Starting /dee2/code/volunteer_pipeline.sh SRR12682225 current disk space = 1547636596736 free memory = 1600388580 SRR12682225 SRAfilesize f95e86776b1ac04ebb4c690fe4016759 SRR12682225.sra SRR12682225.sra file validated SRR12682225 is single end SRR12682225 is conventional basespace SRR12682225 read1 length is 53-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12682225_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 53-150 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.461 32.0 32.0 32.0 32.0 32.0 2 31.487 32.0 32.0 32.0 32.0 32.0 3 31.62575 32.0 32.0 32.0 32.0 32.0 4 31.59075 32.0 32.0 32.0 32.0 32.0 5 31.66425 32.0 32.0 32.0 32.0 32.0 6 34.86 36.0 36.0 36.0 36.0 36.0 7 35.22 36.0 36.0 36.0 36.0 36.0 8 35.175 36.0 36.0 36.0 36.0 36.0 9 35.0775 36.0 36.0 36.0 36.0 36.0 10-14 35.146550000000005 36.0 36.0 36.0 36.0 36.0 15-19 35.1092 36.0 36.0 36.0 36.0 36.0 20-24 34.97395 36.0 36.0 36.0 36.0 36.0 25-29 34.863749999999996 36.0 36.0 36.0 34.4 36.0 30-34 34.8786 36.0 36.0 36.0 35.2 36.0 35-39 34.83955 36.0 36.0 36.0 33.6 36.0 40-44 34.796949999999995 36.0 36.0 36.0 35.2 36.0 45-49 34.609049999999996 36.0 36.0 36.0 32.0 36.0 50-54 34.6145804076019 36.0 36.0 36.0 32.0 36.0 55-59 34.49654743546714 36.0 36.0 36.0 32.0 36.0 60-64 34.276968395178656 36.0 36.0 36.0 32.0 36.0 65-69 34.22017521902377 36.0 36.0 36.0 32.0 36.0 70-74 34.32357425065473 36.0 36.0 36.0 32.0 36.0 75-79 34.144551240516385 36.0 36.0 36.0 32.0 36.0 80-84 34.13492264357423 36.0 36.0 36.0 31.0 36.0 85-89 33.990997331451375 36.0 36.0 36.0 31.0 36.0 90-94 33.988548237438984 36.0 36.0 36.0 31.0 36.0 95-99 34.004199257293365 36.0 36.0 36.0 32.0 36.0 100-104 33.85749144364054 36.0 36.0 36.0 27.0 36.0 105-109 33.54394680802643 36.0 34.4 36.0 27.0 36.0 110-114 33.43197642822205 36.0 32.8 36.0 27.0 36.0 115-119 33.07569450421172 36.0 32.0 36.0 27.0 36.0 120-124 32.33979817443205 34.4 32.0 36.0 25.8 36.0 125-129 32.25431832843283 34.4 32.0 36.0 24.6 36.0 130-134 31.87965095285323 33.6 32.0 36.0 25.8 36.0 135-139 31.890538866854047 33.6 32.0 36.0 27.0 36.0 140-144 32.00267113827759 35.2 32.0 36.0 23.4 36.0 145-149 31.768286411626367 32.0 32.0 36.0 21.0 36.0 150 26.20974212034384 27.0 14.0 32.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 1.0 20 2.0 21 5.0 22 6.0 23 6.0 24 15.0 25 19.0 26 38.0 27 74.0 28 68.0 29 109.0 30 124.0 31 167.0 32 241.0 33 337.0 34 925.0 35 1862.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.450000000000003 10.725 7.725 54.1 2 21.3 14.274999999999999 34.849999999999994 29.575000000000003 3 20.825 16.7 21.65 40.825 4 27.400000000000002 23.425 19.475 29.7 5 26.55 28.875 22.225 22.35 6 22.283841693975294 32.94681119233678 23.645071842702293 21.12427527098563 7 18.0 22.95 38.175 20.875 8 20.05 19.950000000000003 32.074999999999996 27.925 9 20.349999999999998 20.4 33.825 25.424999999999997 10-14 22.785 25.290000000000003 25.83 26.095000000000002 15-19 23.02 24.235 26.77 25.974999999999998 20-24 23.615 24.795 25.235000000000003 26.355 25-29 23.445 24.975 24.68 26.900000000000002 30-34 23.064999999999998 24.36 24.795 27.779999999999998 35-39 23.474999999999998 24.83 25.11 26.584999999999997 40-44 23.645 24.025 25.380000000000003 26.950000000000003 45-49 23.165 24.505 25.55 26.779999999999998 50-54 23.35116755837792 24.401220061003052 24.981249062453124 27.266363318165908 55-59 23.52411446868121 24.454672803682207 24.62477486491895 27.396437862717633 60-64 23.39190068578866 24.348000200230267 25.324122741152326 26.93597637282875 65-69 23.32415519399249 24.831038798498124 24.851063829787236 26.99374217772215 70-74 24.079731557069163 24.019632393449193 25.256673511293638 26.64396253818801 75-79 23.922965043382316 24.279051105872913 24.223882842670143 27.574101008074624 80-84 24.001406823091997 23.745164045621266 24.951012410189417 27.302416721097323 85-89 23.645444455655333 24.02381192614267 25.012612249016247 27.318131369185757 90-94 24.311158471609073 23.773278530471405 25.052011975440198 26.86355102247932 95-99 23.492989458601983 24.36291065397605 25.457987923446936 26.68611196397503 100-104 23.890961857379768 24.196724709784412 24.984452736318406 26.927860696517413 105-109 23.36994004987002 24.261234017719772 25.136612021857925 27.232213910552282 110-114 24.500818330605565 25.330060010911076 23.737043098745225 26.432078559738137 115-119 24.329815452339297 24.47655059540606 24.589423782380496 26.604210169874147 120-124 24.518749632071586 23.7770059457232 24.54818390533938 27.15606051686584 125-129 23.713303034025305 24.327478196781723 23.952831347500307 28.00638742169267 130-134 24.703455389375968 23.39479112944817 24.954873646209386 26.946879834966474 135-139 24.5611647843244 24.397877262212546 24.60879031160702 26.432167641856037 140-144 24.506697393057756 24.463488405588365 23.736137116520236 27.293677084833647 145-149 25.404644616467277 22.448979591836736 23.879896786300726 28.26647900539526 150 26.246418338108885 0.0 35.587392550143264 38.16618911174785 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 3.0 1 1.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.5 25 0.5 26 1.5 27 2.0 28 2.5 29 3.5 30 4.5 31 10.0 32 12.0 33 10.0 34 17.0 35 28.0 36 43.0 37 66.0 38 68.0 39 67.0 40 85.0 41 106.5 42 118.5 43 130.5 44 144.5 45 158.0 46 171.0 47 176.5 48 188.5 49 203.0 50 205.0 51 177.5 52 165.5 53 160.0 54 152.0 55 159.0 56 153.5 57 131.5 58 117.5 59 103.0 60 88.5 61 75.0 62 58.5 63 58.0 64 50.0 65 44.5 66 48.5 67 43.5 68 30.0 69 25.5 70 28.5 71 30.0 72 23.5 73 15.0 74 10.0 75 9.5 76 11.5 77 7.5 78 3.5 79 2.0 80 0.5 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.8250000000000001 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 52-53 1.0 54-55 1.0 56-57 1.0 58-59 1.0 60-61 1.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 2.0 72-73 1.0 74-75 3.0 76-77 2.0 78-79 1.0 80-81 4.0 82-83 8.0 84-85 8.0 86-87 5.0 88-89 8.0 90-91 10.0 92-93 13.0 94-95 10.0 96-97 22.0 98-99 13.0 100-101 25.0 102-103 28.0 104-105 39.0 106-107 45.0 108-109 37.0 110-111 41.0 112-113 48.0 114-115 48.0 116-117 58.0 118-119 54.0 120-121 62.0 122-123 65.0 124-125 53.0 126-127 50.0 128-129 64.0 130-131 66.0 132-133 67.0 134-135 62.0 136-137 68.0 138-139 59.0 140-141 64.0 142-143 76.0 144-145 63.0 146-147 119.0 148-149 779.0 150-151 1745.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.525 #Duplication Level Percentage of deduplicated Percentage of total 1 93.43758726612677 83.65 2 4.272549567160011 7.6499999999999995 3 0.8656799776598716 2.325 4 0.6702038536721586 2.4 5 0.4188774085450991 1.875 6 0.13962580284836637 0.75 7 0.08377548170901983 0.525 8 0.08377548170901983 0.6 9 0.027925160569673275 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCAACTTTCGTTCTTGATTAATGAAAACATCCTTGGCAAATGCTTTCGC 9 0.22499999999999998 No Hit CTCGTTGAAGACCAACAATTGCAATGATCTATCCCCATCACGATGAAATT 8 0.2 No Hit CAACAACTTAAATATACGCTATTGGAGCTGGAATTACCGCGGCTGCTGGC 8 0.2 No Hit CGTTAACGGAATTAACCAGACAAATCGCTCCACCAACTAAGAACGGCCAT 8 0.2 No Hit CTTGTTACGACTTCTCCTTCCTCTAAATGATAAGGTTCAATGGACTTCTC 7 0.17500000000000002 No Hit CTCAGAGCCAATCCTTTTCCCGAAGTTACGGATCCGTTTTGCCGACTTCC 7 0.17500000000000002 No Hit CCCCGACTGTCCCTATTAATCATTACTCCGATCCCGAAGGCCAACACAAT 7 0.17500000000000002 No Hit CCCGTGTCAGGATTGGGTAATTTGCGCGCCTGCTGCCTTCCTTGGATGTG 6 0.15 No Hit CTCTGACTATGAAATACGAATGCCCCCGACTGTCCCTATTAATCATTACT 6 0.15 No Hit CCCGACTGTCCCTATTAATCATTACTCCGATCCCGAAGGCCAACACAATA 6 0.15 No Hit CCGACATCGAAGGATCAAAAAGCAACGTCGCTATGAACGCTTGGCTGCCA 6 0.15 No Hit ATCACGATGAAATTTCCCAAGATTACCCGGGCCTGTCGGCCAAGGCTATA 6 0.15 No Hit GGCGTTCAGTCATAATCCGGCACACGGTAGCTTCGCGCCACTGGCTTTTC 5 0.125 No Hit CCCGGAACCCAAAGACTTTGATTTCTCATAAGGTGCCGGCGGAGTCCTAT 5 0.125 No Hit GCACGTACCATCAAACAAACTATAACTGATTTAATGAGCCATTCGCAGTT 5 0.125 No Hit CCTCTAAGAAGCTAGCTGCGGAGGGATGGCTCCGCATAGCTAGTTAGCAG 5 0.125 No Hit GCTGGAATTACCGCGGCTGCTGGCACCAGACTTGCCCTCCAATGGATCCT 5 0.125 No Hit CCTGTGGTAACTTTTCTGACACCTCTAGCTTCAAACTCCGAAGATCTAAA 5 0.125 No Hit CTTTTATCTAATAAATGCGCCCCTCCCAGAAGTCGGGGTTTGTTGCACGT 5 0.125 No Hit CCCCAACTTTCGTTCTTGATTAATGAAAACATCCTTGGCAAATGCTTTCG 5 0.125 No Hit GTCGGGGCAGGCGGCGGGCGCAGGCGCCGCTTGCTAGCTTGGATTCTGAC 5 0.125 No Hit GTCAATTCCTTTAAGTTTCAGCCTTGCGACCATACTCCCCCCGGAACCCA 5 0.125 No Hit CGAAGATCTAAAGGATCGATAGGCCACGCTTTCACGGTTCGTATTCGTAC 5 0.125 No Hit CCCATCACGATGAAATTTCCCAAGATTACCCGGGCCTGTCGGCCAAGGCT 5 0.125 No Hit CCGCAGGCTCCACGCCTGGTGGTGCCCTTCCGTCAATTCCTTTAAGTTTC 5 0.125 No Hit GCCGCAGGCTCCACGCCTGGTGGTGCCCTTCCGTCAATTCCTTTAAGTTT 5 0.125 No Hit GCCTTTTATCTAATAAATGCGCCCCTCCCAGAAGTCGGGGTTTGTTGCAC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.025 9 0.0 0.0 0.0 0.0 0.025 10-11 0.0 0.0 0.0 0.0 0.025 12-13 0.0 0.0 0.0 0.0 0.025 14-15 0.0 0.0 0.0 0.0 0.025 16-17 0.0 0.0 0.0 0.0 0.025 18-19 0.0 0.0 0.0 0.0 0.025 20-21 0.0 0.0 0.0 0.0 0.025 22-23 0.0 0.0 0.0 0.0 0.025 24-25 0.0 0.0 0.0 0.0 0.025 26-27 0.0 0.0 0.0 0.0 0.025 28-29 0.0 0.0 0.0 0.0 0.025 30-31 0.0 0.0 0.0 0.0 0.025 32-33 0.0 0.0 0.0 0.0 0.025 34-35 0.0 0.0 0.0 0.0 0.025 36-37 0.0 0.0 0.0 0.0 0.025 38-39 0.0 0.0 0.0 0.0 0.025 40-41 0.0 0.0 0.0 0.0 0.025 42-43 0.0 0.0 0.0 0.0 0.025 44-45 0.0 0.0 0.0 0.0 0.025 46-47 0.0 0.0 0.0 0.0 0.025 48-49 0.0 0.0 0.0 0.0 0.025 50-51 0.0 0.0 0.0 0.0 0.025 52-53 0.0 0.0 0.0 0.0 0.025 54-55 0.0 0.0 0.0 0.0 0.025 56-57 0.0 0.0 0.0 0.0 0.025 58-59 0.0 0.0 0.0 0.0 0.025 60-61 0.0 0.0 0.0 0.0 0.025 62-63 0.0 0.0 0.0 0.0 0.025 64-65 0.0 0.0 0.0 0.0 0.025 66-67 0.0 0.0 0.0 0.0 0.025 68-69 0.0 0.0 0.0 0.0 0.025 70-71 0.0 0.0 0.0 0.0 0.025 72-73 0.0 0.0 0.0 0.0 0.025 74-75 0.0 0.0 0.0 0.0 0.025 76-77 0.0 0.0 0.0 0.0 0.025 78-79 0.0 0.0 0.0 0.0 0.025 80-81 0.0 0.0 0.0 0.0 0.025 82-83 0.0 0.0 0.0 0.0 0.025 84-85 0.0 0.0 0.0 0.0 0.025 86-87 0.0 0.0 0.0 0.0 0.025 88-89 0.0 0.0 0.0 0.0 0.025 90-91 0.0 0.0 0.0 0.0 0.025 92-93 0.0 0.0 0.0 0.0 0.025 94-95 0.0 0.0 0.0 0.0 0.025 96-97 0.0 0.0 0.0 0.0 0.025 98-99 0.0 0.0 0.0 0.0 0.025 100-101 0.0 0.0 0.0 0.0 0.025 102-103 0.0 0.0 0.0 0.0 0.025 104-105 0.0 0.0 0.0 0.0 0.025 106-107 0.0 0.0 0.0 0.0 0.025 108-109 0.0 0.0 0.0 0.0 0.025 110-111 0.0 0.0 0.0 0.0 0.025 112-113 0.0 0.0 0.0 0.0 0.025 114-115 0.0 0.0 0.0 0.0 0.025 116-117 0.0 0.0 0.0 0.0 0.025 118-119 0.0 0.0 0.0 0.0 0.025 120-121 0.0 0.0 0.0 0.0 0.025 122-123 0.0 0.0 0.0 0.0 0.025 124-125 0.0 0.0 0.0 0.0 0.025 126-127 0.0 0.0 0.0 0.0 0.025 128-129 0.0 0.0 0.0 0.0 0.025 130-131 0.0 0.0 0.0 0.0 0.025 132-133 0.025 0.0 0.0 0.0 0.025 134-135 0.037500000000000006 0.0 0.0 0.0 0.025 136-137 0.05 0.0 0.0 0.0 0.025 138 0.05 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1276169 READS because READLEN < 1 Read 1276169 spots for SRR12682225.sra Written 1276169 spots for SRR12682225.sra Rejected 1276155 READS because READLEN < 1 Read 1276155 spots for SRR12682225.sra Written 1276155 spots for SRR12682225.sra Rejected 1276155 READS because READLEN < 1 Read 1276155 spots for SRR12682225.sra Written 1276155 spots for SRR12682225.sra Rejected 1276155 READS because READLEN < 1 Read 1276155 spots for SRR12682225.sra Written 1276155 spots for SRR12682225.sra Rejected 1276155 READS because READLEN < 1 Read 1276155 spots for SRR12682225.sra Written 1276155 spots for SRR12682225.sra Rejected 1276155 READS because READLEN < 1 Read 1276155 spots for SRR12682225.sra Written 1276155 spots for SRR12682225.sra Rejected 1276155 READS because READLEN < 1 Read 1276155 spots for SRR12682225.sra Written 1276155 spots for SRR12682225.sra Rejected 1276155 READS because READLEN < 1 Read 1276155 spots for SRR12682225.sra Written 1276155 spots for SRR12682225.sra Rejected 1276155 READS because READLEN < 1 Read 1276155 spots for SRR12682225.sra Written 1276155 spots for SRR12682225.sra Rejected 1276155 READS because READLEN < 1 Read 1276155 spots for SRR12682225.sra Written 1276155 spots for SRR12682225.sra Rejected 1276155 READS because READLEN < 1 Read 1276155 spots for SRR12682225.sra Written 1276155 spots for SRR12682225.sra Rejected 1276155 READS because READLEN < 1 Read 1276155 spots for SRR12682225.sra Written 1276155 spots for SRR12682225.sra Rejected 1276155 READS because READLEN < 1 Read 1276155 spots for SRR12682225.sra Written 1276155 spots for SRR12682225.sra Rejected 1276155 READS because READLEN < 1 Read 1276155 spots for SRR12682225.sra Written 1276155 spots for SRR12682225.sra Rejected 1276155 READS because READLEN < 1 Read 1276155 spots for SRR12682225.sra Written 1276155 spots for SRR12682225.sra Rejected 1276155 READS because READLEN < 1 Read 1276155 spots for SRR12682225.sra Written 1276155 spots for SRR12682225.sra Rejected 1276155 READS because READLEN < 1 Read 1276155 spots for SRR12682225.sra Written 1276155 spots for SRR12682225.sra Rejected 1276155 READS because READLEN < 1 Read 1276155 spots for SRR12682225.sra Written 1276155 spots for SRR12682225.sra Rejected 1276155 READS because READLEN < 1 Read 1276155 spots for SRR12682225.sra Written 1276155 spots for SRR12682225.sra Rejected 1276155 READS because READLEN < 1 Read 1276155 spots for SRR12682225.sra Written 1276155 spots for SRR12682225.sra SRR ids: ['SRR12682225.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_txfy0ei3 SRR12682225.sra spots: 25523114 blocks: [[1, 1276155], [1276156, 2552310], [2552311, 3828465], [3828466, 5104620], [5104621, 6380775], [6380776, 7656930], [7656931, 8933085], [8933086, 10209240], [10209241, 11485395], [11485396, 12761550], [12761551, 14037705], [14037706, 15313860], [15313861, 16590015], [16590016, 17866170], [17866171, 19142325], [19142326, 20418480], [20418481, 21694635], [21694636, 22970790], [22970791, 24246945], [24246946, 25523114]] SRR12682225 file size 8079981 SRR12682225 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12682225 SRR12682225_1.fastq Input file: SRR12682225_1.fastq trimmed: SRR12682225-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 03:15:30 2024 >> started Sat Dec 7 03:15:49 2024 >> done (19.677s) 25523114 reads processed; of these: 1 ( 0.00%) short reads filtered out after trimming by size control 2351 ( 0.01%) empty reads filtered out after trimming by size control 25520762 (99.99%) reads available; of these: 9965 ( 0.04%) trimmed reads available after processing 25510797 (99.96%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 21 2 0.00% 22 12 0.00% 23 17 0.00% 24 26 0.00% 25 39 0.00% 26 41 0.00% 27 59 0.00% 28 59 0.00% 29 90 0.00% 30 101 0.00% 31 80 0.00% 32 122 0.00% 33 122 0.00% 34 150 0.00% 35 155 0.00% 36 191 0.00% 37 216 0.00% 38 256 0.00% 39 279 0.00% 40 372 0.00% 41 400 0.00% 42 375 0.00% 43 443 0.00% 44 402 0.00% 45 480 0.00% 46 554 0.00% 47 604 0.00% 48 745 0.00% 49 989 0.00% 50 1070 0.00% 51 1089 0.00% 52 1179 0.00% 53 1307 0.01% 54 1290 0.01% 55 1339 0.01% 56 1556 0.01% 57 1788 0.01% 58 2119 0.01% 59 2229 0.01% 60 2623 0.01% 61 2934 0.01% 62 3166 0.01% 63 3251 0.01% 64 3377 0.01% 65 3790 0.01% 66 4162 0.02% 67 4533 0.02% 68 5048 0.02% 69 5436 0.02% 70 5993 0.02% 71 6965 0.03% 72 7750 0.03% 73 8425 0.03% 74 9069 0.04% 75 9960 0.04% 76 11004 0.04% 77 11672 0.05% 78 12625 0.05% 79 14774 0.06% 80 15627 0.06% 81 17063 0.07% 82 18925 0.07% 83 20900 0.08% 84 23048 0.09% 85 26235 0.10% 86 29444 0.12% 87 30874 0.12% 88 33671 0.13% 89 35455 0.14% 90 38817 0.15% 91 41508 0.16% 92 46843 0.18% 93 50629 0.20% 94 53549 0.21% 95 58864 0.23% 96 64401 0.25% 97 68364 0.27% 98 75364 0.30% 99 77948 0.31% 100 80889 0.32% 101 85338 0.33% 102 92089 0.36% 103 99206 0.39% 104 104537 0.41% 105 106206 0.42% 106 112366 0.44% 107 120836 0.47% 108 119917 0.47% 109 129989 0.51% 110 133085 0.52% 111 140580 0.55% 112 151157 0.59% 113 150637 0.59% 114 159490 0.62% 115 168614 0.66% 116 175109 0.69% 117 170029 0.67% 118 173458 0.68% 119 181560 0.71% 120 190184 0.75% 121 186985 0.73% 122 198442 0.78% 123 202901 0.80% 124 198540 0.78% 125 200471 0.79% 126 206055 0.81% 127 203420 0.80% 128 206887 0.81% 129 216993 0.85% 130 212564 0.83% 131 212420 0.83% 132 212475 0.83% 133 217887 0.85% 134 211069 0.83% 135 215714 0.85% 136 220390 0.86% 137 220285 0.86% 138 213361 0.84% 139 217549 0.85% 140 216218 0.85% 141 207493 0.81% 142 207291 0.81% 143 207008 0.81% 144 213923 0.84% 145 212755 0.83% 146 270549 1.06% 147 476907 1.87% 148 1123570 4.40% 149 3830409 15.01% 150 10748522 42.12% 25520762 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.62 fanout-score-rank=36 prefix-density=1.27 prefix-fanout=1.0 sequence=CTTGGATGTGGCAGCCGTTTCTC criterion=fanout-score sequence-density=0.07 sequence-density-rank=29 fanout-score=274.90 fanout-score-rank=1 prefix-density=0.59 prefix-fanout=31.4 sequence=CTTCTTCTTGTC Started job on | Dec 07 03:16:11 Started mapping on | Dec 07 03:16:11 Finished on | Dec 07 03:17:26 Mapping speed, Million of reads per hour | 1225.00 Number of input reads | 25520762 Average input read length | 139 UNIQUE READS: Uniquely mapped reads number | 15598098 Uniquely mapped reads % | 61.12% Average mapped length | 139.40 Number of splices: Total | 6727897 Number of splices: Annotated (sjdb) | 6340259 Number of splices: GT/AG | 6638727 Number of splices: GC/AG | 79418 Number of splices: AT/AC | 4838 Number of splices: Non-canonical | 4914 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 1.53 Insertion rate per base | 0.00% Insertion average length | 1.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 961878 % of reads mapped to multiple loci | 3.77% Number of reads mapped to too many loci | 7493351 % of reads mapped to too many loci | 29.36% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.78% % of reads unmapped: other | 3.97% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 8960786 8960786 8960786 N_multimapping 961878 961878 961878 N_noFeature 781117 15214122 901772 N_ambiguous 305383 1656 42749 UnstrandedReadsAssigned:14511598 PositiveStrandReadsAssigned:382320 NegativeStrandReadsAssigned:14653577 Dataset is classified negative stranded MeadianReadLen=149 20thPercentileLength=127 echo kmer=123 SRR12682225 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR12682225-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,520,762 reads, 14,952,912 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,108 rounds 52973 SRR12682225.ke.tsv 35125 SRR12682225.se.tsv 88098 total ==> SRR12682225.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 59.8468 7.5146 PNS24247 1044 945 32.0833 3.56811 PNS24249 1928 1829 113.045 6.49575 PNS24246 1044 945 32.0833 3.56811 PNS24248 1044 945 32.0833 3.56811 PNS24244 1471 1372 124.858 9.5643 PNS24243 293 194 1 0.541738 KQK14069 1603 1504 7936.29 554.575 KQK14071 474 375 591.929 165.893 ==> SRR12682225.se.tsv <== BRADI_1g14170v3 9517 BRADI_1g53295v3 103 BRADI_1g59795v3 372 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 731 BRADI_1g74790v3 450 BRADI_1g09890v3 0 BRADI_1g77505v3 185 BRADI_1g48960v3 0 SRR12682225 completed mapping pipeline successfully