SRR12667006.sra Written 1939835 spots for SRR12667006.sra Read 1939835 spots for SRR12667006.sra Written 1939835 spots for SRR12667006.sra Read 1939835 spots for SRR12667006.sra Written 1939835 spots for SRR12667006.sra Read 1939835 spots for SRR12667006.sra Written 1939835 spots for SRR12667006.sra Read 1939835 spots for SRR12667006.sra Written 1939835 spots for SRR12667006.sra Read 1939835 spots for SRR12667006.sra Written 1939835 spots for SRR12667006.sra Read 1939835 spots for SRR12667006.sra Written 1939835 spots for SRR12667006.sra Read 1939835 spots for SRR12667006.sra Written 1939835 spots for SRR12667006.sra Read 1939835 spots for SRR12667006.sra Written 1939835 spots for SRR12667006.sra Read 1939835 spots for SRR12667006.sra Written 1939835 spots for SRR12667006.sra Read 1939835 spots for SRR12667006.sra Written 1939835 spots for SRR12667006.sra Read 1939835 spots for SRR12667006.sra Written 1939835 spots for SRR12667006.sra SRR ids: ['SRR12667006.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_m8ilsrwh SRR12667006.sra spots: 38796719 blocks: [[1, 1939835], [1939836, 3879670], [3879671, 5819505], [5819506, 7759340], [7759341, 9699175], [9699176, 11639010], [11639011, 13578845], [13578846, 15518680], [15518681, 17458515], [17458516, 19398350], [19398351, 21338185], [21338186, 23278020], [23278021, 25217855], [25217856, 27157690], [27157691, 29097525], [29097526, 31037360], [31037361, 32977195], [32977196, 34917030], [34917031, 36856865], [36856866, 38796719]] SRR12667006 file size 13163122 SRR12667006 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12667006 SRR12667006_1.fastq SRR12667006_2.fastq Input file: SRR12667006_1.fastq Paired file: SRR12667006_2.fastq trimmed: SRR12667006-trimmed-pair1.fastq, SRR12667006-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Dec 12 02:15:00 2024 >> started Thu Dec 12 02:15:41 2024 >> done (41.668s) 38796719 read pairs processed; of these: 104 ( 0.00%) short read pairs filtered out after trimming by size control 9233 ( 0.02%) empty read pairs filtered out after trimming by size control 38787382 (99.98%) read pairs available; of these: 3055547 ( 7.88%) trimmed read pairs available after processing 35731835 (92.12%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 18 0.00% 20 12 0.00% 21 21 0.00% 22 26 0.00% 23 22 0.00% 24 30 0.00% 25 42 0.00% 26 29 0.00% 27 38 0.00% 28 39 0.00% 29 43 0.00% 30 29 0.00% 31 36 0.00% 32 47 0.00% 33 47 0.00% 34 43 0.00% 35 47 0.00% 36 45 0.00% 37 54 0.00% 38 82 0.00% 39 80 0.00% 40 56 0.00% 41 61 0.00% 42 75 0.00% 43 75 0.00% 44 85 0.00% 45 76 0.00% 46 99 0.00% 47 74 0.00% 48 94 0.00% 49 107 0.00% 50 129 0.00% 51 109 0.00% 52 134 0.00% 53 154 0.00% 54 149 0.00% 55 157 0.00% 56 207 0.00% 57 197 0.00% 58 230 0.00% 59 222 0.00% 60 286 0.00% 61 333 0.00% 62 361 0.00% 63 355 0.00% 64 374 0.00% 65 404 0.00% 66 448 0.00% 67 528 0.00% 68 569 0.00% 69 663 0.00% 70 759 0.00% 71 839 0.00% 72 913 0.00% 73 1084 0.00% 74 1188 0.00% 75 1310 0.00% 76 1443 0.00% 77 1575 0.00% 78 1669 0.00% 79 1872 0.00% 80 2271 0.01% 81 2507 0.01% 82 3078 0.01% 83 3444 0.01% 84 3830 0.01% 85 4127 0.01% 86 4384 0.01% 87 4810 0.01% 88 5175 0.01% 89 5915 0.02% 90 6507 0.02% 91 7379 0.02% 92 8565 0.02% 93 9511 0.02% 94 10521 0.03% 95 11101 0.03% 96 12125 0.03% 97 13093 0.03% 98 13585 0.04% 99 14690 0.04% 100 15708 0.04% 101 17252 0.04% 102 19155 0.05% 103 20995 0.05% 104 22280 0.06% 105 23790 0.06% 106 25215 0.07% 107 26188 0.07% 108 27407 0.07% 109 28732 0.07% 110 29736 0.08% 111 31613 0.08% 112 34267 0.09% 113 36157 0.09% 114 38522 0.10% 115 40700 0.10% 116 41923 0.11% 117 42829 0.11% 118 44250 0.11% 119 44830 0.12% 120 46489 0.12% 121 48584 0.13% 122 50864 0.13% 123 53649 0.14% 124 56314 0.15% 125 58152 0.15% 126 59578 0.15% 127 60741 0.16% 128 60251 0.16% 129 62341 0.16% 130 63748 0.16% 131 64538 0.17% 132 67598 0.17% 133 70175 0.18% 134 72494 0.19% 135 75347 0.19% 136 77589 0.20% 137 77508 0.20% 138 78783 0.20% 139 80069 0.21% 140 79645 0.21% 141 81856 0.21% 142 84282 0.22% 143 86366 0.22% 144 89290 0.23% 145 92869 0.24% 146 94366 0.24% 147 94968 0.24% 148 96511 0.25% 149 95070 0.25% 150 97041 0.25% 151 35731835 92.12% 38787382 reads passed initial QC criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=3.47 fanout-score-rank=15 prefix-density=0.78 prefix-fanout=3.1 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTGTGTGGCGTCGGT criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=19.43 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=6.7 sequence=TTGATGAAAATTGTATTATAATTATATAGTTGATGTCTTTTGGTCACAAGACGACCAAATTACGCATCACAAGTACAACCCCGCGTCAGAAAATGGTAGAAACTTCTATTGCTTATTACAAATTCACATCGAGCCATCCGGCATGCAGTACTGGAAAATAGCGAGTACATATACTCCATGGCATCGCATCCACATCAATGGATCGATCTGTAGGGTCATCTCCATATCTGTATGTATAAGTATACGTTGTATGTATAGGAGTTAACCGGATGAGAGGACTTAGAGCTCCCATGTGTCGAACTTGCCGGAGACGAAGTCGTAGTGGCCGCCCACGAGCTTGAGGGTTCCGTTGGCGACGCCTTCCTTGACGAACGGGTAGGTCTTGAGGTTCTCGAGGGACACGTTCACGGCCTCCTTTTCCAAGACGGCGCATTGGTCATCGAAAGGCATGGAGGCGCACTCGGTCTGCACCTTCTTCTTGGCCGGGAACCCGATCCTGACCCAGTCCTCG criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=3.89 fanout-score-rank=13 prefix-density=0.60 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAGCTCCCCTGGGTACTATGACGGCAGGTA criterion=fanout-score sequence-density=0.02 sequence-density-rank=36 fanout-score=59.11 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=5.5 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCCTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR12667006 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 12 02:16:46 Started mapping on | Dec 12 02:16:46 Finished on | Dec 12 02:20:44 Mapping speed, Million of reads per hour | 586.70 Number of input reads | 38787382 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 36881251 Uniquely mapped reads % | 95.09% Average mapped length | 297.49 Number of splices: Total | 42635279 Number of splices: Annotated (sjdb) | 40192987 Number of splices: GT/AG | 41985580 Number of splices: GC/AG | 540726 Number of splices: AT/AC | 17957 Number of splices: Non-canonical | 91016 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.02% Deletion average length | 2.54 Insertion rate per base | 0.02% Insertion average length | 2.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 524388 % of reads mapped to multiple loci | 1.35% Number of reads mapped to too many loci | 48036 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.72% % of reads unmapped: other | 0.72% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1381743 1381743 1381743 N_multimapping 524388 524388 524388 N_noFeature 1330253 35815119 1593526 N_ambiguous 972163 6114 170547 UnstrandedReadsAssigned:34578835 PositiveStrandReadsAssigned:1060018 NegativeStrandReadsAssigned:35117178 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12667006 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12667006-trimmed-pair1.fastq SRR12667006-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 38,787,382 reads, 35,527,413 reads pseudoaligned [quant] estimated average fragment length: 294.012 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,176 rounds 52973 SRR12667006.ke.tsv 35125 SRR12667006.se.tsv 88098 total ==> SRR12667006.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 643.909 0 0 PNS24247 1044 750.988 97.0331 5.17436 PNS24249 1928 1634.99 86.5446 2.1198 PNS24246 1044 750.988 97.0331 5.17436 PNS24248 1044 750.988 97.0331 5.17436 PNS24244 1471 1177.99 190.356 6.47136 PNS24243 293 89.3769 0 0 KQK14069 1603 1309.99 516.561 15.7915 KQK14071 474 218.697 4.54337 0.831967 ==> SRR12667006.se.tsv <== BRADI_1g14170v3 533 BRADI_1g53295v3 416 BRADI_1g59795v3 1410 BRADI_1g07683v3 0 BRADI_1g00485v3 14 BRADI_1g20270v3 719 BRADI_1g74790v3 321 BRADI_1g09890v3 0 BRADI_1g77505v3 245 BRADI_1g48960v3 0 SRR12667006 completed mapping pipeline successfully