Starting /dee2/code/volunteer_pipeline.sh SRR12667007 current disk space = 1540809531392 free memory = 1598903576 SRR12667007 SRAfilesize 5843ea70768ce400e7de13a1f157cfe2 SRR12667007.sra SRR12667007.sra file validated SRR12667007 is paired end SRR12667007 is conventional basespace SRR12667007 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12667007_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.407 37.0 37.0 37.0 37.0 37.0 2 36.38525 37.0 37.0 37.0 37.0 37.0 3 36.492 37.0 37.0 37.0 37.0 37.0 4 36.565 37.0 37.0 37.0 37.0 37.0 5 36.5425 37.0 37.0 37.0 37.0 37.0 6 36.5585 37.0 37.0 37.0 37.0 37.0 7 36.459 37.0 37.0 37.0 37.0 37.0 8 36.6245 37.0 37.0 37.0 37.0 37.0 9 36.521 37.0 37.0 37.0 37.0 37.0 10-14 36.5472 37.0 37.0 37.0 37.0 37.0 15-19 36.567899999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.4907 37.0 37.0 37.0 37.0 37.0 25-29 36.4804 37.0 37.0 37.0 37.0 37.0 30-34 36.46999999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.4128 37.0 37.0 37.0 37.0 37.0 40-44 36.3852 37.0 37.0 37.0 37.0 37.0 45-49 36.3316 37.0 37.0 37.0 37.0 37.0 50-54 36.3322 37.0 37.0 37.0 37.0 37.0 55-59 36.311899999999994 37.0 37.0 37.0 37.0 37.0 60-64 36.319900000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.2638 37.0 37.0 37.0 37.0 37.0 70-74 36.305899999999994 37.0 37.0 37.0 37.0 37.0 75-79 36.2826 37.0 37.0 37.0 37.0 37.0 80-84 36.1807 37.0 37.0 37.0 37.0 37.0 85-89 36.2236 37.0 37.0 37.0 37.0 37.0 90-94 36.2033 37.0 37.0 37.0 37.0 37.0 95-99 36.111799999999995 37.0 37.0 37.0 37.0 37.0 100-104 36.1423 37.0 37.0 37.0 37.0 37.0 105-109 36.1426 37.0 37.0 37.0 37.0 37.0 110-114 36.132999999999996 37.0 37.0 37.0 37.0 37.0 115-119 36.0783 37.0 37.0 37.0 37.0 37.0 120-124 36.0267 37.0 37.0 37.0 37.0 37.0 125-129 36.0159 37.0 37.0 37.0 37.0 37.0 130-134 36.0248 37.0 37.0 37.0 37.0 37.0 135-139 35.944900000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.809999999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.6622 37.0 37.0 37.0 37.0 37.0 150-151 35.50025 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 3.0 24 2.0 25 1.0 26 3.0 27 7.0 28 12.0 29 26.0 30 26.0 31 38.0 32 64.0 33 77.0 34 140.0 35 307.0 36 2800.0 37 493.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.6 12.35 8.175 35.875 2 24.005006257822277 15.66958698372966 35.61952440550689 24.705882352941178 3 21.4 22.625 25.4 30.575000000000003 4 26.275 28.9 21.05 23.775 5 26.3 32.25 22.05 19.400000000000002 6 22.125 33.050000000000004 22.725 22.1 7 17.375 20.775 40.475 21.375 8 21.0 20.974999999999998 27.875 30.15 9 20.175 19.325 31.95 28.549999999999997 10-14 23.74 25.85 24.104999999999997 26.305 15-19 23.18 24.36 25.55 26.91 20-24 23.53 25.31 24.77 26.39 25-29 23.76 25.259999999999998 25.27 25.71 30-34 23.305 25.005 25.465 26.224999999999998 35-39 23.419999999999998 25.47 24.755 26.355 40-44 24.154999999999998 25.095 24.95 25.8 45-49 24.41 25.074999999999996 24.615000000000002 25.900000000000002 50-54 24.275 24.81 24.565 26.35 55-59 24.25 24.635 24.93 26.185000000000002 60-64 24.295 24.51 24.715 26.479999999999997 65-69 24.47 24.08 24.985 26.465 70-74 24.46 24.884999999999998 24.315 26.340000000000003 75-79 24.325 24.7 24.64 26.334999999999997 80-84 23.7 24.404999999999998 24.82 27.075 85-89 24.755 23.875 24.625 26.745 90-94 24.5 24.695 24.395 26.41 95-99 24.465 24.205 25.11 26.22 100-104 24.805 24.385 24.67 26.14 105-109 25.055 24.349999999999998 24.515 26.08 110-114 24.9 24.285 24.245 26.57 115-119 25.105 25.069999999999997 23.990000000000002 25.835 120-124 24.38 24.565 24.485 26.57 125-129 25.369999999999997 24.965 23.65 26.015 130-134 25.89 24.415 23.93 25.765 135-139 25.56 24.5 23.435 26.505000000000003 140-144 25.369999999999997 24.435000000000002 23.835 26.36 145-149 24.77 24.884999999999998 23.955000000000002 26.39 150-151 25.224999999999998 24.099999999999998 22.975 27.700000000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.0 25 0.5 26 2.0 27 2.0 28 0.5 29 1.0 30 5.0 31 7.5 32 13.5 33 24.0 34 28.5 35 32.0 36 46.0 37 62.5 38 78.0 39 93.0 40 108.5 41 128.0 42 150.5 43 166.5 44 176.5 45 174.5 46 175.0 47 172.5 48 156.5 49 164.0 50 168.0 51 150.0 52 136.5 53 125.0 54 113.5 55 108.0 56 103.0 57 106.0 58 101.0 59 92.5 60 87.5 61 89.5 62 81.5 63 72.5 64 74.5 65 62.5 66 62.5 67 60.5 68 46.5 69 41.0 70 39.0 71 31.5 72 20.5 73 14.5 74 13.0 75 11.5 76 8.5 77 4.0 78 3.0 79 2.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.125 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.75 #Duplication Level Percentage of deduplicated Percentage of total 1 90.68870523415978 82.3 2 8.539944903581267 15.5 3 0.6611570247933884 1.7999999999999998 4 0.11019283746556473 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.23750000000000002 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.325 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.425 0.0 0.0 0.0 0.0 100-101 0.5625 0.0 0.0 0.0 0.0 102-103 0.725 0.0 0.0 0.0 0.0 104-105 0.9125000000000001 0.0 0.0 0.0 0.0 106-107 1.05 0.0 0.0 0.0 0.0 108-109 1.3 0.0 0.0 0.0 0.0 110-111 1.525 0.0 0.0 0.0 0.0 112-113 1.7999999999999998 0.0 0.0 0.0 0.0 114-115 2.0375 0.0 0.0 0.0 0.0 116-117 2.3375000000000004 0.0 0.0 0.0 0.0 118-119 2.7375 0.0 0.0 0.0 0.0 120-121 3.075 0.0 0.0 0.0 0.0 122-123 3.1625 0.0 0.0 0.0 0.0 124-125 3.55 0.0 0.0 0.0 0.0 126-127 3.95 0.0 0.0 0.0 0.0 128-129 4.4375 0.0 0.0 0.0 0.0 130-131 4.987500000000001 0.0 0.0 0.0 0.0 132-133 5.525 0.0 0.0 0.0 0.0 134-135 6.0 0.0 0.0 0.0 0.0 136-137 6.65 0.0 0.0 0.0 0.0 138-139 7.324999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTATCAT 10 0.006830828 145.0 6 >>END_MODULE SRR12667007 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12667007_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.116 37.0 37.0 37.0 37.0 37.0 2 35.975 37.0 37.0 37.0 37.0 37.0 3 36.18 37.0 37.0 37.0 37.0 37.0 4 36.3355 37.0 37.0 37.0 37.0 37.0 5 36.234 37.0 37.0 37.0 37.0 37.0 6 36.1695 37.0 37.0 37.0 37.0 37.0 7 36.2175 37.0 37.0 37.0 37.0 37.0 8 36.2865 37.0 37.0 37.0 37.0 37.0 9 36.2595 37.0 37.0 37.0 37.0 37.0 10-14 36.2185 37.0 37.0 37.0 37.0 37.0 15-19 36.192899999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.1917 37.0 37.0 37.0 37.0 37.0 25-29 36.150099999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.103300000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.0659 37.0 37.0 37.0 37.0 37.0 40-44 36.120599999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.032799999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.0122 37.0 37.0 37.0 37.0 37.0 55-59 36.0037 37.0 37.0 37.0 37.0 37.0 60-64 35.9762 37.0 37.0 37.0 37.0 37.0 65-69 35.979499999999994 37.0 37.0 37.0 37.0 37.0 70-74 35.8853 37.0 37.0 37.0 37.0 37.0 75-79 35.859500000000004 37.0 37.0 37.0 37.0 37.0 80-84 35.8779 37.0 37.0 37.0 37.0 37.0 85-89 35.8241 37.0 37.0 37.0 37.0 37.0 90-94 35.8555 37.0 37.0 37.0 37.0 37.0 95-99 35.8239 37.0 37.0 37.0 37.0 37.0 100-104 35.841899999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.79010000000001 37.0 37.0 37.0 37.0 37.0 110-114 35.771 37.0 37.0 37.0 37.0 37.0 115-119 35.718399999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.7309 37.0 37.0 37.0 37.0 37.0 125-129 35.72539999999999 37.0 37.0 37.0 37.0 37.0 130-134 35.726699999999994 37.0 37.0 37.0 37.0 37.0 135-139 35.5762 37.0 37.0 37.0 37.0 37.0 140-144 35.5018 37.0 37.0 37.0 37.0 37.0 145-149 35.4484 37.0 37.0 37.0 37.0 37.0 150-151 35.07875 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 6.0 14 3.0 15 4.0 16 4.0 17 2.0 18 5.0 19 4.0 20 5.0 21 7.0 22 9.0 23 7.0 24 2.0 25 3.0 26 7.0 27 13.0 28 18.0 29 20.0 30 25.0 31 36.0 32 43.0 33 82.0 34 190.0 35 415.0 36 2656.0 37 434.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.375 15.950000000000001 9.625 29.049999999999997 2 30.15 19.6 28.825 21.425 3 25.5 22.075 28.425 24.0 4 27.925 30.925000000000004 17.925 23.225 5 28.749999999999996 32.625 17.7 20.925 6 24.025 34.125 18.05 23.799999999999997 7 23.1 15.825 35.775 25.3 8 25.174999999999997 18.975 22.425 33.425 9 25.650000000000002 20.0 25.624999999999996 28.725 10-14 27.169999999999998 24.099999999999998 22.314999999999998 26.415 15-19 27.29 24.095 22.759999999999998 25.855 20-24 27.22 23.98 22.935 25.865 25-29 26.43 24.52 23.265 25.785000000000004 30-34 26.71 24.92 22.52 25.85 35-39 27.26 24.075 23.085 25.580000000000002 40-44 26.705000000000002 24.445 23.41 25.44 45-49 27.115000000000002 23.715 22.869999999999997 26.3 50-54 26.765 24.62 23.445 25.169999999999998 55-59 27.255000000000003 24.490000000000002 23.39 24.865000000000002 60-64 26.5 24.14 23.65 25.71 65-69 26.840000000000003 24.115000000000002 23.235 25.81 70-74 27.034999999999997 24.060000000000002 23.445 25.46 75-79 26.919999999999998 24.335 23.61 25.135 80-84 26.905 25.064999999999998 23.05 24.98 85-89 26.290000000000003 24.255 23.294999999999998 26.16 90-94 27.005000000000003 24.135 23.43 25.430000000000003 95-99 26.595000000000002 24.765 23.494999999999997 25.145 100-104 27.339999999999996 24.474999999999998 23.244999999999997 24.94 105-109 26.825 24.565 23.945 24.665 110-114 27.22 24.73 23.365 24.685000000000002 115-119 27.439999999999998 24.935 22.720000000000002 24.905 120-124 26.810000000000002 25.155 23.015 25.019999999999996 125-129 27.339999999999996 24.545 23.415 24.7 130-134 27.79 25.15 23.380000000000003 23.68 135-139 28.044999999999998 25.330000000000002 23.150000000000002 23.474999999999998 140-144 27.965 25.224999999999998 23.355 23.455000000000002 145-149 27.91 25.155 23.115 23.82 150-151 28.825 24.6875 22.900000000000002 23.5875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 2.0 22 2.0 23 0.5 24 1.5 25 1.5 26 1.0 27 0.5 28 2.5 29 5.0 30 6.0 31 5.0 32 7.5 33 11.0 34 13.0 35 22.0 36 29.5 37 34.0 38 51.5 39 74.5 40 88.0 41 116.0 42 135.5 43 133.0 44 141.0 45 152.0 46 162.0 47 164.0 48 154.5 49 151.5 50 138.5 51 126.0 52 123.0 53 117.5 54 117.5 55 105.5 56 98.5 57 104.0 58 103.5 59 116.5 60 111.0 61 107.0 62 119.0 63 120.5 64 112.0 65 93.5 66 82.0 67 79.0 68 71.5 69 59.5 70 55.0 71 45.5 72 34.5 73 24.0 74 13.5 75 11.5 76 10.0 77 5.5 78 3.0 79 0.5 80 2.0 81 1.5 82 0.5 83 0.5 84 0.5 85 0.5 86 0.5 87 1.0 88 1.0 89 1.0 90 0.5 91 0.0 92 1.5 93 2.0 94 1.0 95 1.0 96 1.5 97 1.0 98 0.0 99 0.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.64999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 90.78874793160507 82.3 2 8.24600110314396 14.95 3 0.827357970215113 2.25 4 0.13789299503585217 0.5 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.3625 0.0 0.0 0.0 0.0 96-97 0.425 0.0 0.0 0.0 0.0 98-99 0.45 0.0 0.0 0.0 0.0 100-101 0.5875 0.0 0.0 0.0 0.0 102-103 0.75 0.0 0.0 0.0 0.0 104-105 0.9375 0.0 0.0 0.0 0.0 106-107 1.0625 0.0 0.0 0.0 0.0 108-109 1.325 0.0 0.0 0.0 0.0 110-111 1.5625 0.0 0.0 0.0 0.0 112-113 1.85 0.0 0.0 0.0 0.0 114-115 2.0875 0.0 0.0 0.0 0.0 116-117 2.375 0.0 0.0 0.0 0.0 118-119 2.7875 0.0 0.0 0.0 0.0 120-121 3.125 0.0 0.0 0.0 0.0 122-123 3.2375 0.0 0.0 0.0 0.0 124-125 3.6500000000000004 0.0 0.0 0.0 0.0 126-127 4.05 0.0 0.0 0.0 0.0 128-129 4.5375 0.0 0.0 0.0 0.0 130-131 5.1 0.0 0.0 0.0 0.0 132-133 5.65 0.0 0.0 0.0 0.0 134-135 6.125 0.0 0.0 0.0 0.0 136-137 6.775 0.0 0.0 0.0 0.0 138-139 7.425000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1483888 spots for SRR12667007.sra Written 1483888 spots for SRR12667007.sra Read 1483888 spots for SRR12667007.sra Written 1483888 spots for SRR12667007.sra Read 1483888 spots for SRR12667007.sra Written 1483888 spots for SRR12667007.sra Read 1483888 spots for SRR12667007.sra Written 1483888 spots for SRR12667007.sra Read 1483888 spots for SRR12667007.sra Written 1483888 spots for SRR12667007.sra Read 1483906 spots for SRR12667007.sra Written 1483906 spots for SRR12667007.sra Read 1483888 spots for SRR12667007.sra Written 1483888 spots for SRR12667007.sra Read 1483888 spots for SRR12667007.sra Written 1483888 spots for SRR12667007.sra Read 1483888 spots for SRR12667007.sra Written 1483888 spots for SRR12667007.sra Read 1483888 spots for SRR12667007.sra Written 1483888 spots for SRR12667007.sra Read 1483888 spots for SRR12667007.sra Written 1483888 spots for SRR12667007.sra Read 1483888 spots for SRR12667007.sra Written 1483888 spots for SRR12667007.sra Read 1483888 spots for SRR12667007.sra Written 1483888 spots for SRR12667007.sra Read 1483888 spots for SRR12667007.sra Written 1483888 spots for SRR12667007.sra Read 1483888 spots for SRR12667007.sra Written 1483888 spots for SRR12667007.sra Read 1483888 spots for SRR12667007.sra Written 1483888 spots for SRR12667007.sra Read 1483888 spots for SRR12667007.sra Written 1483888 spots for SRR12667007.sra Read 1483888 spots for SRR12667007.sra Written 1483888 spots for SRR12667007.sra Read 1483888 spots for SRR12667007.sra Written 1483888 spots for SRR12667007.sra Read 1483888 spots for SRR12667007.sra Written 1483888 spots for SRR12667007.sra SRR ids: ['SRR12667007.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ms2j1wkh SRR12667007.sra spots: 29677778 blocks: [[1, 1483888], [1483889, 2967776], [2967777, 4451664], [4451665, 5935552], [5935553, 7419440], [7419441, 8903328], [8903329, 10387216], [10387217, 11871104], [11871105, 13354992], [13354993, 14838880], [14838881, 16322768], [16322769, 17806656], [17806657, 19290544], [19290545, 20774432], [20774433, 22258320], [22258321, 23742208], [23742209, 25226096], [25226097, 26709984], [26709985, 28193872], [28193873, 29677778]] SRR12667007 file size 10064106 SRR12667007 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12667007 SRR12667007_1.fastq SRR12667007_2.fastq Input file: SRR12667007_1.fastq Paired file: SRR12667007_2.fastq trimmed: SRR12667007-trimmed-pair1.fastq, SRR12667007-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 18:13:41 2024 >> started Sat Dec 7 18:14:14 2024 >> done (33.380s) 29677778 read pairs processed; of these: 63 ( 0.00%) short read pairs filtered out after trimming by size control 13536 ( 0.05%) empty read pairs filtered out after trimming by size control 29664179 (99.95%) read pairs available; of these: 3092954 (10.43%) trimmed read pairs available after processing 26571225 (89.57%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 8 0.00% 20 14 0.00% 21 14 0.00% 22 20 0.00% 23 22 0.00% 24 13 0.00% 25 18 0.00% 26 21 0.00% 27 33 0.00% 28 20 0.00% 29 20 0.00% 30 24 0.00% 31 24 0.00% 32 42 0.00% 33 42 0.00% 34 32 0.00% 35 35 0.00% 36 34 0.00% 37 47 0.00% 38 48 0.00% 39 37 0.00% 40 39 0.00% 41 42 0.00% 42 63 0.00% 43 53 0.00% 44 72 0.00% 45 53 0.00% 46 85 0.00% 47 49 0.00% 48 59 0.00% 49 82 0.00% 50 63 0.00% 51 80 0.00% 52 112 0.00% 53 97 0.00% 54 111 0.00% 55 94 0.00% 56 118 0.00% 57 149 0.00% 58 139 0.00% 59 192 0.00% 60 210 0.00% 61 227 0.00% 62 263 0.00% 63 268 0.00% 64 311 0.00% 65 333 0.00% 66 377 0.00% 67 430 0.00% 68 510 0.00% 69 569 0.00% 70 733 0.00% 71 833 0.00% 72 912 0.00% 73 1065 0.00% 74 1234 0.00% 75 1310 0.00% 76 1511 0.01% 77 1551 0.01% 78 1954 0.01% 79 2100 0.01% 80 2489 0.01% 81 2814 0.01% 82 3370 0.01% 83 3904 0.01% 84 4344 0.01% 85 4811 0.02% 86 5089 0.02% 87 5574 0.02% 88 6292 0.02% 89 6957 0.02% 90 7665 0.03% 91 8741 0.03% 92 9835 0.03% 93 10881 0.04% 94 12217 0.04% 95 13058 0.04% 96 13729 0.05% 97 14810 0.05% 98 15453 0.05% 99 16557 0.06% 100 17845 0.06% 101 19373 0.07% 102 21630 0.07% 103 23465 0.08% 104 25230 0.09% 105 26391 0.09% 106 27688 0.09% 107 28201 0.10% 108 29687 0.10% 109 30916 0.10% 110 32062 0.11% 111 33827 0.11% 112 36544 0.12% 113 38343 0.13% 114 41182 0.14% 115 42888 0.14% 116 43812 0.15% 117 44777 0.15% 118 45072 0.15% 119 46389 0.16% 120 47320 0.16% 121 49296 0.17% 122 51744 0.17% 123 55201 0.19% 124 57364 0.19% 125 59465 0.20% 126 60808 0.20% 127 60925 0.21% 128 61031 0.21% 129 62884 0.21% 130 63194 0.21% 131 64859 0.22% 132 67110 0.23% 133 70229 0.24% 134 71874 0.24% 135 74891 0.25% 136 76748 0.26% 137 77732 0.26% 138 78610 0.26% 139 78525 0.26% 140 78670 0.27% 141 79638 0.27% 142 81523 0.27% 143 83348 0.28% 144 87163 0.29% 145 91026 0.31% 146 91332 0.31% 147 92374 0.31% 148 92066 0.31% 149 91236 0.31% 150 91829 0.31% 151 26571225 89.57% 29664179 reads passed initial QC criterion=sequence-density sequence-density=0.76 sequence-density-rank=1 fanout-score=3.21 fanout-score-rank=17 prefix-density=0.84 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTGTGTGGCGTCGGT criterion=fanout-score sequence-density=0.15 sequence-density-rank=27 fanout-score=30.76 fanout-score-rank=1 prefix-density=0.58 prefix-fanout=8.1 sequence=GGCGGCGGCGGCCTCGCCGTCGCTGGTGTACTTCCCCAGCTGTGCCAGGGAGTTTGCCTTGGCGCGCAGCAGCAGTGCCTCCTGCGCCGCCGCCACGTTCTCCGGCCGTCCTCCCCACGTCTTCAGGCACGTGTTCTGCAGCGCCCTCGCGTATGAGAAGGACACGTGCCACGGGTTCGGCGACTGGTTCATCGCGTTCAGGTTCAGCGTTGCCTCCACCTCTGACTGCCCGCCCGACAGGAACATGATGCCGGGGACGGAAGGAGGGATCCTCCTCTGGAGGAGCTTGAGGG criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=37 prefix-density=0.40 prefix-fanout=2.1 sequence=GACGGCAGGTACTGGACAATGTGGAAGCTGCCCATGTTCGGGTGCACCGACGCCAC criterion=fanout-score sequence-density=0.02 sequence-density-rank=37 fanout-score=82.63 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=3.7 sequence=CGTCGTCGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGGCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGCGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCG SRR12667007 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 18:15:05 Started mapping on | Dec 07 18:15:10 Finished on | Dec 07 18:18:11 Mapping speed, Million of reads per hour | 590.01 Number of input reads | 29664179 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 28042521 Uniquely mapped reads % | 94.53% Average mapped length | 296.24 Number of splices: Total | 29596630 Number of splices: Annotated (sjdb) | 27974281 Number of splices: GT/AG | 29152873 Number of splices: GC/AG | 365593 Number of splices: AT/AC | 10909 Number of splices: Non-canonical | 67255 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.02% Deletion average length | 2.30 Insertion rate per base | 0.02% Insertion average length | 2.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 474013 % of reads mapped to multiple loci | 1.60% Number of reads mapped to too many loci | 47304 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.75% % of reads unmapped: other | 0.96% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1147645 1147645 1147645 N_multimapping 474013 474013 474013 N_noFeature 936709 27215804 1119533 N_ambiguous 768342 4103 125797 UnstrandedReadsAssigned:26337470 PositiveStrandReadsAssigned:822614 NegativeStrandReadsAssigned:26797191 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12667007 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12667007-trimmed-pair1.fastq SRR12667007-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,664,179 reads, 27,072,437 reads pseudoaligned [quant] estimated average fragment length: 274.905 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,161 rounds 52973 SRR12667007.ke.tsv 35125 SRR12667007.se.tsv 88098 total ==> SRR12667007.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 662.627 0 0 PNS24247 1044 770.095 76.096 4.88546 PNS24249 1928 1654.1 49.1906 1.47031 PNS24246 1044 770.095 76.096 4.88546 PNS24248 1044 770.095 76.096 4.88546 PNS24244 1471 1197.1 155.521 6.42317 PNS24243 293 95.2979 0 0 KQK14069 1603 1329.1 282.388 10.5046 KQK14071 474 230.165 31.4147 6.7481 ==> SRR12667007.se.tsv <== BRADI_1g14170v3 457 BRADI_1g53295v3 283 BRADI_1g59795v3 996 BRADI_1g07683v3 0 BRADI_1g00485v3 17 BRADI_1g20270v3 426 BRADI_1g74790v3 346 BRADI_1g09890v3 0 BRADI_1g77505v3 183 BRADI_1g48960v3 0 SRR12667007 completed mapping pipeline successfully