Starting /dee2/code/volunteer_pipeline.sh SRR12711890 current disk space = 1540654682112 free memory = 1602337104 SRR12711890 SRAfilesize 8af97feaea5be8fe2ea0a62b605db4b3 SRR12711890.sra SRR12711890.sra file validated SRR12711890 is paired end SRR12711890 is conventional basespace SRR12711890 read1 length is 80 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12711890_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 80 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.66825 38.0 38.0 38.0 32.0 38.0 2 36.97225 38.0 38.0 38.0 32.0 38.0 3 36.62475 38.0 38.0 38.0 32.0 38.0 4 36.7175 38.0 38.0 38.0 32.0 38.0 5 36.58725 38.0 38.0 38.0 32.0 38.0 6 38.809 40.0 38.0 40.0 38.0 40.0 7 38.8445 40.0 38.0 40.0 38.0 40.0 8 38.96025 40.0 38.0 40.0 38.0 40.0 9 39.118 40.0 38.0 40.0 38.0 40.0 10-11 38.95925 40.0 38.0 40.0 38.0 40.0 12-13 39.061875 40.0 38.0 40.0 38.0 40.0 14-15 38.797250000000005 40.0 38.0 40.0 38.0 40.0 16-17 38.9965 40.0 38.0 40.0 38.0 40.0 18-19 39.009249999999994 40.0 38.0 40.0 38.0 40.0 20-21 39.017624999999995 40.0 38.0 40.0 38.0 40.0 22-23 38.95525000000001 40.0 38.0 40.0 38.0 40.0 24-25 39.05025 40.0 38.0 40.0 38.0 40.0 26-27 38.738375 40.0 38.0 40.0 38.0 40.0 28-29 38.79325 40.0 38.0 40.0 38.0 40.0 30-31 38.921375 40.0 38.0 40.0 38.0 40.0 32-33 38.885125 40.0 38.0 40.0 38.0 40.0 34-35 38.53675 40.0 38.0 40.0 38.0 40.0 36-37 38.803 40.0 38.0 40.0 38.0 40.0 38-39 38.713625 40.0 38.0 40.0 38.0 40.0 40-41 38.887 40.0 38.0 40.0 38.0 40.0 42-43 38.892624999999995 40.0 38.0 40.0 38.0 40.0 44-45 38.691 40.0 38.0 40.0 38.0 40.0 46-47 38.82475 40.0 38.0 40.0 38.0 40.0 48-49 38.773624999999996 40.0 38.0 40.0 38.0 40.0 50-51 38.7845 40.0 38.0 40.0 38.0 40.0 52-53 38.68175 40.0 38.0 40.0 38.0 40.0 54-55 38.61625 40.0 38.0 40.0 38.0 40.0 56-57 38.682249999999996 40.0 38.0 40.0 38.0 40.0 58-59 38.7325 40.0 38.0 40.0 38.0 40.0 60-61 38.8515 40.0 38.0 40.0 38.0 40.0 62-63 38.67225 40.0 38.0 40.0 38.0 40.0 64-65 38.753625 40.0 38.0 40.0 38.0 40.0 66-67 38.574625 40.0 38.0 40.0 38.0 40.0 68-69 38.236875 40.0 38.0 40.0 38.0 40.0 70-71 38.67274999999999 40.0 38.0 40.0 38.0 40.0 72-73 38.126999999999995 40.0 38.0 40.0 38.0 40.0 74-75 38.512125 40.0 38.0 40.0 38.0 40.0 76-77 38.573125000000005 40.0 38.0 40.0 38.0 40.0 78-79 38.311 40.0 38.0 40.0 38.0 40.0 80 37.79325 38.0 38.0 40.0 32.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 2.0 24 0.0 25 4.0 26 3.0 27 11.0 28 13.0 29 12.0 30 38.0 31 33.0 32 34.0 33 47.0 34 83.0 35 97.0 36 146.0 37 210.0 38 513.0 39 2754.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.3 13.375 7.449999999999999 34.875 2 26.65666416604151 15.928982245561391 28.232058014503625 29.182295573893473 3 23.75 19.775000000000002 22.375 34.1 4 28.207051762940733 24.18104526131533 19.35483870967742 28.257064266066518 5 26.375 28.375 21.675 23.575 6 24.675 28.625 22.775000000000002 23.925 7 21.975 21.75 34.275 22.0 8 21.8 22.8 27.575 27.825 9 21.175 20.775 30.95 27.1 10-11 25.6125 27.425 21.712500000000002 25.25 12-13 25.4875 22.575 25.874999999999996 26.0625 14-15 24.6 23.425 25.025 26.950000000000003 16-17 24.7375 24.0625 24.6875 26.5125 18-19 24.3875 24.0 23.95 27.6625 20-21 25.112499999999997 23.95 24.4875 26.450000000000003 22-23 26.55 23.95 23.962500000000002 25.5375 24-25 25.55 24.05 23.325000000000003 27.075 26-27 24.8125 24.3 24.349999999999998 26.5375 28-29 25.337500000000002 24.087500000000002 24.85 25.724999999999998 30-31 24.7 24.1875 24.25 26.8625 32-33 25.2 23.5375 24.75 26.5125 34-35 25.5375 23.474999999999998 23.525 27.462500000000002 36-37 24.762500000000003 24.5 24.087500000000002 26.650000000000002 38-39 24.7375 23.549999999999997 25.0125 26.700000000000003 40-41 24.725 24.45 24.125 26.700000000000003 42-43 25.5625 23.8125 23.7625 26.8625 44-45 25.687500000000004 23.775 24.462500000000002 26.075 46-47 25.275 23.875 24.025 26.825 48-49 23.9125 23.4625 24.6125 28.012500000000003 50-51 24.8 23.375 24.474999999999998 27.35 52-53 26.5 22.9875 23.5875 26.924999999999997 54-55 25.1875 24.349999999999998 23.7 26.7625 56-57 25.2875 23.6875 24.3 26.724999999999998 58-59 24.8625 23.825 23.4875 27.825 60-61 25.224999999999998 23.849999999999998 23.9125 27.0125 62-63 25.3125 22.9375 24.275 27.474999999999998 64-65 26.087500000000002 24.4375 23.075000000000003 26.400000000000002 66-67 25.662499999999998 23.5875 23.8375 26.9125 68-69 24.85 23.1875 24.7375 27.224999999999998 70-71 26.400000000000002 22.162499999999998 24.65 26.787499999999998 72-73 25.2125 23.625 23.9125 27.250000000000004 74-75 25.5 23.25 24.1875 27.0625 76-77 25.724999999999998 23.7125 24.0625 26.5 78-79 25.95 23.7625 23.7125 26.575 80 24.425 24.175 24.625 26.775 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 1.0 26 1.0 27 2.0 28 3.5 29 5.5 30 7.0 31 9.0 32 16.0 33 22.5 34 33.5 35 43.0 36 45.5 37 53.0 38 74.0 39 104.0 40 118.0 41 129.0 42 153.0 43 166.0 44 186.5 45 207.0 46 204.0 47 202.0 48 202.0 49 210.0 50 219.0 51 205.5 52 176.0 53 157.0 54 148.0 55 142.0 56 142.5 57 130.5 58 121.0 59 138.0 60 152.0 61 133.0 62 112.5 63 102.5 64 102.0 65 110.0 66 99.5 67 92.5 68 79.5 69 61.5 70 60.0 71 49.0 72 35.0 73 31.5 74 23.5 75 16.0 76 15.0 77 10.5 78 5.5 79 2.5 80 1.0 81 1.5 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.025 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 80 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49748743718592 99.0 2 0.5025125628140703 1.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 65 0.0 0.0 0.0 0.0 0.0 66 0.025 0.0 0.0 0.0 0.0 67 0.05 0.0 0.0 0.0 0.0 68 0.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12711890 read2 length is 80 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12711890_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 80 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2005 38.0 38.0 38.0 32.0 38.0 2 36.36075 38.0 38.0 38.0 32.0 38.0 3 35.6025 38.0 32.0 38.0 32.0 38.0 4 36.31675 38.0 38.0 38.0 32.0 38.0 5 36.4025 38.0 38.0 38.0 32.0 38.0 6 38.61475 40.0 38.0 40.0 38.0 40.0 7 38.5035 40.0 38.0 40.0 38.0 40.0 8 38.5755 40.0 38.0 40.0 38.0 40.0 9 38.3665 40.0 38.0 40.0 38.0 40.0 10-11 38.2755 40.0 38.0 40.0 38.0 40.0 12-13 38.3785 40.0 38.0 40.0 38.0 40.0 14-15 38.581125 40.0 38.0 40.0 38.0 40.0 16-17 38.305125000000004 40.0 38.0 40.0 38.0 40.0 18-19 38.420875 40.0 38.0 40.0 38.0 40.0 20-21 38.487625 40.0 38.0 40.0 38.0 40.0 22-23 38.469125000000005 40.0 38.0 40.0 38.0 40.0 24-25 38.1815 40.0 38.0 40.0 38.0 40.0 26-27 38.3885 40.0 38.0 40.0 38.0 40.0 28-29 38.34775 40.0 38.0 40.0 38.0 40.0 30-31 38.511625 40.0 38.0 40.0 38.0 40.0 32-33 38.45825 40.0 38.0 40.0 38.0 40.0 34-35 38.374875 40.0 38.0 40.0 38.0 40.0 36-37 38.333875 40.0 38.0 40.0 38.0 40.0 38-39 38.397125 40.0 38.0 40.0 38.0 40.0 40-41 38.103 40.0 38.0 40.0 38.0 40.0 42-43 38.17375 40.0 38.0 40.0 38.0 40.0 44-45 37.90975 40.0 38.0 40.0 35.0 40.0 46-47 38.157125 40.0 38.0 40.0 38.0 40.0 48-49 38.2335 40.0 38.0 40.0 38.0 40.0 50-51 38.3275 40.0 38.0 40.0 38.0 40.0 52-53 38.319500000000005 40.0 38.0 40.0 38.0 40.0 54-55 38.304625 40.0 38.0 40.0 38.0 40.0 56-57 38.082375 40.0 38.0 40.0 38.0 40.0 58-59 37.757125 40.0 38.0 40.0 35.0 40.0 60-61 37.96475 40.0 38.0 40.0 38.0 40.0 62-63 37.85725 40.0 38.0 40.0 35.0 40.0 64-65 38.158874999999995 40.0 38.0 40.0 38.0 40.0 66-67 37.769 40.0 38.0 40.0 35.0 40.0 68-69 37.934625 40.0 38.0 40.0 35.0 40.0 70-71 37.631625 40.0 38.0 40.0 32.0 40.0 72-73 37.827124999999995 40.0 38.0 40.0 38.0 40.0 74-75 37.798 40.0 38.0 40.0 35.0 40.0 76-77 37.76925 40.0 38.0 40.0 35.0 40.0 78-79 37.836625 40.0 38.0 40.0 38.0 40.0 80 35.248 38.0 32.0 38.0 27.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 3.0 16 2.0 17 6.0 18 4.0 19 4.0 20 6.0 21 6.0 22 4.0 23 6.0 24 12.0 25 7.0 26 15.0 27 24.0 28 19.0 29 28.0 30 38.0 31 44.0 32 51.0 33 56.0 34 83.0 35 100.0 36 160.0 37 265.0 38 659.0 39 2398.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.38484621155289 18.97974493623406 11.377844461115279 30.257564391097773 2 31.05 25.924999999999997 22.25 20.775 3 25.906476619154787 26.60665166291573 23.830957739434858 23.655913978494624 4 27.656914228557138 29.607401850462615 18.404601150287572 24.33108277069267 5 28.832208052013 30.182545636409102 17.62940735183796 23.355838959739934 6 26.125 32.05 18.025 23.799999999999997 7 26.174999999999997 19.225 29.275000000000002 25.324999999999996 8 25.75 21.625 22.15 30.475 9 24.75 22.025 24.175 29.049999999999997 10-11 28.537499999999998 24.825 19.950000000000003 26.687499999999996 12-13 28.075 21.637500000000003 22.7625 27.525 14-15 27.037499999999998 23.65 23.4875 25.825 16-17 28.0875 24.212500000000002 22.25 25.45 18-19 27.712500000000002 23.8625 22.662499999999998 25.7625 20-21 26.674999999999997 24.0125 23.1875 26.125 22-23 27.1 23.6375 22.7125 26.55 24-25 26.887499999999996 23.724999999999998 23.3 26.087500000000002 26-27 27.2625 24.349999999999998 22.025 26.3625 28-29 27.712500000000002 24.175 22.287499999999998 25.825 30-31 27.55 23.7375 22.775000000000002 25.937500000000004 32-33 27.0 23.4375 22.45 27.1125 34-35 27.1 23.4625 23.0125 26.424999999999997 36-37 26.5 23.974999999999998 22.3375 27.187499999999996 38-39 26.7125 23.8875 23.6875 25.7125 40-41 27.0 24.0125 22.5125 26.474999999999998 42-43 27.05 23.9125 23.5 25.5375 44-45 27.0 24.025 22.9375 26.0375 46-47 27.725 24.4 22.1 25.775 48-49 26.7625 23.8375 23.575 25.825 50-51 26.3 24.349999999999998 22.85 26.5 52-53 27.712500000000002 23.3375 22.7375 26.2125 54-55 27.375 23.8625 23.0 25.7625 56-57 26.974999999999998 24.5625 22.8625 25.6 58-59 26.875 23.925 22.7 26.5 60-61 27.3375 24.0375 23.599999999999998 25.025 62-63 26.337500000000002 25.0375 23.45 25.174999999999997 64-65 26.5875 23.5375 23.625 26.25 66-67 26.3125 24.075 23.5375 26.075 68-69 27.1625 24.1375 23.2375 25.4625 70-71 26.924999999999997 23.775 23.724999999999998 25.575 72-73 26.325 23.9875 24.0 25.687500000000004 74-75 27.650000000000002 23.9375 23.549999999999997 24.8625 76-77 28.4375 24.474999999999998 22.325 24.762500000000003 78-79 28.212500000000002 22.9875 22.925 25.874999999999996 80 27.125 23.775 22.400000000000002 26.700000000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 1.5 28 2.5 29 1.5 30 1.0 31 4.5 32 6.0 33 10.5 34 23.0 35 29.0 36 35.5 37 44.5 38 49.5 39 80.0 40 108.0 41 126.5 42 150.0 43 163.0 44 174.0 45 177.0 46 193.5 47 214.5 48 194.5 49 189.0 50 208.0 51 191.5 52 178.0 53 164.0 54 150.0 55 153.0 56 159.0 57 157.0 58 134.5 59 124.5 60 129.0 61 124.5 62 131.5 63 138.5 64 125.5 65 117.0 66 107.0 67 93.0 68 89.5 69 75.5 70 61.0 71 57.0 72 46.5 73 34.5 74 23.0 75 17.0 76 11.5 77 7.5 78 6.0 79 1.5 80 0.0 81 0.5 82 0.5 83 0.5 84 0.5 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 1.0 96 0.5 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.025 4 0.025 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 80 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69902182091799 99.375 2 0.27589666415851516 0.5499999999999999 3 0.025081514923501375 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.025 0.0 0.0 18 0.0 0.0 0.025 0.0 0.0 19 0.0 0.0 0.025 0.0 0.0 20 0.0 0.0 0.025 0.0 0.0 21 0.0 0.0 0.025 0.0 0.0 22 0.0 0.0 0.025 0.0 0.0 23 0.0 0.0 0.025 0.0 0.0 24 0.0 0.0 0.025 0.0 0.0 25 0.0 0.0 0.025 0.0 0.0 26 0.0 0.0 0.025 0.0 0.0 27 0.0 0.0 0.025 0.0 0.0 28 0.0 0.0 0.025 0.0 0.0 29 0.0 0.0 0.025 0.0 0.0 30 0.0 0.0 0.025 0.0 0.0 31 0.0 0.0 0.025 0.0 0.0 32 0.0 0.0 0.025 0.0 0.0 33 0.0 0.0 0.025 0.0 0.0 34 0.0 0.0 0.025 0.0 0.0 35 0.0 0.0 0.025 0.0 0.0 36 0.0 0.0 0.025 0.0 0.0 37 0.0 0.0 0.025 0.0 0.0 38 0.0 0.0 0.025 0.0 0.0 39 0.0 0.0 0.025 0.0 0.0 40 0.0 0.0 0.025 0.0 0.0 41 0.0 0.0 0.025 0.0 0.0 42 0.0 0.0 0.025 0.0 0.0 43 0.0 0.0 0.025 0.0 0.0 44 0.0 0.0 0.025 0.0 0.0 45 0.0 0.0 0.025 0.0 0.0 46 0.0 0.0 0.025 0.0 0.0 47 0.0 0.0 0.025 0.0 0.0 48 0.0 0.0 0.025 0.0 0.0 49 0.0 0.0 0.025 0.0 0.0 50 0.0 0.0 0.025 0.0 0.0 51 0.0 0.0 0.025 0.0 0.0 52 0.0 0.0 0.025 0.0 0.0 53 0.0 0.0 0.025 0.0 0.0 54 0.0 0.0 0.025 0.0 0.0 55 0.0 0.0 0.025 0.0 0.0 56 0.0 0.0 0.025 0.0 0.0 57 0.0 0.0 0.025 0.0 0.0 58 0.0 0.0 0.025 0.0 0.0 59 0.0 0.0 0.025 0.0 0.0 60 0.0 0.0 0.025 0.0 0.0 61 0.0 0.0 0.025 0.0 0.0 62 0.0 0.0 0.025 0.0 0.0 63 0.0 0.0 0.025 0.0 0.0 64 0.0 0.0 0.025 0.0 0.0 65 0.0 0.0 0.025 0.0 0.0 66 0.025 0.0 0.025 0.0 0.0 67 0.05 0.0 0.025 0.0 0.0 68 0.075 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1525697 spots for SRR12711890.sra Written 1525697 spots for SRR12711890.sra Read 1525697 spots for SRR12711890.sra Written 1525697 spots for SRR12711890.sra Read 1525697 spots for SRR12711890.sra Written 1525697 spots for SRR12711890.sra Read 1525697 spots for SRR12711890.sra Written 1525697 spots for SRR12711890.sra Read 1525697 spots for SRR12711890.sra Written 1525697 spots for SRR12711890.sra Read 1525697 spots for SRR12711890.sra Written 1525697 spots for SRR12711890.sra Read 1525697 spots for SRR12711890.sra Written 1525697 spots for SRR12711890.sra Read 1525697 spots for SRR12711890.sra Written 1525697 spots for SRR12711890.sra Read 1525697 spots for SRR12711890.sra Written 1525697 spots for SRR12711890.sra Read 1525697 spots for SRR12711890.sra Written 1525697 spots for SRR12711890.sra Read 1525697 spots for SRR12711890.sra Written 1525697 spots for SRR12711890.sra Read 1525697 spots for SRR12711890.sra Written 1525697 spots for SRR12711890.sra Read 1525697 spots for SRR12711890.sra Written 1525697 spots for SRR12711890.sra Read 1525697 spots for SRR12711890.sra Written 1525697 spots for SRR12711890.sra Read 1525697 spots for SRR12711890.sra Written 1525697 spots for SRR12711890.sra Read 1525697 spots for SRR12711890.sra Written 1525697 spots for SRR12711890.sra Read 1525703 spots for SRR12711890.sra Written 1525703 spots for SRR12711890.sra Read 1525697 spots for SRR12711890.sra Written 1525697 spots for SRR12711890.sra Read 1525697 spots for SRR12711890.sra Written 1525697 spots for SRR12711890.sra Read 1525697 spots for SRR12711890.sra Written 1525697 spots for SRR12711890.sra SRR ids: ['SRR12711890.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rj734xy3 SRR12711890.sra spots: 30513946 blocks: [[1, 1525697], [1525698, 3051394], [3051395, 4577091], [4577092, 6102788], [6102789, 7628485], [7628486, 9154182], [9154183, 10679879], [10679880, 12205576], [12205577, 13731273], [13731274, 15256970], [15256971, 16782667], [16782668, 18308364], [18308365, 19834061], [19834062, 21359758], [21359759, 22885455], [22885456, 24411152], [24411153, 25936849], [25936850, 27462546], [27462547, 28988243], [28988244, 30513946]] SRR12711890 file size 6087048 SRR12711890 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12711890 SRR12711890_1.fastq SRR12711890_2.fastq Input file: SRR12711890_1.fastq Paired file: SRR12711890_2.fastq trimmed: SRR12711890-trimmed-pair1.fastq, SRR12711890-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 18:24:08 2024 >> started Sat Dec 7 18:24:36 2024 >> done (28.549s) 30513946 read pairs processed; of these: 1556 ( 0.01%) short read pairs filtered out after trimming by size control 9824 ( 0.03%) empty read pairs filtered out after trimming by size control 30502566 (99.96%) read pairs available; of these: 196055 ( 0.64%) trimmed read pairs available after processing 30306511 (99.36%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 7 0.00% 20 6 0.00% 21 6 0.00% 22 8 0.00% 23 6 0.00% 24 7 0.00% 25 5 0.00% 26 16 0.00% 27 14 0.00% 28 27 0.00% 29 35 0.00% 30 54 0.00% 31 64 0.00% 32 76 0.00% 33 58 0.00% 34 82 0.00% 35 93 0.00% 36 83 0.00% 37 101 0.00% 38 124 0.00% 39 186 0.00% 40 186 0.00% 41 206 0.00% 42 232 0.00% 43 247 0.00% 44 274 0.00% 45 355 0.00% 46 397 0.00% 47 424 0.00% 48 438 0.00% 49 1285 0.00% 50 1075 0.00% 51 1608 0.01% 52 1600 0.01% 53 1271 0.00% 54 2221 0.01% 55 1436 0.00% 56 2406 0.01% 57 2123 0.01% 58 3025 0.01% 59 2889 0.01% 60 3067 0.01% 61 3876 0.01% 62 3328 0.01% 63 4689 0.02% 64 3895 0.01% 65 5111 0.02% 66 4576 0.02% 67 5549 0.02% 68 5044 0.02% 69 6720 0.02% 70 7085 0.02% 71 8617 0.03% 72 9458 0.03% 73 11049 0.04% 74 12639 0.04% 75 12705 0.04% 76 13083 0.04% 77 14958 0.05% 78 16850 0.06% 79 18992 0.06% 80 30306511 99.36% 30502566 reads passed initial QC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.56 fanout-score-rank=21 prefix-density=0.38 prefix-fanout=2.5 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=14.88 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=2.5 sequence=GCCGGGAACGATTCCCTGCTCGACAAGGATGTCAACAATCTTCTTGCCATCAACAGTCGATTGGTAGAGGGTCTCCTCGAAGAGGATAGCACCAGAGATGTAATTTCCCAGGCCTGGTGGAGTGACAAGGAGGGTACGGTAAGCCTGGCGGTTAGCCTCAGTGTTCTCAAGGCCAATCGAGTCAAGTCTCTTTCCACAGGTAGCATTGGACTCATCCATGGCTAGGATGCCCCTTCCTGGTGATGCGATGGTTTTCGCGGTCTTGACAAGTTCATCAGCGTATGCGCTGGCACGGACAACCATGGAGACGGTCATCTGCTTGGGAGTGGCAGCCTGGCGGGTGGTGCCCCATTCGGACTTCTTGGGAAGGAAAGACGATTTGAGGATAGTAGCCGAGGCCATTGTTTCTGGCTCCAAAGGCAAGAGGATCAGG criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=4.17 fanout-score-rank=12 prefix-density=0.33 prefix-fanout=3.6 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.11 sequence-density-rank=22 fanout-score=139.20 fanout-score-rank=1 prefix-density=0.74 prefix-fanout=20.2 sequence=CGCCGCCGCCGC SRR12711890 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 18:25:10 Started mapping on | Dec 07 18:25:10 Finished on | Dec 07 18:26:16 Mapping speed, Million of reads per hour | 1663.78 Number of input reads | 30502566 Average input read length | 159 UNIQUE READS: Uniquely mapped reads number | 28459036 Uniquely mapped reads % | 93.30% Average mapped length | 159.51 Number of splices: Total | 14788275 Number of splices: Annotated (sjdb) | 14078358 Number of splices: GT/AG | 14596224 Number of splices: GC/AG | 172182 Number of splices: AT/AC | 6925 Number of splices: Non-canonical | 12944 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 1.94 Insertion rate per base | 0.01% Insertion average length | 1.73 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 665113 % of reads mapped to multiple loci | 2.18% Number of reads mapped to too many loci | 296578 % of reads mapped to too many loci | 0.97% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.12% % of reads unmapped: other | 2.42% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1378902 1378902 1378902 N_multimapping 665113 665113 665113 N_noFeature 703624 27746058 927988 N_ambiguous 555809 2730 67830 UnstrandedReadsAssigned:27199603 PositiveStrandReadsAssigned:710248 NegativeStrandReadsAssigned:27463218 Dataset is classified negative stranded MeadianReadLen=80 20thPercentileLength=80 echo kmer=75 SRR12711890 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12711890-trimmed-pair1.fastq SRR12711890-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,502,566 reads, 27,780,803 reads pseudoaligned [quant] estimated average fragment length: 155.7 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,210 rounds 52973 SRR12711890.ke.tsv 35125 SRR12711890.se.tsv 88098 total ==> SRR12711890.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 781.422 121.662 7.8709 PNS24247 1044 889.3 20.7759 1.18105 PNS24249 1928 1773.3 128.901 3.67477 PNS24246 1044 889.3 20.7759 1.18105 PNS24248 1044 889.3 20.7759 1.18105 PNS24244 1471 1316.3 141.109 5.41947 PNS24243 293 141.332 0 0 KQK14069 1603 1448.3 363.867 12.7011 KQK14071 474 320.501 3.8487 0.607074 ==> SRR12711890.se.tsv <== BRADI_1g14170v3 397 BRADI_1g53295v3 37 BRADI_1g59795v3 320 BRADI_1g07683v3 0 BRADI_1g00485v3 62 BRADI_1g20270v3 4150 BRADI_1g74790v3 549 BRADI_1g09890v3 10 BRADI_1g77505v3 479 BRADI_1g48960v3 1 SRR12711890 completed mapping pipeline successfully