Starting /dee2/code/volunteer_pipeline.sh SRR12711889 current disk space = 1540628647936 free memory = 1602339400 SRR12711889 SRAfilesize afcd47d783c28dd0ae78082232c2bc14 SRR12711889.sra SRR12711889.sra file validated SRR12711889 is paired end SRR12711889 is conventional basespace SRR12711889 read1 length is 80 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12711889_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 80 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.852 38.0 38.0 38.0 32.0 38.0 2 36.6155 38.0 38.0 38.0 32.0 38.0 3 36.6595 38.0 38.0 38.0 32.0 38.0 4 36.77575 38.0 38.0 38.0 32.0 38.0 5 36.687 38.0 38.0 38.0 32.0 38.0 6 38.77025 40.0 38.0 40.0 38.0 40.0 7 38.62975 40.0 38.0 40.0 38.0 40.0 8 38.6655 40.0 38.0 40.0 38.0 40.0 9 38.696 40.0 38.0 40.0 38.0 40.0 10-11 38.670625 40.0 38.0 40.0 38.0 40.0 12-13 38.68075 40.0 38.0 40.0 38.0 40.0 14-15 38.5055 40.0 38.0 40.0 38.0 40.0 16-17 38.5325 40.0 38.0 40.0 38.0 40.0 18-19 38.6515 40.0 38.0 40.0 38.0 40.0 20-21 38.67725 40.0 38.0 40.0 38.0 40.0 22-23 38.659125 40.0 38.0 40.0 38.0 40.0 24-25 38.62575 40.0 38.0 40.0 38.0 40.0 26-27 38.62875 40.0 38.0 40.0 38.0 40.0 28-29 38.647625000000005 40.0 38.0 40.0 38.0 40.0 30-31 38.62975 40.0 38.0 40.0 38.0 40.0 32-33 38.507125 40.0 38.0 40.0 38.0 40.0 34-35 38.644375 40.0 38.0 40.0 38.0 40.0 36-37 38.596125 40.0 38.0 40.0 38.0 40.0 38-39 38.456 40.0 38.0 40.0 38.0 40.0 40-41 38.502624999999995 40.0 38.0 40.0 38.0 40.0 42-43 38.505624999999995 40.0 38.0 40.0 38.0 40.0 44-45 38.280875 40.0 38.0 40.0 38.0 40.0 46-47 38.403 40.0 38.0 40.0 38.0 40.0 48-49 38.468 40.0 38.0 40.0 38.0 40.0 50-51 38.37575 40.0 38.0 40.0 38.0 40.0 52-53 38.447375 40.0 38.0 40.0 38.0 40.0 54-55 38.499375 40.0 38.0 40.0 38.0 40.0 56-57 38.33475 40.0 38.0 40.0 38.0 40.0 58-59 38.386125 40.0 38.0 40.0 38.0 40.0 60-61 38.283125 40.0 38.0 40.0 38.0 40.0 62-63 38.23075 40.0 38.0 40.0 38.0 40.0 64-65 38.30175 40.0 38.0 40.0 38.0 40.0 66-67 38.283625 40.0 38.0 40.0 38.0 40.0 68-69 38.239374999999995 40.0 38.0 40.0 38.0 40.0 70-71 38.188625 40.0 38.0 40.0 38.0 40.0 72-73 38.182500000000005 40.0 38.0 40.0 38.0 40.0 74-75 38.26025 40.0 38.0 40.0 38.0 40.0 76-77 38.2445 40.0 38.0 40.0 38.0 40.0 78-79 38.208 40.0 38.0 40.0 38.0 40.0 80 37.388 38.0 38.0 40.0 32.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 0.0 24 0.0 25 2.0 26 8.0 27 15.0 28 18.0 29 31.0 30 43.0 31 44.0 32 60.0 33 57.0 34 85.0 35 138.0 36 143.0 37 259.0 38 581.0 39 2515.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.05 15.0 8.025 33.925 2 27.145007526342198 16.20672353236327 27.87255393878575 28.77571500250878 3 24.425 19.275000000000002 21.15 35.15 4 26.950000000000003 23.95 21.05 28.050000000000004 5 27.3 27.85 21.875 22.975 6 25.174999999999997 28.675 22.775000000000002 23.375 7 19.6 22.900000000000002 36.5 21.0 8 22.5 22.475 27.450000000000003 27.575 9 21.175 22.45 31.624999999999996 24.75 10-11 25.25 27.200000000000003 22.5625 24.9875 12-13 23.825 23.825 26.6 25.75 14-15 24.337500000000002 24.725 24.9875 25.95 16-17 24.9375 24.05 25.137500000000003 25.874999999999996 18-19 24.8125 24.0625 25.224999999999998 25.900000000000002 20-21 24.75 25.0375 24.337500000000002 25.874999999999996 22-23 24.8 24.875 24.675 25.650000000000002 24-25 24.6125 24.65 24.224999999999998 26.5125 26-27 23.962500000000002 24.587500000000002 24.462500000000002 26.987499999999997 28-29 25.174999999999997 24.975 23.9125 25.937500000000004 30-31 24.125 24.4375 24.712500000000002 26.724999999999998 32-33 24.725 25.174999999999997 24.3 25.8 34-35 24.325 24.275 24.975 26.424999999999997 36-37 24.6625 24.5125 24.6125 26.2125 38-39 24.7375 24.5375 24.0625 26.6625 40-41 24.6875 24.637500000000003 24.025 26.650000000000002 42-43 24.375 23.9 24.75 26.974999999999998 44-45 24.725 24.85 24.5 25.924999999999997 46-47 24.712500000000002 24.7375 24.4875 26.0625 48-49 23.9 24.15 25.224999999999998 26.724999999999998 50-51 24.637500000000003 24.0 24.75 26.6125 52-53 24.762500000000003 24.8 24.0125 26.424999999999997 54-55 24.1625 24.1375 25.05 26.650000000000002 56-57 24.5 24.9875 24.0 26.5125 58-59 24.4125 24.0625 24.6625 26.8625 60-61 24.5375 23.8125 24.85 26.8 62-63 24.1625 25.275 23.849999999999998 26.7125 64-65 25.35 24.125 24.7 25.825 66-67 24.9375 24.1375 24.1125 26.8125 68-69 24.275 24.625 24.212500000000002 26.887499999999996 70-71 25.3125 24.775 23.6625 26.25 72-73 24.887500000000003 24.05 24.175 26.887499999999996 74-75 24.625 24.4375 24.875 26.0625 76-77 25.3125 23.7 24.8125 26.174999999999997 78-79 23.5625 23.4125 25.412499999999998 27.6125 80 26.424999999999997 24.025 24.075 25.474999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.5 25 2.0 26 1.0 27 2.0 28 4.5 29 8.0 30 11.0 31 12.5 32 16.0 33 23.5 34 39.5 35 50.0 36 60.0 37 79.0 38 103.0 39 121.5 40 125.0 41 135.0 42 163.0 43 195.5 44 213.5 45 217.0 46 214.0 47 209.0 48 203.5 49 198.5 50 197.0 51 172.0 52 161.0 53 165.5 54 137.5 55 119.0 56 128.0 57 134.0 58 132.0 59 124.0 60 115.0 61 110.0 62 107.0 63 103.0 64 100.5 65 104.0 66 92.0 67 73.0 68 59.0 69 54.5 70 57.0 71 47.0 72 36.0 73 24.5 74 14.0 75 14.0 76 11.5 77 4.5 78 2.0 79 2.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.35000000000000003 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 80 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 57 0.025 0.0 0.0 0.0 0.0 58 0.025 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.025 0.0 0.0 0.0 0.0 61 0.05 0.0 0.0 0.0 0.0 62 0.075 0.0 0.0 0.0 0.0 63 0.1 0.0 0.0 0.0 0.0 64 0.1 0.0 0.0 0.0 0.0 65 0.1 0.0 0.0 0.0 0.0 66 0.1 0.0 0.0 0.0 0.0 67 0.125 0.0 0.0 0.0 0.0 68 0.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12711889 read2 length is 80 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12711889_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 80 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.39575 38.0 38.0 38.0 32.0 38.0 2 36.11075 38.0 38.0 38.0 32.0 38.0 3 36.1335 38.0 38.0 38.0 32.0 38.0 4 36.0925 38.0 38.0 38.0 32.0 38.0 5 36.20325 38.0 38.0 38.0 32.0 38.0 6 38.10975 40.0 38.0 40.0 38.0 40.0 7 38.23625 40.0 38.0 40.0 38.0 40.0 8 38.2915 40.0 38.0 40.0 38.0 40.0 9 38.35275 40.0 38.0 40.0 38.0 40.0 10-11 38.431375 40.0 38.0 40.0 38.0 40.0 12-13 38.26075 40.0 38.0 40.0 38.0 40.0 14-15 38.244625 40.0 38.0 40.0 38.0 40.0 16-17 38.267624999999995 40.0 38.0 40.0 38.0 40.0 18-19 38.32425 40.0 38.0 40.0 38.0 40.0 20-21 38.244 40.0 38.0 40.0 38.0 40.0 22-23 38.35075 40.0 38.0 40.0 38.0 40.0 24-25 38.18875 40.0 38.0 40.0 38.0 40.0 26-27 38.226875 40.0 38.0 40.0 38.0 40.0 28-29 38.2405 40.0 38.0 40.0 38.0 40.0 30-31 38.230625 40.0 38.0 40.0 38.0 40.0 32-33 38.2325 40.0 38.0 40.0 38.0 40.0 34-35 38.0075 40.0 38.0 40.0 38.0 40.0 36-37 38.072625 40.0 38.0 40.0 38.0 40.0 38-39 38.070625 40.0 38.0 40.0 38.0 40.0 40-41 38.207625 40.0 38.0 40.0 38.0 40.0 42-43 38.09475 40.0 38.0 40.0 38.0 40.0 44-45 37.981625 40.0 38.0 40.0 38.0 40.0 46-47 37.999625 40.0 38.0 40.0 38.0 40.0 48-49 37.979625 40.0 38.0 40.0 38.0 40.0 50-51 37.934 40.0 38.0 40.0 38.0 40.0 52-53 37.84725 40.0 38.0 40.0 35.0 40.0 54-55 37.891375 40.0 38.0 40.0 35.0 40.0 56-57 37.897 40.0 38.0 40.0 35.0 40.0 58-59 37.844125 40.0 38.0 40.0 35.0 40.0 60-61 37.919624999999996 40.0 38.0 40.0 38.0 40.0 62-63 37.923 40.0 38.0 40.0 38.0 40.0 64-65 37.927 40.0 38.0 40.0 38.0 40.0 66-67 37.793125 40.0 38.0 40.0 32.0 40.0 68-69 37.610875 40.0 38.0 40.0 32.0 40.0 70-71 37.643625 40.0 38.0 40.0 32.0 40.0 72-73 37.598749999999995 39.0 38.0 40.0 32.0 40.0 74-75 37.704125000000005 38.0 38.0 40.0 35.0 40.0 76-77 37.52975 38.0 38.0 40.0 32.0 40.0 78-79 37.336625 38.0 38.0 40.0 32.0 40.0 80 35.614 38.0 38.0 38.0 27.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 2.0 17 2.0 18 3.0 19 4.0 20 10.0 21 4.0 22 9.0 23 11.0 24 7.0 25 11.0 26 16.0 27 14.0 28 28.0 29 38.0 30 37.0 31 54.0 32 53.0 33 68.0 34 89.0 35 121.0 36 185.0 37 297.0 38 717.0 39 2220.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.95 20.5 10.725 28.825 2 30.375000000000004 24.55 24.175 20.9 3 24.474999999999998 25.8 25.25 24.474999999999998 4 25.85 30.625000000000004 20.525 23.0 5 27.950000000000003 30.525000000000002 19.275000000000002 22.25 6 25.924999999999997 32.175 19.950000000000003 21.95 7 24.6 19.2 31.624999999999996 24.575 8 26.400000000000002 21.475 22.075 30.049999999999997 9 26.05 22.075 25.15 26.724999999999998 10-11 26.875 27.025 20.0875 26.0125 12-13 26.375 23.200000000000003 24.3875 26.0375 14-15 27.1375 24.4125 22.900000000000002 25.55 16-17 26.224999999999998 25.2625 22.725 25.7875 18-19 26.9625 24.6625 23.45 24.925 20-21 26.3625 25.0375 22.7375 25.8625 22-23 27.737499999999997 24.212500000000002 22.8375 25.2125 24-25 27.0125 24.75 23.6875 24.55 26-27 26.275 24.3 23.849999999999998 25.575 28-29 27.175 24.0375 23.4125 25.374999999999996 30-31 26.2875 24.525 23.3 25.887500000000003 32-33 26.825 23.2625 23.599999999999998 26.3125 34-35 26.125 24.099999999999998 23.0875 26.687499999999996 36-37 26.687499999999996 23.549999999999997 22.9875 26.775 38-39 26.5 24.7 23.599999999999998 25.2 40-41 26.85 24.25 23.25 25.650000000000002 42-43 26.2125 24.025 24.05 25.7125 44-45 27.775 24.1625 23.375 24.6875 46-47 26.8125 24.087500000000002 23.2875 25.8125 48-49 26.3 24.45 24.087500000000002 25.162499999999998 50-51 25.775 24.3875 24.7875 25.05 52-53 26.700000000000003 24.3875 23.5125 25.4 54-55 26.325 25.0125 23.3375 25.324999999999996 56-57 27.525 23.875 22.7375 25.8625 58-59 26.637499999999996 24.25 23.4375 25.674999999999997 60-61 27.275 23.9375 24.275 24.5125 62-63 26.3 25.25 22.875 25.575 64-65 27.1375 23.625 24.3125 24.925 66-67 26.1 24.8625 24.425 24.6125 68-69 26.075 24.45 23.962500000000002 25.5125 70-71 27.037499999999998 24.0625 23.4875 25.412499999999998 72-73 25.887500000000003 25.3125 24.3 24.5 74-75 26.4125 25.275 23.625 24.6875 76-77 26.8125 25.074999999999996 23.4625 24.65 78-79 25.887500000000003 25.112499999999997 24.5375 24.462500000000002 80 25.674999999999997 23.9 25.275 25.15 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 0.0 26 0.0 27 3.0 28 5.5 29 3.5 30 2.0 31 5.0 32 10.0 33 17.0 34 27.0 35 32.0 36 43.5 37 68.5 38 82.0 39 100.0 40 118.0 41 131.5 42 162.5 43 194.5 44 201.5 45 194.0 46 201.0 47 201.5 48 205.5 49 203.5 50 191.0 51 174.5 52 160.5 53 163.0 54 150.0 55 137.0 56 138.5 57 142.0 58 141.0 59 135.5 60 133.0 61 123.0 62 114.5 63 114.0 64 106.0 65 100.0 66 100.5 67 88.0 68 71.0 69 56.0 70 45.0 71 45.5 72 35.0 73 27.5 74 21.0 75 11.0 76 12.5 77 7.5 78 1.0 79 1.0 80 1.0 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 80 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 57 0.025 0.0 0.0 0.0 0.0 58 0.025 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.025 0.0 0.0 0.0 0.0 61 0.05 0.0 0.0 0.0 0.0 62 0.075 0.0 0.0 0.0 0.0 63 0.075 0.0 0.0 0.0 0.0 64 0.075 0.0 0.0 0.0 0.0 65 0.075 0.0 0.0 0.0 0.0 66 0.075 0.0 0.0 0.0 0.0 67 0.125 0.0 0.0 0.0 0.0 68 0.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1563432 spots for SRR12711889.sra Written 1563432 spots for SRR12711889.sra Read 1563432 spots for SRR12711889.sra Written 1563432 spots for SRR12711889.sra Read 1563432 spots for SRR12711889.sra Written 1563432 spots for SRR12711889.sra Read 1563432 spots for SRR12711889.sra Written 1563432 spots for SRR12711889.sra Read 1563432 spots for SRR12711889.sra Written 1563432 spots for SRR12711889.sra Read 1563432 spots for SRR12711889.sra Written 1563432 spots for SRR12711889.sra Read 1563432 spots for SRR12711889.sra Written 1563432 spots for SRR12711889.sra Read 1563432 spots for SRR12711889.sra Written 1563432 spots for SRR12711889.sra Read 1563445 spots for SRR12711889.sra Written 1563445 spots for SRR12711889.sra Read 1563432 spots for SRR12711889.sra Written 1563432 spots for SRR12711889.sra Read 1563432 spots for SRR12711889.sra Written 1563432 spots for SRR12711889.sra Read 1563432 spots for SRR12711889.sra Written 1563432 spots for SRR12711889.sra Read 1563432 spots for SRR12711889.sra Written 1563432 spots for SRR12711889.sra Read 1563432 spots for SRR12711889.sra Written 1563432 spots for SRR12711889.sra Read 1563432 spots for SRR12711889.sra Written 1563432 spots for SRR12711889.sra Read 1563432 spots for SRR12711889.sra Written 1563432 spots for SRR12711889.sra Read 1563432 spots for SRR12711889.sra Written 1563432 spots for SRR12711889.sra Read 1563432 spots for SRR12711889.sra Written 1563432 spots for SRR12711889.sra Read 1563432 spots for SRR12711889.sra Written 1563432 spots for SRR12711889.sra Read 1563432 spots for SRR12711889.sra Written 1563432 spots for SRR12711889.sra SRR ids: ['SRR12711889.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7x85td44 SRR12711889.sra spots: 31268653 blocks: [[1, 1563432], [1563433, 3126864], [3126865, 4690296], [4690297, 6253728], [6253729, 7817160], [7817161, 9380592], [9380593, 10944024], [10944025, 12507456], [12507457, 14070888], [14070889, 15634320], [15634321, 17197752], [17197753, 18761184], [18761185, 20324616], [20324617, 21888048], [21888049, 23451480], [23451481, 25014912], [25014913, 26578344], [26578345, 28141776], [28141777, 29705208], [29705209, 31268653]] SRR12711889 file size 6238137 SRR12711889 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12711889 SRR12711889_1.fastq SRR12711889_2.fastq Input file: SRR12711889_1.fastq Paired file: SRR12711889_2.fastq trimmed: SRR12711889-trimmed-pair1.fastq, SRR12711889-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 18:23:39 2024 >> started Sat Dec 7 18:24:06 2024 >> done (27.367s) 31268653 read pairs processed; of these: 1668 ( 0.01%) short read pairs filtered out after trimming by size control 17550 ( 0.06%) empty read pairs filtered out after trimming by size control 31249435 (99.94%) read pairs available; of these: 302438 ( 0.97%) trimmed read pairs available after processing 30946997 (99.03%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 10 0.00% 20 13 0.00% 21 12 0.00% 22 15 0.00% 23 9 0.00% 24 10 0.00% 25 15 0.00% 26 18 0.00% 27 46 0.00% 28 37 0.00% 29 41 0.00% 30 59 0.00% 31 58 0.00% 32 79 0.00% 33 111 0.00% 34 117 0.00% 35 125 0.00% 36 142 0.00% 37 146 0.00% 38 210 0.00% 39 250 0.00% 40 318 0.00% 41 315 0.00% 42 422 0.00% 43 452 0.00% 44 464 0.00% 45 542 0.00% 46 589 0.00% 47 671 0.00% 48 744 0.00% 49 1714 0.01% 50 1544 0.00% 51 2084 0.01% 52 2129 0.01% 53 1962 0.01% 54 3012 0.01% 55 2165 0.01% 56 3281 0.01% 57 3104 0.01% 58 4030 0.01% 59 4057 0.01% 60 4563 0.01% 61 5321 0.02% 62 4934 0.02% 63 6627 0.02% 64 5985 0.02% 65 7497 0.02% 66 7405 0.02% 67 8227 0.03% 68 8177 0.03% 69 10854 0.03% 70 11353 0.04% 71 13630 0.04% 72 15116 0.05% 73 17417 0.06% 74 19495 0.06% 75 20012 0.06% 76 21305 0.07% 77 23476 0.08% 78 26453 0.08% 79 29462 0.09% 80 30946997 99.03% 31249435 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.74 fanout-score-rank=18 prefix-density=0.33 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=32 fanout-score=11.99 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=2.8 sequence=GCCGGGAACGATTCCCTGCTCGACAAGGATGTCAACAATCTTCTTGCCATCAACAGTCGATTGGTAGAGGGTCTCCTCGAAGAGGATAGCACCAGAGATGTAATTTCCCAGGCCTGGTGGAGTGACAAGGAGGGTACGGTAAGCCTGGCGGTTAGCCTCAGTGTTCTCAAGGCCAATCGAGTCAAGTCTCTTTCCACAGGTAGCATTGGACTCATCCATGGCTAGGATGCCCCTTCCTGGTGATGCGATGGTTTTCGCGGTCTTGACAAGTTCATCAGCGTATGCGCTGGCACGGACAACCATGGAGACGGTCATCTGCTTGGGAGTGGCAGCCTGGCGGGTGGTGCCCCATTCGGACTTCTTGGGAAGGAAAGACGATTTGAGGATAGTAGCCGAGGCCATTGTTTCTGGCTCCAAAGGCAAGAGGATCAGGTGCT criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=5.03 fanout-score-rank=11 prefix-density=0.41 prefix-fanout=3.7 sequence=AAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.10 sequence-density-rank=19 fanout-score=117.10 fanout-score-rank=1 prefix-density=0.64 prefix-fanout=18.1 sequence=GCCGCCGCCGCCA SRR12711889 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 18:24:43 Started mapping on | Dec 07 18:24:43 Finished on | Dec 07 18:25:44 Mapping speed, Million of reads per hour | 1844.23 Number of input reads | 31249435 Average input read length | 159 UNIQUE READS: Uniquely mapped reads number | 30032794 Uniquely mapped reads % | 96.11% Average mapped length | 159.43 Number of splices: Total | 15820910 Number of splices: Annotated (sjdb) | 15054263 Number of splices: GT/AG | 15615337 Number of splices: GC/AG | 183463 Number of splices: AT/AC | 7645 Number of splices: Non-canonical | 14465 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 1.97 Insertion rate per base | 0.01% Insertion average length | 1.71 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 484731 % of reads mapped to multiple loci | 1.55% Number of reads mapped to too many loci | 130951 % of reads mapped to too many loci | 0.42% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.10% % of reads unmapped: other | 0.83% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 732434 732434 732434 N_multimapping 484731 484731 484731 N_noFeature 760203 29273375 1004937 N_ambiguous 587598 2783 73744 UnstrandedReadsAssigned:28684993 PositiveStrandReadsAssigned:756636 NegativeStrandReadsAssigned:28954113 Dataset is classified negative stranded MeadianReadLen=80 20thPercentileLength=80 echo kmer=75 SRR12711889 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12711889-trimmed-pair1.fastq SRR12711889-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,249,435 reads, 29,252,635 reads pseudoaligned [quant] estimated average fragment length: 152.595 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,216 rounds 52973 SRR12711889.ke.tsv 35125 SRR12711889.se.tsv 88098 total ==> SRR12711889.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 784.485 0 0 PNS24247 1044 892.405 80.3734 4.4232 PNS24249 1928 1776.4 105.713 2.92262 PNS24246 1044 892.405 80.3734 4.4232 PNS24248 1044 892.405 80.3734 4.4232 PNS24244 1471 1319.4 81.1667 3.02125 PNS24243 293 144.115 0 0 KQK14069 1603 1451.4 1499.55 50.7411 KQK14071 474 323.51 40.9919 6.22296 ==> SRR12711889.se.tsv <== BRADI_1g14170v3 1558 BRADI_1g53295v3 40 BRADI_1g59795v3 379 BRADI_1g07683v3 0 BRADI_1g00485v3 82 BRADI_1g20270v3 4738 BRADI_1g74790v3 532 BRADI_1g09890v3 26 BRADI_1g77505v3 492 BRADI_1g48960v3 0 SRR12711889 completed mapping pipeline successfully