Starting /dee2/code/volunteer_pipeline.sh SRR12711891 current disk space = 1540667809792 free memory = 1602334808 SRR12711891 SRAfilesize 6a4766d3641fcfde4e4f524b8adc6dfb SRR12711891.sra SRR12711891.sra file validated SRR12711891 is paired end SRR12711891 is conventional basespace SRR12711891 read1 length is 80 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12711891_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 80 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.885 38.0 38.0 38.0 32.0 38.0 2 36.8175 38.0 38.0 38.0 32.0 38.0 3 36.73725 38.0 38.0 38.0 32.0 38.0 4 36.698 38.0 38.0 38.0 32.0 38.0 5 36.65225 38.0 38.0 38.0 32.0 38.0 6 38.736 40.0 38.0 40.0 38.0 40.0 7 38.6735 40.0 38.0 40.0 38.0 40.0 8 38.7305 40.0 38.0 40.0 38.0 40.0 9 38.73575 40.0 38.0 40.0 38.0 40.0 10-11 38.774875 40.0 38.0 40.0 38.0 40.0 12-13 38.79875 40.0 38.0 40.0 38.0 40.0 14-15 38.565375 40.0 38.0 40.0 38.0 40.0 16-17 38.62475 40.0 38.0 40.0 38.0 40.0 18-19 38.747625 40.0 38.0 40.0 38.0 40.0 20-21 38.805875 40.0 38.0 40.0 38.0 40.0 22-23 38.78125 40.0 38.0 40.0 38.0 40.0 24-25 38.671125 40.0 38.0 40.0 38.0 40.0 26-27 38.7405 40.0 38.0 40.0 38.0 40.0 28-29 38.746875 40.0 38.0 40.0 38.0 40.0 30-31 38.687625 40.0 38.0 40.0 38.0 40.0 32-33 38.62825 40.0 38.0 40.0 38.0 40.0 34-35 38.713499999999996 40.0 38.0 40.0 38.0 40.0 36-37 38.65837500000001 40.0 38.0 40.0 38.0 40.0 38-39 38.566375 40.0 38.0 40.0 38.0 40.0 40-41 38.559875000000005 40.0 38.0 40.0 38.0 40.0 42-43 38.632000000000005 40.0 38.0 40.0 38.0 40.0 44-45 38.517250000000004 40.0 38.0 40.0 38.0 40.0 46-47 38.516625000000005 40.0 38.0 40.0 38.0 40.0 48-49 38.563125 40.0 38.0 40.0 38.0 40.0 50-51 38.516999999999996 40.0 38.0 40.0 38.0 40.0 52-53 38.474500000000006 40.0 38.0 40.0 38.0 40.0 54-55 38.462625 40.0 38.0 40.0 38.0 40.0 56-57 38.358374999999995 40.0 38.0 40.0 38.0 40.0 58-59 38.458875 40.0 38.0 40.0 38.0 40.0 60-61 38.39575 40.0 38.0 40.0 38.0 40.0 62-63 38.38225 40.0 38.0 40.0 38.0 40.0 64-65 38.43825 40.0 38.0 40.0 38.0 40.0 66-67 38.45675 40.0 38.0 40.0 38.0 40.0 68-69 38.441125 40.0 38.0 40.0 38.0 40.0 70-71 38.401624999999996 40.0 38.0 40.0 38.0 40.0 72-73 38.38775 40.0 38.0 40.0 38.0 40.0 74-75 38.369375000000005 40.0 38.0 40.0 38.0 40.0 76-77 38.29275 40.0 38.0 40.0 38.0 40.0 78-79 38.350375 40.0 38.0 40.0 38.0 40.0 80 37.444 38.0 38.0 40.0 32.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 3.0 25 2.0 26 9.0 27 8.0 28 17.0 29 18.0 30 39.0 31 38.0 32 56.0 33 65.0 34 84.0 35 101.0 36 152.0 37 249.0 38 559.0 39 2599.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.800000000000004 14.45 7.5 32.25 2 29.155176736024067 15.342191025319629 27.801453998495862 27.70117824016044 3 24.8 20.075000000000003 21.95 33.175 4 27.275 24.875 21.575 26.275 5 27.425 27.400000000000002 20.95 24.224999999999998 6 25.324999999999996 29.625 22.175 22.875 7 20.175 21.575 36.95 21.3 8 21.675 22.35 26.900000000000002 29.075 9 22.650000000000002 21.575 30.175 25.6 10-11 25.2 27.037499999999998 22.0125 25.75 12-13 25.3125 22.4625 25.074999999999996 27.150000000000002 14-15 24.175 23.925 25.137500000000003 26.7625 16-17 25.162499999999998 23.3 24.1375 27.400000000000002 18-19 25.1875 24.0 24.9375 25.874999999999996 20-21 24.962500000000002 24.125 24.025 26.887499999999996 22-23 25.424999999999997 24.637500000000003 23.5 26.437500000000004 24-25 24.975 24.2875 23.549999999999997 27.187499999999996 26-27 24.625 24.1875 24.2875 26.900000000000002 28-29 25.837500000000002 24.55 23.400000000000002 26.2125 30-31 24.825 24.0625 24.025 27.0875 32-33 25.25 23.599999999999998 24.325 26.825 34-35 25.162499999999998 23.599999999999998 24.45 26.787499999999998 36-37 24.975 23.275000000000002 24.525 27.224999999999998 38-39 25.337500000000002 23.5 23.674999999999997 27.487499999999997 40-41 25.4 24.0375 23.65 26.9125 42-43 24.5 23.1 24.637500000000003 27.762500000000003 44-45 24.95 24.25 24.175 26.625 46-47 25.55 23.1125 24.075 27.2625 48-49 25.525 23.225 24.625 26.625 50-51 25.4 23.5375 23.599999999999998 27.462500000000002 52-53 25.937500000000004 23.125 23.525 27.4125 54-55 25.6 23.875 23.1625 27.3625 56-57 25.275 23.45 24.5625 26.7125 58-59 25.6125 24.5375 22.75 27.1 60-61 25.924999999999997 23.0875 23.75 27.237499999999997 62-63 25.724999999999998 23.2625 23.95 27.0625 64-65 25.525 23.5125 24.325 26.637499999999996 66-67 25.1875 23.325000000000003 23.849999999999998 27.6375 68-69 25.7375 23.0125 23.625 27.625 70-71 25.8 23.2375 24.05 26.9125 72-73 25.887500000000003 23.5875 23.5 27.025 74-75 25.937500000000004 23.0125 24.0625 26.987499999999997 76-77 26.5 23.325000000000003 22.75 27.425 78-79 24.7875 24.099999999999998 23.6125 27.500000000000004 80 26.125 24.55 22.925 26.400000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.5 25 2.0 26 2.5 27 2.0 28 3.0 29 7.5 30 10.0 31 12.5 32 15.5 33 20.5 34 38.0 35 51.0 36 57.5 37 61.5 38 78.0 39 100.0 40 103.0 41 126.5 42 165.5 43 182.0 44 176.5 45 170.0 46 168.5 47 186.5 48 198.5 49 179.0 50 167.0 51 158.5 52 145.0 53 150.5 54 151.0 55 141.0 56 148.5 57 149.5 58 148.5 59 146.5 60 139.0 61 139.0 62 134.5 63 123.5 64 104.5 65 92.0 66 92.0 67 89.5 68 75.0 69 59.0 70 55.0 71 52.5 72 46.5 73 37.5 74 27.0 75 22.0 76 18.5 77 9.0 78 3.5 79 4.0 80 4.0 81 2.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.27499999999999997 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 80 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29506545820746 98.6 2 0.7049345417925479 1.4000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.05 0.0 0.0 0.0 0.0 64 0.05 0.0 0.0 0.0 0.0 65 0.075 0.0 0.0 0.0 0.0 66 0.075 0.0 0.0 0.0 0.0 67 0.075 0.0 0.0 0.0 0.0 68 0.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12711891 read2 length is 80 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12711891_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 80 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.47 38.0 38.0 38.0 32.0 38.0 2 36.30075 38.0 38.0 38.0 32.0 38.0 3 36.49425 38.0 38.0 38.0 32.0 38.0 4 36.422 38.0 38.0 38.0 32.0 38.0 5 36.4535 38.0 38.0 38.0 32.0 38.0 6 38.32475 40.0 38.0 40.0 38.0 40.0 7 38.48 40.0 38.0 40.0 38.0 40.0 8 38.552 40.0 38.0 40.0 38.0 40.0 9 38.5785 40.0 38.0 40.0 38.0 40.0 10-11 38.570625 40.0 38.0 40.0 38.0 40.0 12-13 38.525125 40.0 38.0 40.0 38.0 40.0 14-15 38.44575 40.0 38.0 40.0 38.0 40.0 16-17 38.450874999999996 40.0 38.0 40.0 38.0 40.0 18-19 38.5265 40.0 38.0 40.0 38.0 40.0 20-21 38.459375 40.0 38.0 40.0 38.0 40.0 22-23 38.5275 40.0 38.0 40.0 38.0 40.0 24-25 38.383875 40.0 38.0 40.0 38.0 40.0 26-27 38.458375000000004 40.0 38.0 40.0 38.0 40.0 28-29 38.471875 40.0 38.0 40.0 38.0 40.0 30-31 38.49025 40.0 38.0 40.0 38.0 40.0 32-33 38.451750000000004 40.0 38.0 40.0 38.0 40.0 34-35 38.391625 40.0 38.0 40.0 38.0 40.0 36-37 38.32299999999999 40.0 38.0 40.0 38.0 40.0 38-39 38.402875 40.0 38.0 40.0 38.0 40.0 40-41 38.45275 40.0 38.0 40.0 38.0 40.0 42-43 38.312 40.0 38.0 40.0 38.0 40.0 44-45 38.242875 40.0 38.0 40.0 38.0 40.0 46-47 38.17125 40.0 38.0 40.0 38.0 40.0 48-49 38.255625 40.0 38.0 40.0 38.0 40.0 50-51 38.134125 40.0 38.0 40.0 38.0 40.0 52-53 38.151125 40.0 38.0 40.0 38.0 40.0 54-55 38.1805 40.0 38.0 40.0 38.0 40.0 56-57 38.18775 40.0 38.0 40.0 38.0 40.0 58-59 38.15875 40.0 38.0 40.0 38.0 40.0 60-61 38.117625000000004 40.0 38.0 40.0 38.0 40.0 62-63 38.167625 40.0 38.0 40.0 38.0 40.0 64-65 38.106 40.0 38.0 40.0 38.0 40.0 66-67 38.072625 40.0 38.0 40.0 38.0 40.0 68-69 37.926375 40.0 38.0 40.0 38.0 40.0 70-71 37.811875 40.0 38.0 40.0 35.0 40.0 72-73 37.812124999999995 40.0 38.0 40.0 35.0 40.0 74-75 37.900125 40.0 38.0 40.0 38.0 40.0 76-77 37.8965 40.0 38.0 40.0 35.0 40.0 78-79 37.714124999999996 39.0 38.0 40.0 32.0 40.0 80 35.89425 38.0 38.0 40.0 32.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 1.0 17 2.0 18 2.0 19 2.0 20 3.0 21 2.0 22 2.0 23 6.0 24 4.0 25 11.0 26 20.0 27 20.0 28 31.0 29 33.0 30 27.0 31 31.0 32 59.0 33 46.0 34 73.0 35 134.0 36 174.0 37 252.0 38 670.0 39 2394.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.325 20.025000000000002 10.674999999999999 28.975 2 30.875000000000004 24.25 24.6 20.275000000000002 3 23.849999999999998 25.6 25.324999999999996 25.224999999999998 4 27.6 29.325000000000003 19.875 23.200000000000003 5 28.725 30.85 18.0 22.425 6 26.35 31.724999999999998 18.05 23.875 7 25.974999999999998 18.05 31.25 24.725 8 26.950000000000003 21.925 19.85 31.275 9 24.075 22.0 23.825 30.099999999999998 10-11 28.449999999999996 24.962500000000002 20.1625 26.424999999999997 12-13 27.025 22.5 23.1625 27.3125 14-15 27.200000000000003 24.1625 22.1375 26.5 16-17 27.474999999999998 23.5625 21.925 27.037499999999998 18-19 26.987499999999997 23.925 22.625 26.4625 20-21 27.275 23.9125 21.987499999999997 26.825 22-23 27.500000000000004 23.962500000000002 22.075 26.4625 24-25 27.650000000000002 23.4375 22.787499999999998 26.125 26-27 27.1625 23.7125 22.95 26.174999999999997 28-29 26.6625 23.8375 22.275 27.224999999999998 30-31 27.9375 23.7 22.35 26.0125 32-33 27.575 24.2875 22.3875 25.75 34-35 27.6375 23.4625 21.912499999999998 26.987499999999997 36-37 26.9625 24.0625 22.537499999999998 26.437500000000004 38-39 27.85 23.7375 22.15 26.2625 40-41 27.3625 23.8375 22.4375 26.3625 42-43 27.212500000000002 23.0125 23.3625 26.4125 44-45 27.6 24.2875 21.9625 26.150000000000002 46-47 27.6125 23.799999999999997 22.037499999999998 26.55 48-49 26.625 24.525 22.15 26.700000000000003 50-51 28.1625 22.8875 22.875 26.075 52-53 26.950000000000003 23.7125 22.8 26.5375 54-55 26.55 23.8125 23.35 26.2875 56-57 26.674999999999997 24.5625 22.787499999999998 25.974999999999998 58-59 27.6375 24.0625 22.7625 25.5375 60-61 27.1 23.3875 23.2875 26.224999999999998 62-63 27.650000000000002 23.7125 22.900000000000002 25.7375 64-65 27.700000000000003 23.9375 22.912499999999998 25.45 66-67 26.924999999999997 23.6375 22.95 26.487500000000004 68-69 27.925 24.0125 22.05 26.0125 70-71 27.950000000000003 23.6375 22.55 25.8625 72-73 27.0625 24.15 23.6625 25.124999999999996 74-75 27.725 24.0 22.4875 25.7875 76-77 27.474999999999998 23.6875 22.1375 26.700000000000003 78-79 26.25 24.1625 22.8625 26.724999999999998 80 27.1 24.474999999999998 22.6 25.825 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 1.0 27 1.5 28 3.5 29 4.0 30 3.0 31 4.0 32 7.0 33 14.5 34 18.5 35 17.0 36 28.0 37 47.0 38 65.0 39 90.0 40 105.0 41 110.5 42 130.0 43 161.0 44 180.0 45 182.0 46 192.0 47 188.5 48 180.5 49 174.0 50 162.0 51 179.0 52 175.0 53 149.5 54 154.0 55 163.0 56 160.5 57 142.5 58 144.0 59 159.0 60 157.0 61 147.0 62 136.5 63 128.5 64 120.0 65 119.0 66 117.0 67 103.5 68 84.5 69 68.0 70 59.0 71 50.5 72 50.0 73 48.0 74 31.5 75 25.0 76 23.5 77 15.5 78 7.0 79 2.5 80 0.0 81 0.0 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 80 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44681921046015 98.875 2 0.5280362081971335 1.05 3 0.025144581342720643 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.05 0.0 0.0 0.0 0.0 64 0.05 0.0 0.0 0.0 0.0 65 0.075 0.0 0.0 0.0 0.0 66 0.075 0.0 0.0 0.0 0.0 67 0.075 0.0 0.0 0.0 0.0 68 0.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1324441 spots for SRR12711891.sra Written 1324441 spots for SRR12711891.sra Read 1324441 spots for SRR12711891.sra Written 1324441 spots for SRR12711891.sra Read 1324441 spots for SRR12711891.sra Written 1324441 spots for SRR12711891.sra Read 1324441 spots for SRR12711891.sra Written 1324441 spots for SRR12711891.sra Read 1324441 spots for SRR12711891.sra Written 1324441 spots for SRR12711891.sra Read 1324441 spots for SRR12711891.sra Written 1324441 spots for SRR12711891.sra Read 1324441 spots for SRR12711891.sra Written 1324441 spots for SRR12711891.sra Read 1324441 spots for SRR12711891.sra Written 1324441 spots for SRR12711891.sra Read 1324441 spots for SRR12711891.sra Written 1324441 spots for SRR12711891.sra Read 1324441 spots for SRR12711891.sra Written 1324441 spots for SRR12711891.sra Read 1324441 spots for SRR12711891.sra Written 1324441 spots for SRR12711891.sra Read 1324441 spots for SRR12711891.sra Written 1324441 spots for SRR12711891.sra Read 1324441 spots for SRR12711891.sra Written 1324441 spots for SRR12711891.sra Read 1324441 spots for SRR12711891.sra Written 1324441 spots for SRR12711891.sra Read 1324441 spots for SRR12711891.sra Written 1324441 spots for SRR12711891.sra Read 1324441 spots for SRR12711891.sra Written 1324441 spots for SRR12711891.sra Read 1324441 spots for SRR12711891.sra Written 1324441 spots for SRR12711891.sra Read 1324458 spots for SRR12711891.sra Written 1324458 spots for SRR12711891.sra Read 1324441 spots for SRR12711891.sra Written 1324441 spots for SRR12711891.sra Read 1324441 spots for SRR12711891.sra Written 1324441 spots for SRR12711891.sra SRR ids: ['SRR12711891.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nifwx73_ SRR12711891.sra spots: 26488837 blocks: [[1, 1324441], [1324442, 2648882], [2648883, 3973323], [3973324, 5297764], [5297765, 6622205], [6622206, 7946646], [7946647, 9271087], [9271088, 10595528], [10595529, 11919969], [11919970, 13244410], [13244411, 14568851], [14568852, 15893292], [15893293, 17217733], [17217734, 18542174], [18542175, 19866615], [19866616, 21191056], [21191057, 22515497], [22515498, 23839938], [23839939, 25164379], [25164380, 26488837]] SRR12711891 file size 5281240 SRR12711891 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12711891 SRR12711891_1.fastq SRR12711891_2.fastq Input file: SRR12711891_1.fastq Paired file: SRR12711891_2.fastq trimmed: SRR12711891-trimmed-pair1.fastq, SRR12711891-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 18:23:05 2024 >> started Sat Dec 7 18:23:28 2024 >> done (23.100s) 26488837 read pairs processed; of these: 1486 ( 0.01%) short read pairs filtered out after trimming by size control 12082 ( 0.05%) empty read pairs filtered out after trimming by size control 26475269 (99.95%) read pairs available; of these: 174543 ( 0.66%) trimmed read pairs available after processing 26300726 (99.34%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 4 0.00% 20 6 0.00% 21 8 0.00% 22 6 0.00% 23 9 0.00% 24 13 0.00% 25 16 0.00% 26 16 0.00% 27 25 0.00% 28 36 0.00% 29 45 0.00% 30 44 0.00% 31 65 0.00% 32 74 0.00% 33 80 0.00% 34 85 0.00% 35 87 0.00% 36 111 0.00% 37 141 0.00% 38 148 0.00% 39 160 0.00% 40 206 0.00% 41 233 0.00% 42 265 0.00% 43 268 0.00% 44 331 0.00% 45 356 0.00% 46 370 0.00% 47 428 0.00% 48 519 0.00% 49 1209 0.00% 50 1174 0.00% 51 1618 0.01% 52 1518 0.01% 53 1315 0.00% 54 2105 0.01% 55 1421 0.01% 56 2107 0.01% 57 2137 0.01% 58 2752 0.01% 59 2634 0.01% 60 2973 0.01% 61 3484 0.01% 62 3108 0.01% 63 4276 0.02% 64 3631 0.01% 65 4513 0.02% 66 4305 0.02% 67 5100 0.02% 68 4748 0.02% 69 6272 0.02% 70 6541 0.02% 71 7749 0.03% 72 8049 0.03% 73 9518 0.04% 74 10809 0.04% 75 10911 0.04% 76 11428 0.04% 77 12476 0.05% 78 14376 0.05% 79 16127 0.06% 80 26300726 99.34% 26475269 reads passed initial QC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.52 fanout-score-rank=21 prefix-density=0.44 prefix-fanout=2.5 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.07 sequence-density-rank=31 fanout-score=10.83 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=4.6 sequence=GGCGGCGGTGGCGACGACGAGGAGGCTGGAGGTCTGGACCTCGGCTTCAGGGTACATGTTGCAGCCGTTGCAGCCGCTGCCGCACTTGCAGGATGACCCGCAGTTGCAGTTTCCTCCGCAGCAAGACATCTTCGGTCGAGTGCTCGAACTTG criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=25 prefix-density=0.38 prefix-fanout=2.2 sequence=GTGCAGTGCATCAGCTTCATCGCCTTCAAGCCACCGGGTTGTGAGGAGTCCGGCAAGGCCTAAGCAAGT criterion=fanout-score sequence-density=0.12 sequence-density-rank=24 fanout-score=136.51 fanout-score-rank=1 prefix-density=0.85 prefix-fanout=20.0 sequence=CGCCGCCGCCGC SRR12711891 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 18:24:00 Started mapping on | Dec 07 18:24:00 Finished on | Dec 07 18:24:52 Mapping speed, Million of reads per hour | 1832.90 Number of input reads | 26475269 Average input read length | 159 UNIQUE READS: Uniquely mapped reads number | 24734238 Uniquely mapped reads % | 93.42% Average mapped length | 159.49 Number of splices: Total | 12540344 Number of splices: Annotated (sjdb) | 11943456 Number of splices: GT/AG | 12382333 Number of splices: GC/AG | 141111 Number of splices: AT/AC | 5665 Number of splices: Non-canonical | 11235 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 1.96 Insertion rate per base | 0.01% Insertion average length | 1.73 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 552921 % of reads mapped to multiple loci | 2.09% Number of reads mapped to too many loci | 237636 % of reads mapped to too many loci | 0.90% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.22% % of reads unmapped: other | 2.37% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1188571 1188571 1188571 N_multimapping 552921 552921 552921 N_noFeature 601713 24125484 793838 N_ambiguous 480224 2081 64470 UnstrandedReadsAssigned:23652301 PositiveStrandReadsAssigned:606673 NegativeStrandReadsAssigned:23875930 Dataset is classified negative stranded MeadianReadLen=80 20thPercentileLength=80 echo kmer=75 SRR12711891 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12711891-trimmed-pair1.fastq SRR12711891-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,475,269 reads, 24,106,171 reads pseudoaligned [quant] estimated average fragment length: 161.279 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,184 rounds 52973 SRR12711891.ke.tsv 35125 SRR12711891.se.tsv 88098 total ==> SRR12711891.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 775.852 0 0 PNS24247 1044 883.721 74.5875 4.76283 PNS24249 1928 1767.72 121.357 3.87403 PNS24246 1044 883.721 74.5875 4.76283 PNS24248 1044 883.721 74.5875 4.76283 PNS24244 1471 1310.72 93.8809 4.04186 PNS24243 293 136.889 0 0 KQK14069 1603 1442.72 1065.22 41.6649 KQK14071 474 315.023 25.5486 4.57655 ==> SRR12711891.se.tsv <== BRADI_1g14170v3 1116 BRADI_1g53295v3 17 BRADI_1g59795v3 222 BRADI_1g07683v3 0 BRADI_1g00485v3 54 BRADI_1g20270v3 3763 BRADI_1g74790v3 370 BRADI_1g09890v3 10 BRADI_1g77505v3 391 BRADI_1g48960v3 0 SRR12711891 completed mapping pipeline successfully