Starting /dee2/code/volunteer_pipeline.sh SRR12711892 current disk space = 1540597682176 free memory = 1595979776 SRR12711892 SRAfilesize 6f24a76f6191c552cbe703e9166f42aa SRR12711892.sra SRR12711892.sra file validated SRR12711892 is paired end SRR12711892 is conventional basespace SRR12711892 read1 length is 80 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12711892_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 80 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.7355 38.0 38.0 38.0 32.0 38.0 2 36.90925 38.0 38.0 38.0 32.0 38.0 3 36.518 38.0 38.0 38.0 32.0 38.0 4 36.81325 38.0 38.0 38.0 32.0 38.0 5 36.69225 38.0 38.0 38.0 32.0 38.0 6 38.71425 40.0 38.0 40.0 38.0 40.0 7 38.82275 40.0 38.0 40.0 38.0 40.0 8 38.9205 40.0 38.0 40.0 38.0 40.0 9 38.97025 40.0 38.0 40.0 38.0 40.0 10-11 38.88975 40.0 38.0 40.0 38.0 40.0 12-13 39.042 40.0 38.0 40.0 38.0 40.0 14-15 38.761 40.0 38.0 40.0 38.0 40.0 16-17 38.888 40.0 38.0 40.0 38.0 40.0 18-19 38.98375 40.0 38.0 40.0 38.0 40.0 20-21 38.918499999999995 40.0 38.0 40.0 38.0 40.0 22-23 38.880875 40.0 38.0 40.0 38.0 40.0 24-25 38.872 40.0 38.0 40.0 38.0 40.0 26-27 38.5695 40.0 38.0 40.0 38.0 40.0 28-29 38.7175 40.0 38.0 40.0 38.0 40.0 30-31 38.836625 40.0 38.0 40.0 38.0 40.0 32-33 38.802125000000004 40.0 38.0 40.0 38.0 40.0 34-35 38.47525 40.0 38.0 40.0 38.0 40.0 36-37 38.799625 40.0 38.0 40.0 38.0 40.0 38-39 38.712 40.0 38.0 40.0 38.0 40.0 40-41 38.798625 40.0 38.0 40.0 38.0 40.0 42-43 38.848625 40.0 38.0 40.0 38.0 40.0 44-45 38.562 40.0 38.0 40.0 38.0 40.0 46-47 38.7745 40.0 38.0 40.0 38.0 40.0 48-49 38.639375 40.0 38.0 40.0 38.0 40.0 50-51 38.67575 40.0 38.0 40.0 38.0 40.0 52-53 38.612 40.0 38.0 40.0 38.0 40.0 54-55 38.550875000000005 40.0 38.0 40.0 38.0 40.0 56-57 38.53037500000001 40.0 38.0 40.0 38.0 40.0 58-59 38.528875 40.0 38.0 40.0 38.0 40.0 60-61 38.69325 40.0 38.0 40.0 38.0 40.0 62-63 38.530375 40.0 38.0 40.0 38.0 40.0 64-65 38.591 40.0 38.0 40.0 38.0 40.0 66-67 38.430625 40.0 38.0 40.0 38.0 40.0 68-69 38.132125 40.0 38.0 40.0 38.0 40.0 70-71 38.566874999999996 40.0 38.0 40.0 38.0 40.0 72-73 37.94075 40.0 38.0 40.0 35.0 40.0 74-75 38.3335 40.0 38.0 40.0 38.0 40.0 76-77 38.489125 40.0 38.0 40.0 38.0 40.0 78-79 38.225624999999994 40.0 38.0 40.0 38.0 40.0 80 37.5975 38.0 38.0 40.0 32.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 3.0 25 11.0 26 5.0 27 11.0 28 15.0 29 21.0 30 23.0 31 38.0 32 57.0 33 54.0 34 61.0 35 110.0 36 152.0 37 247.0 38 502.0 39 2690.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.4 14.45 7.475 32.675 2 28.928928928928926 15.74074074074074 26.901901901901905 28.428428428428425 3 24.525 21.9 20.65 32.925 4 27.406851712928233 25.681420355088775 20.330082520630157 26.581645411352838 5 28.075 28.425 20.25 23.25 6 24.775 28.675 23.799999999999997 22.75 7 20.825 22.2 34.775 22.2 8 22.75 22.35 25.575 29.325000000000003 9 22.1 22.375 29.425 26.1 10-11 26.0125 27.450000000000003 21.05 25.4875 12-13 24.95 22.725 23.962500000000002 28.3625 14-15 25.7125 23.7 24.175 26.4125 16-17 25.3 24.8625 23.35 26.487500000000004 18-19 25.424999999999997 24.099999999999998 23.400000000000002 27.075 20-21 25.5375 23.4875 24.675 26.3 22-23 25.9875 24.1625 22.8875 26.9625 24-25 25.637500000000003 23.3625 23.150000000000002 27.85 26-27 24.462500000000002 23.8875 23.6625 27.987499999999997 28-29 26.275 24.1625 23.325000000000003 26.237500000000004 30-31 26.137500000000003 23.1625 24.462500000000002 26.237500000000004 32-33 26.087500000000002 23.6125 23.5875 26.7125 34-35 25.8125 23.825 23.674999999999997 26.687499999999996 36-37 26.637499999999996 22.4875 23.474999999999998 27.400000000000002 38-39 25.0375 23.3375 23.575 28.050000000000004 40-41 26.6625 22.95 23.2625 27.125 42-43 26.4625 22.725 23.9375 26.875 44-45 25.8 22.3 24.625 27.275 46-47 25.6 24.224999999999998 23.962500000000002 26.2125 48-49 26.237500000000004 23.5875 23.025000000000002 27.150000000000002 50-51 25.474999999999998 23.05 23.3625 28.1125 52-53 26.174999999999997 23.025000000000002 24.0375 26.7625 54-55 26.224999999999998 22.2125 24.25 27.3125 56-57 25.7375 23.474999999999998 23.724999999999998 27.0625 58-59 26.875 23.0375 23.75 26.337500000000002 60-61 26.35 22.6125 22.825 28.212500000000002 62-63 26.150000000000002 23.3625 22.8 27.6875 64-65 26.0375 23.6875 23.8875 26.387500000000003 66-67 26.0625 22.6875 23.45 27.800000000000004 68-69 25.474999999999998 23.150000000000002 24.0125 27.3625 70-71 27.150000000000002 22.8 23.674999999999997 26.375 72-73 27.00675168792198 22.88072018004501 22.43060765191298 27.68192048012003 74-75 26.674999999999997 22.0875 23.7125 27.525 76-77 26.650000000000002 23.1875 23.125 27.037499999999998 78-79 26.7625 22.6875 22.787499999999998 27.762500000000003 80 26.375 23.5 23.200000000000003 26.924999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 2.0 28 5.0 29 9.5 30 12.0 31 13.0 32 17.0 33 22.0 34 35.5 35 47.0 36 57.5 37 72.0 38 86.5 39 116.0 40 135.0 41 123.5 42 130.5 43 150.0 44 157.0 45 163.0 46 173.0 47 182.5 48 181.0 49 165.0 50 150.0 51 158.5 52 156.0 53 143.0 54 142.5 55 144.0 56 140.0 57 132.5 58 131.5 59 146.0 60 158.0 61 141.5 62 126.0 63 118.0 64 107.5 65 106.0 66 110.5 67 103.5 68 86.5 69 74.0 70 67.0 71 68.5 72 65.0 73 50.5 74 35.5 75 30.0 76 25.5 77 17.0 78 10.0 79 4.5 80 2.0 81 2.5 82 2.0 83 1.0 84 1.0 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.0 4 0.025 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.025 74-75 0.0 76-77 0.0 78-79 0.0 80 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 80 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21815889029004 98.35000000000001 2 0.7313997477931904 1.4500000000000002 3 0.025220680958385876 0.075 4 0.0 0.0 5 0.025220680958385876 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGC 5 0.125 TruSeq Adapter, Index 6 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 41 0.025 0.0 0.0 0.0 0.0 42 0.025 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.05 0.0 0.0 0.0 0.0 53 0.05 0.0 0.0 0.0 0.0 54 0.075 0.0 0.0 0.0 0.0 55 0.075 0.0 0.0 0.0 0.0 56 0.075 0.0 0.0 0.0 0.0 57 0.075 0.0 0.0 0.0 0.0 58 0.075 0.0 0.0 0.0 0.0 59 0.1 0.0 0.0 0.0 0.0 60 0.1 0.0 0.0 0.0 0.0 61 0.125 0.0 0.0 0.0 0.0 62 0.125 0.0 0.0 0.0 0.0 63 0.15 0.0 0.0 0.0 0.0 64 0.175 0.0 0.0 0.0 0.0 65 0.2 0.0 0.0 0.0 0.0 66 0.2 0.0 0.0 0.0 0.0 67 0.2 0.0 0.0 0.0 0.0 68 0.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12711892 read2 length is 80 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12711892_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 80 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.05 38.0 38.0 38.0 32.0 38.0 2 36.274 38.0 38.0 38.0 32.0 38.0 3 35.50075 38.0 32.0 38.0 32.0 38.0 4 36.31475 38.0 38.0 38.0 32.0 38.0 5 36.367 38.0 38.0 38.0 32.0 38.0 6 38.60475 40.0 38.0 40.0 38.0 40.0 7 38.491 40.0 38.0 40.0 38.0 40.0 8 38.52175 40.0 38.0 40.0 38.0 40.0 9 38.30325 40.0 38.0 40.0 38.0 40.0 10-11 38.208 40.0 38.0 40.0 35.0 40.0 12-13 38.283 40.0 38.0 40.0 38.0 40.0 14-15 38.426625 40.0 38.0 40.0 38.0 40.0 16-17 38.25125 40.0 38.0 40.0 38.0 40.0 18-19 38.36775 40.0 38.0 40.0 38.0 40.0 20-21 38.414500000000004 40.0 38.0 40.0 38.0 40.0 22-23 38.411874999999995 40.0 38.0 40.0 38.0 40.0 24-25 38.092625 40.0 38.0 40.0 38.0 40.0 26-27 38.27825 40.0 38.0 40.0 38.0 40.0 28-29 38.269000000000005 40.0 38.0 40.0 38.0 40.0 30-31 38.341625 40.0 38.0 40.0 38.0 40.0 32-33 38.32925 40.0 38.0 40.0 38.0 40.0 34-35 38.331625 40.0 38.0 40.0 38.0 40.0 36-37 38.27475 40.0 38.0 40.0 38.0 40.0 38-39 38.326499999999996 40.0 38.0 40.0 38.0 40.0 40-41 37.96962499999999 40.0 38.0 40.0 38.0 40.0 42-43 38.052499999999995 40.0 38.0 40.0 38.0 40.0 44-45 37.791624999999996 40.0 38.0 40.0 35.0 40.0 46-47 38.076499999999996 40.0 38.0 40.0 38.0 40.0 48-49 38.192375 40.0 38.0 40.0 38.0 40.0 50-51 38.275875 40.0 38.0 40.0 38.0 40.0 52-53 38.223375000000004 40.0 38.0 40.0 38.0 40.0 54-55 38.236000000000004 40.0 38.0 40.0 38.0 40.0 56-57 38.086125 40.0 38.0 40.0 38.0 40.0 58-59 37.630624999999995 40.0 38.0 40.0 32.0 40.0 60-61 37.836124999999996 40.0 38.0 40.0 38.0 40.0 62-63 37.746125000000006 40.0 38.0 40.0 32.0 40.0 64-65 37.969625 40.0 38.0 40.0 38.0 40.0 66-67 37.759249999999994 40.0 38.0 40.0 35.0 40.0 68-69 37.79925 40.0 38.0 40.0 35.0 40.0 70-71 37.548 40.0 38.0 40.0 32.0 40.0 72-73 37.734125 40.0 38.0 40.0 32.0 40.0 74-75 37.65575 40.0 38.0 40.0 32.0 40.0 76-77 37.64125 40.0 38.0 40.0 32.0 40.0 78-79 37.657125 40.0 38.0 40.0 32.0 40.0 80 35.0125 38.0 32.0 38.0 27.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 6.0 17 6.0 18 5.0 19 3.0 20 10.0 21 3.0 22 6.0 23 9.0 24 10.0 25 15.0 26 19.0 27 20.0 28 23.0 29 24.0 30 46.0 31 43.0 32 50.0 33 68.0 34 87.0 35 117.0 36 139.0 37 280.0 38 652.0 39 2359.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.125 20.175 9.875 28.825 2 29.849999999999998 24.725 21.875 23.549999999999997 3 25.624999999999996 24.8 24.025 25.55 4 29.75 29.299999999999997 17.375 23.575 5 28.425 30.225 17.925 23.425 6 26.650000000000002 30.55 18.925 23.875 7 26.825 17.9 30.049999999999997 25.224999999999998 8 27.05 21.85 19.650000000000002 31.45 9 24.925 21.85 24.349999999999998 28.875 10-11 29.1625 24.275 18.212500000000002 28.349999999999998 12-13 27.5125 21.8125 22.7125 27.962500000000002 14-15 28.0625 23.1125 21.512500000000003 27.3125 16-17 28.4125 22.8125 21.224999999999998 27.55 18-19 26.937499999999996 23.6375 22.0875 27.3375 20-21 27.2625 23.3375 22.125 27.275 22-23 28.95 23.1625 21.5625 26.325 24-25 27.450000000000003 22.375 22.237499999999997 27.9375 26-27 26.875 23.8875 21.637500000000003 27.6 28-29 28.212500000000002 22.8625 21.587500000000002 27.3375 30-31 27.787499999999998 22.8625 22.0 27.35 32-33 27.6875 23.0125 22.287499999999998 27.0125 34-35 28.0875 24.2625 21.5 26.150000000000002 36-37 27.725 22.3375 22.3875 27.55 38-39 27.8125 23.05 22.1375 27.0 40-41 27.5625 23.4625 21.75 27.224999999999998 42-43 27.437499999999996 22.6125 22.3875 27.5625 44-45 28.4125 22.0625 22.775000000000002 26.75 46-47 27.6375 23.1875 22.1875 26.987499999999997 48-49 28.425 22.1375 22.1 27.3375 50-51 28.7 22.537499999999998 22.7625 26.0 52-53 28.6375 23.7875 21.4125 26.1625 54-55 26.637499999999996 23.724999999999998 21.55 28.0875 56-57 27.762500000000003 23.0 23.474999999999998 25.7625 58-59 28.5875 23.2375 21.725 26.450000000000003 60-61 27.474999999999998 23.175 22.5 26.85 62-63 27.1625 23.5625 22.0125 27.2625 64-65 26.7125 23.6375 22.5125 27.1375 66-67 26.9625 23.400000000000002 22.2625 27.375 68-69 27.800000000000004 22.8875 22.912499999999998 26.400000000000002 70-71 27.5125 23.325000000000003 22.075 27.0875 72-73 27.900000000000002 23.1875 22.3625 26.55 74-75 27.55 23.3 22.912499999999998 26.237500000000004 76-77 26.200000000000003 23.6625 23.9125 26.224999999999998 78-79 27.3875 23.4375 22.537499999999998 26.637499999999996 80 27.275 23.125 22.075 27.525 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.5 23 0.5 24 0.0 25 0.0 26 0.0 27 0.0 28 0.5 29 2.0 30 3.0 31 5.5 32 9.5 33 11.5 34 10.5 35 9.0 36 22.5 37 43.0 38 60.5 39 75.5 40 80.0 41 87.0 42 113.5 43 143.0 44 168.0 45 183.0 46 178.0 47 171.5 48 172.0 49 168.5 50 163.0 51 164.5 52 160.0 53 156.0 54 158.0 55 158.0 56 156.0 57 159.5 58 168.5 59 159.5 60 147.0 61 136.0 62 133.5 63 142.5 64 133.0 65 123.0 66 125.5 67 116.5 68 103.5 69 86.5 70 71.0 71 65.0 72 58.0 73 59.0 74 47.0 75 33.0 76 26.0 77 18.5 78 11.0 79 4.5 80 5.0 81 3.5 82 1.0 83 0.0 84 1.0 85 2.0 86 1.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 80 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.9 #Duplication Level Percentage of deduplicated Percentage of total 1 98.96359959555106 97.875 2 0.9858442871587462 1.95 3 0.02527805864509606 0.075 4 0.02527805864509606 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.05 0.0 0.0 0.0 0.0 55 0.05 0.0 0.0 0.0 0.0 56 0.05 0.0 0.0 0.0 0.0 57 0.05 0.0 0.0 0.0 0.0 58 0.05 0.0 0.0 0.0 0.0 59 0.075 0.0 0.0 0.0 0.0 60 0.075 0.0 0.0 0.0 0.0 61 0.1 0.0 0.0 0.0 0.0 62 0.1 0.0 0.0 0.0 0.0 63 0.125 0.0 0.0 0.0 0.0 64 0.15 0.0 0.0 0.0 0.0 65 0.175 0.0 0.0 0.0 0.0 66 0.175 0.0 0.0 0.0 0.0 67 0.175 0.0 0.0 0.0 0.0 68 0.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1542776 spots for SRR12711892.sra Written 1542776 spots for SRR12711892.sra Read 1542776 spots for SRR12711892.sra Written 1542776 spots for SRR12711892.sra Read 1542776 spots for SRR12711892.sra Written 1542776 spots for SRR12711892.sra Read 1542776 spots for SRR12711892.sra Written 1542776 spots for SRR12711892.sra Read 1542776 spots for SRR12711892.sra Written 1542776 spots for SRR12711892.sra Read 1542776 spots for SRR12711892.sra Written 1542776 spots for SRR12711892.sra Read 1542776 spots for SRR12711892.sra Written 1542776 spots for SRR12711892.sra Read 1542776 spots for SRR12711892.sra Written 1542776 spots for SRR12711892.sra Read 1542785 spots for SRR12711892.sra Written 1542785 spots for SRR12711892.sra Read 1542776 spots for SRR12711892.sra Written 1542776 spots for SRR12711892.sra Read 1542776 spots for SRR12711892.sra Written 1542776 spots for SRR12711892.sra Read 1542776 spots for SRR12711892.sra Written 1542776 spots for SRR12711892.sra Read 1542776 spots for SRR12711892.sra Written 1542776 spots for SRR12711892.sra Read 1542776 spots for SRR12711892.sra Written 1542776 spots for SRR12711892.sra Read 1542776 spots for SRR12711892.sra Written 1542776 spots for SRR12711892.sra Read 1542776 spots for SRR12711892.sra Written 1542776 spots for SRR12711892.sra Read 1542776 spots for SRR12711892.sra Written 1542776 spots for SRR12711892.sra Read 1542776 spots for SRR12711892.sra Written 1542776 spots for SRR12711892.sra Read 1542776 spots for SRR12711892.sra Written 1542776 spots for SRR12711892.sra Read 1542776 spots for SRR12711892.sra Written 1542776 spots for SRR12711892.sra SRR ids: ['SRR12711892.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0_ka1u5a SRR12711892.sra spots: 30855529 blocks: [[1, 1542776], [1542777, 3085552], [3085553, 4628328], [4628329, 6171104], [6171105, 7713880], [7713881, 9256656], [9256657, 10799432], [10799433, 12342208], [12342209, 13884984], [13884985, 15427760], [15427761, 16970536], [16970537, 18513312], [18513313, 20056088], [20056089, 21598864], [21598865, 23141640], [23141641, 24684416], [24684417, 26227192], [26227193, 27769968], [27769969, 29312744], [29312745, 30855529]] SRR12711892 file size 6155431 SRR12711892 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12711892 SRR12711892_1.fastq SRR12711892_2.fastq Input file: SRR12711892_1.fastq Paired file: SRR12711892_2.fastq trimmed: SRR12711892-trimmed-pair1.fastq, SRR12711892-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 18:28:34 2024 >> started Sat Dec 7 18:29:00 2024 >> done (26.262s) 30855529 read pairs processed; of these: 1871 ( 0.01%) short read pairs filtered out after trimming by size control 59271 ( 0.19%) empty read pairs filtered out after trimming by size control 30794387 (99.80%) read pairs available; of these: 260089 ( 0.84%) trimmed read pairs available after processing 30534298 (99.16%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 17 0.00% 19 15 0.00% 20 21 0.00% 21 14 0.00% 22 20 0.00% 23 15 0.00% 24 21 0.00% 25 13 0.00% 26 24 0.00% 27 34 0.00% 28 50 0.00% 29 63 0.00% 30 63 0.00% 31 96 0.00% 32 138 0.00% 33 110 0.00% 34 129 0.00% 35 170 0.00% 36 168 0.00% 37 220 0.00% 38 237 0.00% 39 287 0.00% 40 342 0.00% 41 421 0.00% 42 430 0.00% 43 515 0.00% 44 514 0.00% 45 559 0.00% 46 581 0.00% 47 717 0.00% 48 877 0.00% 49 1814 0.01% 50 1520 0.00% 51 2104 0.01% 52 2172 0.01% 53 1866 0.01% 54 2914 0.01% 55 2122 0.01% 56 2836 0.01% 57 2936 0.01% 58 4020 0.01% 59 3699 0.01% 60 4224 0.01% 61 4897 0.02% 62 4947 0.02% 63 6412 0.02% 64 5881 0.02% 65 6920 0.02% 66 6515 0.02% 67 7289 0.02% 68 7261 0.02% 69 8877 0.03% 70 10003 0.03% 71 12130 0.04% 72 12447 0.04% 73 14760 0.05% 74 15832 0.05% 75 16431 0.05% 76 17589 0.06% 77 18828 0.06% 78 20839 0.07% 79 23123 0.08% 80 30534298 99.16% 30794387 reads passed initial QC criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=34 prefix-density=0.41 prefix-fanout=2.0 sequence=TAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTG criterion=fanout-score sequence-density=0.11 sequence-density-rank=34 fanout-score=8.22 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=4.1 sequence=GCGCCGAGCATGGCCCA criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=4.14 fanout-score-rank=10 prefix-density=0.59 prefix-fanout=3.6 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.16 sequence-density-rank=32 fanout-score=8.87 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=3.7 sequence=CAGAGCATCCTCGCCAT SRR12711892 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 18:29:39 Started mapping on | Dec 07 18:29:39 Finished on | Dec 07 18:30:39 Mapping speed, Million of reads per hour | 1847.66 Number of input reads | 30794387 Average input read length | 159 UNIQUE READS: Uniquely mapped reads number | 28558250 Uniquely mapped reads % | 92.74% Average mapped length | 159.45 Number of splices: Total | 12936361 Number of splices: Annotated (sjdb) | 12342977 Number of splices: GT/AG | 12771961 Number of splices: GC/AG | 145432 Number of splices: AT/AC | 5176 Number of splices: Non-canonical | 13792 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 1.89 Insertion rate per base | 0.01% Insertion average length | 1.70 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 939106 % of reads mapped to multiple loci | 3.05% Number of reads mapped to too many loci | 245864 % of reads mapped to too many loci | 0.80% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.30% % of reads unmapped: other | 2.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1297551 1297551 1297551 N_multimapping 939106 939106 939106 N_noFeature 708325 27858596 914225 N_ambiguous 575010 1906 82904 UnstrandedReadsAssigned:27274915 PositiveStrandReadsAssigned:697748 NegativeStrandReadsAssigned:27561121 Dataset is classified negative stranded MeadianReadLen=80 20thPercentileLength=80 echo kmer=75 SRR12711892 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12711892-trimmed-pair1.fastq SRR12711892-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,794,387 reads, 27,866,943 reads pseudoaligned [quant] estimated average fragment length: 159.34 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,185 rounds 52973 SRR12711892.ke.tsv 35125 SRR12711892.se.tsv 88098 total ==> SRR12711892.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 777.755 0 0 PNS24247 1044 885.66 39.264 2.10976 PNS24249 1928 1769.66 74.205 1.99549 PNS24246 1044 885.66 39.264 2.10976 PNS24248 1044 885.66 39.264 2.10976 PNS24244 1471 1312.66 194.003 7.03337 PNS24243 293 138.711 0 0 KQK14069 1603 1444.66 1032.59 34.0149 KQK14071 474 316.519 60.4393 9.08713 ==> SRR12711892.se.tsv <== BRADI_1g14170v3 1125 BRADI_1g53295v3 21 BRADI_1g59795v3 248 BRADI_1g07683v3 0 BRADI_1g00485v3 39 BRADI_1g20270v3 2185 BRADI_1g74790v3 117 BRADI_1g09890v3 17 BRADI_1g77505v3 362 BRADI_1g48960v3 0 SRR12711892 completed mapping pipeline successfully