Starting /dee2/code/volunteer_pipeline.sh SRR12667010 current disk space = 1540839268352 free memory = 1489752888 SRR12667010 SRAfilesize 66d92e14a699ad66d45f52fe8096cc76 SRR12667010.sra SRR12667010.sra file validated SRR12667010 is paired end SRR12667010 is conventional basespace SRR12667010 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12667010_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.458 37.0 37.0 37.0 37.0 37.0 2 36.266 37.0 37.0 37.0 37.0 37.0 3 36.396 37.0 37.0 37.0 37.0 37.0 4 36.5045 37.0 37.0 37.0 37.0 37.0 5 36.5755 37.0 37.0 37.0 37.0 37.0 6 36.512 37.0 37.0 37.0 37.0 37.0 7 36.4155 37.0 37.0 37.0 37.0 37.0 8 36.5435 37.0 37.0 37.0 37.0 37.0 9 36.556 37.0 37.0 37.0 37.0 37.0 10-14 36.5227 37.0 37.0 37.0 37.0 37.0 15-19 36.5404 37.0 37.0 37.0 37.0 37.0 20-24 36.4819 37.0 37.0 37.0 37.0 37.0 25-29 36.470299999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.4108 37.0 37.0 37.0 37.0 37.0 35-39 36.3885 37.0 37.0 37.0 37.0 37.0 40-44 36.345 37.0 37.0 37.0 37.0 37.0 45-49 36.3646 37.0 37.0 37.0 37.0 37.0 50-54 36.3207 37.0 37.0 37.0 37.0 37.0 55-59 36.2984 37.0 37.0 37.0 37.0 37.0 60-64 36.3304 37.0 37.0 37.0 37.0 37.0 65-69 36.2706 37.0 37.0 37.0 37.0 37.0 70-74 36.26369999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.2047 37.0 37.0 37.0 37.0 37.0 80-84 36.204 37.0 37.0 37.0 37.0 37.0 85-89 36.259299999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.17 37.0 37.0 37.0 37.0 37.0 95-99 36.055 37.0 37.0 37.0 37.0 37.0 100-104 36.0846 37.0 37.0 37.0 37.0 37.0 105-109 36.1446 37.0 37.0 37.0 37.0 37.0 110-114 36.0307 37.0 37.0 37.0 37.0 37.0 115-119 35.9958 37.0 37.0 37.0 37.0 37.0 120-124 35.9028 37.0 37.0 37.0 37.0 37.0 125-129 35.893699999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.9328 37.0 37.0 37.0 37.0 37.0 135-139 35.9324 37.0 37.0 37.0 37.0 37.0 140-144 35.672000000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.7476 37.0 37.0 37.0 37.0 37.0 150-151 35.49625 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 1.0 23 1.0 24 3.0 25 2.0 26 8.0 27 9.0 28 12.0 29 24.0 30 28.0 31 43.0 32 41.0 33 80.0 34 160.0 35 332.0 36 2786.0 37 469.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.6 11.5 9.025 41.875 2 23.1981981981982 16.19119119119119 38.06306306306306 22.54754754754755 3 19.400000000000002 22.825 25.4 32.375 4 26.325 29.175 20.65 23.849999999999998 5 25.95 33.650000000000006 21.025 19.375 6 22.3 33.925 22.1 21.675 7 16.875 21.15 41.3 20.674999999999997 8 20.7 22.0 27.900000000000002 29.4 9 19.875 20.825 31.225 28.075 10-14 23.185 26.009999999999998 25.28 25.525 15-19 23.06 25.295 25.745 25.900000000000002 20-24 22.32 25.81 26.19 25.679999999999996 25-29 23.32 24.945 26.064999999999998 25.669999999999998 30-34 22.75 25.074999999999996 26.334999999999997 25.840000000000003 35-39 23.155 25.564999999999998 25.715 25.564999999999998 40-44 22.96 25.415 25.805 25.82 45-49 23.165 25.264999999999997 25.97 25.6 50-54 23.044999999999998 24.725 26.195 26.035000000000004 55-59 23.825 25.27 25.955000000000002 24.95 60-64 23.345 24.865000000000002 26.095000000000002 25.695 65-69 23.005 25.330000000000002 25.874999999999996 25.790000000000003 70-74 23.62 25.019999999999996 25.435000000000002 25.924999999999997 75-79 23.345 25.545 25.169999999999998 25.94 80-84 23.64 25.155 25.569999999999997 25.635 85-89 23.66 25.22 25.669999999999998 25.45 90-94 24.005000000000003 25.835 24.895 25.264999999999997 95-99 23.605 25.415 25.174999999999997 25.805 100-104 24.23 24.465 25.555 25.75 105-109 24.135 25.180000000000003 25.06 25.624999999999996 110-114 23.595 25.235000000000003 25.790000000000003 25.380000000000003 115-119 23.54 25.695 25.330000000000002 25.435000000000002 120-124 24.104999999999997 24.805 24.875 26.215 125-129 24.04 25.555 24.89 25.515 130-134 24.14 25.790000000000003 24.605 25.465 135-139 23.835 25.679999999999996 24.545 25.94 140-144 24.215 25.41 24.529999999999998 25.845000000000002 145-149 24.565 24.945 24.63 25.86 150-151 23.9 24.5625 24.325 27.212500000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 1.5 27 5.5 28 8.5 29 7.5 30 10.0 31 16.0 32 14.0 33 15.5 34 23.0 35 38.0 36 60.5 37 66.5 38 71.5 39 96.0 40 122.5 41 143.5 42 164.5 43 177.5 44 188.5 45 194.5 46 194.5 47 186.5 48 169.5 49 181.0 50 177.5 51 156.5 52 139.5 53 129.0 54 130.0 55 113.5 56 103.5 57 107.5 58 107.0 59 95.0 60 76.0 61 66.5 62 69.0 63 62.5 64 53.5 65 42.5 66 41.5 67 43.0 68 35.5 69 28.5 70 18.0 71 14.0 72 12.5 73 8.0 74 6.0 75 4.5 76 1.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.025 #Duplication Level Percentage of deduplicated Percentage of total 1 89.97500694251596 81.0 2 9.025270758122744 16.25 3 0.9441821716189948 2.55 4 0.05554012774229381 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.44999999999999996 0.0 0.0 0.0 0.0 100-101 0.525 0.0 0.0 0.0 0.0 102-103 0.625 0.0 0.0 0.0 0.0 104-105 0.6875 0.0 0.0 0.0 0.0 106-107 0.7625 0.0 0.0 0.0 0.0 108-109 0.8625 0.0 0.0 0.0 0.0 110-111 1.025 0.0 0.0 0.0 0.0 112-113 1.1875 0.0 0.0 0.0 0.0 114-115 1.35 0.0 0.0 0.0 0.0 116-117 1.5125000000000002 0.0 0.0 0.0 0.0 118-119 1.85 0.0 0.0 0.0 0.0 120-121 2.0375 0.0 0.0 0.0 0.0 122-123 2.2249999999999996 0.0 0.0 0.0 0.0 124-125 2.5625 0.0 0.0 0.0 0.0 126-127 3.0 0.0 0.0 0.0 0.0 128-129 3.2750000000000004 0.0 0.0 0.0 0.0 130-131 3.7125 0.0 0.0 0.0 0.0 132-133 4.237500000000001 0.0 0.0 0.0 0.0 134-135 4.6875 0.0 0.0 0.0 0.0 136-137 5.3375 0.0 0.0 0.0 0.0 138-139 5.824999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12667010 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12667010_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0695 37.0 37.0 37.0 37.0 37.0 2 35.979 37.0 37.0 37.0 37.0 37.0 3 36.2045 37.0 37.0 37.0 37.0 37.0 4 36.2805 37.0 37.0 37.0 37.0 37.0 5 36.359 37.0 37.0 37.0 37.0 37.0 6 36.2335 37.0 37.0 37.0 37.0 37.0 7 36.285 37.0 37.0 37.0 37.0 37.0 8 36.367 37.0 37.0 37.0 37.0 37.0 9 36.3305 37.0 37.0 37.0 37.0 37.0 10-14 36.3115 37.0 37.0 37.0 37.0 37.0 15-19 36.27759999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.244 37.0 37.0 37.0 37.0 37.0 25-29 36.2359 37.0 37.0 37.0 37.0 37.0 30-34 36.2202 37.0 37.0 37.0 37.0 37.0 35-39 36.17190000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.1591 37.0 37.0 37.0 37.0 37.0 45-49 36.1405 37.0 37.0 37.0 37.0 37.0 50-54 36.02589999999999 37.0 37.0 37.0 37.0 37.0 55-59 36.1291 37.0 37.0 37.0 37.0 37.0 60-64 36.0616 37.0 37.0 37.0 37.0 37.0 65-69 36.057100000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.0115 37.0 37.0 37.0 37.0 37.0 75-79 36.0474 37.0 37.0 37.0 37.0 37.0 80-84 35.980000000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.9345 37.0 37.0 37.0 37.0 37.0 90-94 35.983900000000006 37.0 37.0 37.0 37.0 37.0 95-99 35.87769999999999 37.0 37.0 37.0 37.0 37.0 100-104 35.9216 37.0 37.0 37.0 37.0 37.0 105-109 35.898700000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.8641 37.0 37.0 37.0 37.0 37.0 115-119 35.788799999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.8715 37.0 37.0 37.0 37.0 37.0 125-129 35.8442 37.0 37.0 37.0 37.0 37.0 130-134 35.8195 37.0 37.0 37.0 37.0 37.0 135-139 35.61129999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.53830000000001 37.0 37.0 37.0 37.0 37.0 145-149 35.4494 37.0 37.0 37.0 37.0 37.0 150-151 35.1495 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 2.0 14 1.0 15 2.0 16 2.0 17 4.0 18 1.0 19 2.0 20 2.0 21 5.0 22 6.0 23 5.0 24 9.0 25 6.0 26 9.0 27 11.0 28 12.0 29 23.0 30 26.0 31 33.0 32 47.0 33 88.0 34 172.0 35 422.0 36 2637.0 37 472.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.8 14.224999999999998 10.65 33.324999999999996 2 28.15 21.25 30.425 20.175 3 24.925 22.650000000000002 27.175 25.25 4 26.825 30.025000000000002 18.8 24.349999999999998 5 28.025 33.775 18.85 19.35 6 21.875 34.35 20.7 23.075000000000003 7 21.625 15.625 37.325 25.424999999999997 8 23.325000000000003 21.125 24.349999999999998 31.2 9 24.05 21.2 27.800000000000004 26.950000000000003 10-14 26.51 25.264999999999997 22.62 25.605 15-19 25.465 25.41 24.5 24.625 20-24 25.840000000000003 26.040000000000003 23.68 24.44 25-29 26.555 25.445 23.615 24.385 30-34 25.415 25.5 23.98 25.105 35-39 25.485000000000003 25.040000000000003 24.015 25.46 40-44 26.495 25.165 23.595 24.745 45-49 26.13 25.205 24.18 24.485 50-54 25.669999999999998 25.45 24.240000000000002 24.64 55-59 26.534999999999997 25.25 23.79 24.425 60-64 25.605 25.014999999999997 24.72 24.66 65-69 25.36 25.46 24.66 24.52 70-74 26.495 25.314999999999998 24.38 23.810000000000002 75-79 25.874999999999996 25.025 24.795 24.305 80-84 25.895000000000003 25.39 24.39 24.325 85-89 26.355 25.590000000000003 23.635 24.42 90-94 26.19 25.564999999999998 24.52 23.724999999999998 95-99 25.94 25.41 24.88 23.77 100-104 26.355 24.95 24.5 24.195 105-109 26.21 25.2 24.43 24.16 110-114 26.240000000000002 25.580000000000002 25.365 22.814999999999998 115-119 26.619999999999997 25.89 24.075 23.415 120-124 26.179999999999996 25.385 24.83 23.605 125-129 26.105 25.895000000000003 23.845 24.154999999999998 130-134 26.8 25.75 24.165 23.285 135-139 26.68 25.77 24.69 22.86 140-144 27.16 25.305 24.77 22.765 145-149 27.42 25.135 24.529999999999998 22.915 150-151 27.287499999999998 26.4625 23.849999999999998 22.400000000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 0.5 20 0.5 21 0.5 22 1.0 23 0.5 24 0.5 25 1.5 26 2.0 27 3.0 28 4.0 29 4.0 30 6.0 31 8.5 32 11.5 33 17.5 34 27.0 35 31.5 36 33.0 37 44.5 38 64.0 39 99.0 40 112.5 41 117.5 42 140.0 43 156.5 44 158.0 45 161.0 46 174.0 47 188.0 48 188.5 49 176.5 50 163.0 51 154.0 52 132.5 53 121.0 54 134.5 55 113.5 56 91.0 57 94.5 58 107.0 59 112.0 60 113.0 61 101.0 62 88.5 63 74.5 64 64.0 65 69.5 66 64.5 67 53.0 68 50.5 69 45.0 70 28.5 71 22.5 72 15.0 73 8.0 74 7.5 75 8.0 76 6.0 77 2.0 78 1.0 79 0.5 80 1.0 81 1.0 82 1.0 83 1.5 84 1.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.5 91 1.0 92 1.0 93 0.5 94 0.0 95 0.0 96 1.0 97 1.5 98 0.5 99 1.0 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.125 #Duplication Level Percentage of deduplicated Percentage of total 1 90.37447988904299 81.45 2 8.571428571428571 15.45 3 0.8876560332871012 2.4 4 0.11095700416088765 0.4 5 0.0 0.0 6 0.055478502080443824 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit CTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGA 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.44999999999999996 0.0 0.0 0.0 0.0 100-101 0.525 0.0 0.0 0.0 0.0 102-103 0.625 0.0 0.0 0.0 0.0 104-105 0.6875 0.0 0.0 0.0 0.0 106-107 0.7625 0.0 0.0 0.0 0.0 108-109 0.875 0.0 0.0 0.0 0.0 110-111 1.0499999999999998 0.0 0.0 0.0 0.0 112-113 1.2125 0.0 0.0 0.0 0.0 114-115 1.375 0.0 0.0 0.0 0.0 116-117 1.5375 0.0 0.0 0.0 0.0 118-119 1.875 0.0 0.0 0.0 0.0 120-121 2.0625 0.0 0.0 0.0 0.0 122-123 2.25 0.0 0.0 0.0 0.0 124-125 2.5875000000000004 0.0 0.0 0.0 0.0 126-127 3.025 0.0 0.0 0.0 0.0 128-129 3.3125 0.0 0.0 0.0 0.0 130-131 3.7625 0.0 0.0 0.0 0.0 132-133 4.262499999999999 0.0 0.0 0.0 0.0 134-135 4.7 0.0 0.0 0.0 0.0 136-137 5.3625 0.0 0.0 0.0 0.0 138-139 5.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATGGCG 10 0.006830828 145.0 5 AAACTCT 10 0.006830828 145.0 4 AACTGAG 10 0.006830828 145.0 5 AACTCTG 10 0.006830828 145.0 5 GCTTGCC 10 0.006830828 145.0 5 >>END_MODULE Read 1459003 spots for SRR12667010.sra Written 1459003 spots for SRR12667010.sra Read 1459003 spots for SRR12667010.sra Written 1459003 spots for SRR12667010.sra Read 1459003 spots for SRR12667010.sra Written 1459003 spots for SRR12667010.sra Read 1459003 spots for SRR12667010.sra Written 1459003 spots for SRR12667010.sra Read 1459003 spots for SRR12667010.sra Written 1459003 spots for SRR12667010.sra Read 1459003 spots for SRR12667010.sra Written 1459003 spots for SRR12667010.sra Read 1459003 spots for SRR12667010.sra Written 1459003 spots for SRR12667010.sra Read 1459003 spots for SRR12667010.sra Written 1459003 spots for SRR12667010.sra Read 1459003 spots for SRR12667010.sra Written 1459003 spots for SRR12667010.sra Read 1459003 spots for SRR12667010.sra Written 1459003 spots for SRR12667010.sra Read 1459003 spots for SRR12667010.sra Written 1459003 spots for SRR12667010.sra Read 1459003 spots for SRR12667010.sra Written 1459003 spots for SRR12667010.sra Read 1459003 spots for SRR12667010.sra Written 1459003 spots for SRR12667010.sra Read 1459003 spots for SRR12667010.sra Written 1459003 spots for SRR12667010.sra Read 1459003 spots for SRR12667010.sra Written 1459003 spots for SRR12667010.sra Read 1459003 spots for SRR12667010.sra Written 1459003 spots for SRR12667010.sra Read 1459003 spots for SRR12667010.sra Written 1459003 spots for SRR12667010.sra Read 1459013 spots for SRR12667010.sra Written 1459013 spots for SRR12667010.sra Read 1459003 spots for SRR12667010.sra Written 1459003 spots for SRR12667010.sra Read 1459003 spots for SRR12667010.sra Written 1459003 spots for SRR12667010.sra SRR ids: ['SRR12667010.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ewfl6ao5 SRR12667010.sra spots: 29180070 blocks: [[1, 1459003], [1459004, 2918006], [2918007, 4377009], [4377010, 5836012], [5836013, 7295015], [7295016, 8754018], [8754019, 10213021], [10213022, 11672024], [11672025, 13131027], [13131028, 14590030], [14590031, 16049033], [16049034, 17508036], [17508037, 18967039], [18967040, 20426042], [20426043, 21885045], [21885046, 23344048], [23344049, 24803051], [24803052, 26262054], [26262055, 27721057], [27721058, 29180070]] SRR12667010 file size 9894964 SRR12667010 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12667010 SRR12667010_1.fastq SRR12667010_2.fastq Input file: SRR12667010_1.fastq Paired file: SRR12667010_2.fastq trimmed: SRR12667010-trimmed-pair1.fastq, SRR12667010-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 18:18:58 2024 >> started Sat Dec 7 18:22:45 2024 >> done (226.440s) 29180070 read pairs processed; of these: 51 ( 0.00%) short read pairs filtered out after trimming by size control 7657 ( 0.03%) empty read pairs filtered out after trimming by size control 29172362 (99.97%) read pairs available; of these: 2414829 ( 8.28%) trimmed read pairs available after processing 26757533 (91.72%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 18 0.00% 20 5 0.00% 21 10 0.00% 22 15 0.00% 23 17 0.00% 24 16 0.00% 25 12 0.00% 26 16 0.00% 27 24 0.00% 28 18 0.00% 29 21 0.00% 30 15 0.00% 31 27 0.00% 32 25 0.00% 33 28 0.00% 34 27 0.00% 35 42 0.00% 36 34 0.00% 37 36 0.00% 38 36 0.00% 39 62 0.00% 40 45 0.00% 41 54 0.00% 42 41 0.00% 43 61 0.00% 44 55 0.00% 45 64 0.00% 46 77 0.00% 47 58 0.00% 48 68 0.00% 49 60 0.00% 50 117 0.00% 51 88 0.00% 52 101 0.00% 53 109 0.00% 54 95 0.00% 55 120 0.00% 56 132 0.00% 57 130 0.00% 58 176 0.00% 59 213 0.00% 60 216 0.00% 61 226 0.00% 62 250 0.00% 63 289 0.00% 64 296 0.00% 65 355 0.00% 66 386 0.00% 67 406 0.00% 68 438 0.00% 69 535 0.00% 70 666 0.00% 71 739 0.00% 72 806 0.00% 73 909 0.00% 74 1090 0.00% 75 1170 0.00% 76 1303 0.00% 77 1358 0.00% 78 1686 0.01% 79 1837 0.01% 80 2156 0.01% 81 2411 0.01% 82 2776 0.01% 83 3124 0.01% 84 3451 0.01% 85 3810 0.01% 86 4147 0.01% 87 4513 0.02% 88 5198 0.02% 89 5803 0.02% 90 6175 0.02% 91 7065 0.02% 92 7751 0.03% 93 8512 0.03% 94 9269 0.03% 95 9940 0.03% 96 10606 0.04% 97 11499 0.04% 98 12340 0.04% 99 13095 0.04% 100 14239 0.05% 101 15117 0.05% 102 16552 0.06% 103 17789 0.06% 104 18287 0.06% 105 19799 0.07% 106 21156 0.07% 107 21851 0.07% 108 22551 0.08% 109 24037 0.08% 110 24791 0.08% 111 25674 0.09% 112 27549 0.09% 113 29187 0.10% 114 30361 0.10% 115 32289 0.11% 116 32817 0.11% 117 34278 0.12% 118 34860 0.12% 119 35729 0.12% 120 36977 0.13% 121 38673 0.13% 122 39987 0.14% 123 41616 0.14% 124 43573 0.15% 125 44984 0.15% 126 46436 0.16% 127 46906 0.16% 128 47465 0.16% 129 48936 0.17% 130 49407 0.17% 131 51299 0.18% 132 52576 0.18% 133 54379 0.19% 134 55109 0.19% 135 57566 0.20% 136 59675 0.20% 137 59752 0.20% 138 60215 0.21% 139 62456 0.21% 140 62878 0.22% 141 63708 0.22% 142 66644 0.23% 143 66702 0.23% 144 69033 0.24% 145 70373 0.24% 146 71471 0.24% 147 72507 0.25% 148 74052 0.25% 149 74157 0.25% 150 75427 0.26% 151 26757533 91.72% 29172362 reads passed initial QC criterion=sequence-density sequence-density=0.79 sequence-density-rank=1 fanout-score=3.25 fanout-score-rank=14 prefix-density=0.84 prefix-fanout=3.0 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTGTGTGGCGTCGGT criterion=fanout-score sequence-density=0.05 sequence-density-rank=27 fanout-score=15.21 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=2.0 sequence=TCACCTTGAGCAGCGCCGCCTGGTCGGGGTCGCTGGCGAGGCCGAGCGGGTCGAATGGGCCACCGGGGTGGAGCTTGTCCTCAAGATCAAGGCCGTTGATGATCCTGTAGTACTCGGCGCCTCCGACGAGGACAACCTCGGCGACGACGGCGAGGATGAGGTTGATGGGGATGCTGTTGCCGAAGTAGTTGAGGGTGTTGCCATCCAGGAGAAGAGCGCCGGTCTTGAACCAGACGGCCTCGGGACCGCAGTTGGCGCCGAACTTGTTGCACGCCTCGGGGATGATGAAGCCGGCAGCGCCGAGCATGGCCCATCTGGCATGGATCAGCTCATAGGCCTGGTACTTGGTGAAGTCATCTGGCTTCTTGCTCAGACCGAAAGGATCATAGCCATAGTCTCCAGGAACCTCTCCGTTGAGGTAC criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=3.78 fanout-score-rank=19 prefix-density=0.65 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAGCTCCCCTGGGTACTATGACGGCAGGTACTGGACAATGTGGAAGCTGCCCATGTTCGGGTGCACCGACGCCAC criterion=fanout-score sequence-density=0.02 sequence-density-rank=36 fanout-score=50.75 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=7.7 sequence=AGGAAAGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCGCTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTCGACAAGGGTCTTGTGCCACTCGTT SRR12667010 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 18:29:05 Started mapping on | Dec 07 18:29:06 Finished on | Dec 07 18:57:48 Mapping speed, Million of reads per hour | 60.99 Number of input reads | 29172362 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 27699256 Uniquely mapped reads % | 94.95% Average mapped length | 297.30 Number of splices: Total | 31427232 Number of splices: Annotated (sjdb) | 29643916 Number of splices: GT/AG | 30958206 Number of splices: GC/AG | 390418 Number of splices: AT/AC | 11719 Number of splices: Non-canonical | 66889 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.02% Deletion average length | 2.52 Insertion rate per base | 0.02% Insertion average length | 2.27 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 485924 % of reads mapped to multiple loci | 1.67% Number of reads mapped to too many loci | 46226 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.33% % of reads unmapped: other | 0.90% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 987182 987182 987182 N_multimapping 485924 485924 485924 N_noFeature 1154472 26914400 1367227 N_ambiguous 697923 4660 127595 UnstrandedReadsAssigned:25846861 PositiveStrandReadsAssigned:780196 NegativeStrandReadsAssigned:26204434 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12667010 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12667010-trimmed-pair1.fastq SRR12667010-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,172,362 reads, 26,473,287 reads pseudoaligned [quant] estimated average fragment length: 292.542 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,145 rounds 52973 SRR12667010.ke.tsv 35125 SRR12667010.se.tsv 88098 total ==> SRR12667010.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 645.356 0 0 PNS24247 1044 752.458 81.5747 5.93816 PNS24249 1928 1636.46 43.4253 1.4535 PNS24246 1044 752.458 81.5747 5.93816 PNS24248 1044 752.458 81.5747 5.93816 PNS24244 1471 1179.46 191.851 8.90962 PNS24243 293 90.5605 0 0 KQK14069 1603 1311.46 334.105 13.9543 KQK14071 474 220.042 3.83994 0.955866 ==> SRR12667010.se.tsv <== BRADI_1g14170v3 358 BRADI_1g53295v3 290 BRADI_1g59795v3 1151 BRADI_1g07683v3 0 BRADI_1g00485v3 8 BRADI_1g20270v3 495 BRADI_1g74790v3 227 BRADI_1g09890v3 0 BRADI_1g77505v3 172 BRADI_1g48960v3 1 SRR12667010 completed mapping pipeline successfully