Starting /dee2/code/volunteer_pipeline.sh SRR12711893 current disk space = 1540589666304 free memory = 1598863976 SRR12711893 SRAfilesize a563ae582149c73ce1976efe10486ce5 SRR12711893.sra SRR12711893.sra file validated SRR12711893 is paired end SRR12711893 is conventional basespace SRR12711893 read1 length is 80 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12711893_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 80 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.67125 38.0 38.0 38.0 32.0 38.0 2 36.924 38.0 38.0 38.0 32.0 38.0 3 36.487 38.0 38.0 38.0 32.0 38.0 4 36.8125 38.0 38.0 38.0 32.0 38.0 5 36.72975 38.0 38.0 38.0 32.0 38.0 6 38.8325 40.0 38.0 40.0 38.0 40.0 7 38.77675 40.0 38.0 40.0 38.0 40.0 8 38.94675 40.0 38.0 40.0 38.0 40.0 9 39.006 40.0 38.0 40.0 38.0 40.0 10-11 38.910875 40.0 38.0 40.0 38.0 40.0 12-13 39.038125 40.0 38.0 40.0 38.0 40.0 14-15 38.770125 40.0 38.0 40.0 38.0 40.0 16-17 39.017250000000004 40.0 38.0 40.0 38.0 40.0 18-19 38.99925 40.0 38.0 40.0 38.0 40.0 20-21 38.97475 40.0 38.0 40.0 38.0 40.0 22-23 38.913875000000004 40.0 38.0 40.0 38.0 40.0 24-25 38.960625 40.0 38.0 40.0 38.0 40.0 26-27 38.693 40.0 38.0 40.0 38.0 40.0 28-29 38.748625000000004 40.0 38.0 40.0 38.0 40.0 30-31 38.870374999999996 40.0 38.0 40.0 38.0 40.0 32-33 38.904875000000004 40.0 38.0 40.0 38.0 40.0 34-35 38.44025 40.0 38.0 40.0 38.0 40.0 36-37 38.809 40.0 38.0 40.0 38.0 40.0 38-39 38.70525 40.0 38.0 40.0 38.0 40.0 40-41 38.778375 40.0 38.0 40.0 38.0 40.0 42-43 38.86025 40.0 38.0 40.0 38.0 40.0 44-45 38.646125 40.0 38.0 40.0 38.0 40.0 46-47 38.816500000000005 40.0 38.0 40.0 38.0 40.0 48-49 38.695750000000004 40.0 38.0 40.0 38.0 40.0 50-51 38.804375 40.0 38.0 40.0 38.0 40.0 52-53 38.756625 40.0 38.0 40.0 38.0 40.0 54-55 38.619749999999996 40.0 38.0 40.0 38.0 40.0 56-57 38.638875 40.0 38.0 40.0 38.0 40.0 58-59 38.727000000000004 40.0 38.0 40.0 38.0 40.0 60-61 38.7555 40.0 38.0 40.0 38.0 40.0 62-63 38.606625 40.0 38.0 40.0 38.0 40.0 64-65 38.699625 40.0 38.0 40.0 38.0 40.0 66-67 38.426249999999996 40.0 38.0 40.0 38.0 40.0 68-69 38.23425 40.0 38.0 40.0 38.0 40.0 70-71 38.602999999999994 40.0 38.0 40.0 38.0 40.0 72-73 38.0845 40.0 38.0 40.0 38.0 40.0 74-75 38.464875000000006 40.0 38.0 40.0 38.0 40.0 76-77 38.53775 40.0 38.0 40.0 38.0 40.0 78-79 38.307 40.0 38.0 40.0 38.0 40.0 80 37.54 38.0 38.0 40.0 32.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 4.0 25 1.0 26 7.0 27 5.0 28 13.0 29 14.0 30 29.0 31 37.0 32 45.0 33 63.0 34 78.0 35 105.0 36 157.0 37 242.0 38 454.0 39 2745.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.275 13.900000000000002 6.125 33.7 2 28.04603452589442 16.412309231923945 28.596447335501622 26.945208906680012 3 23.7 19.675 22.125 34.5 4 27.625 25.4 20.4 26.575 5 28.275 28.349999999999998 21.775 21.6 6 25.3 29.125 22.225 23.35 7 20.925 22.375 35.475 21.224999999999998 8 22.075 22.275 25.924999999999997 29.725 9 20.875 20.775 31.15 27.200000000000003 10-11 25.8625 26.724999999999998 21.9375 25.474999999999998 12-13 25.162499999999998 22.5625 24.8625 27.4125 14-15 23.724999999999998 23.825 25.4375 27.0125 16-17 26.0 22.725 23.8375 27.437499999999996 18-19 24.9375 24.837500000000002 23.35 26.875 20-21 25.5125 23.9875 24.1375 26.3625 22-23 25.112499999999997 23.1625 24.712500000000002 27.0125 24-25 25.912499999999998 23.3875 24.925 25.775 26-27 25.7125 23.6875 24.175 26.424999999999997 28-29 25.324999999999996 24.0625 24.175 26.437500000000004 30-31 25.25 23.6625 23.75 27.3375 32-33 25.2 23.95 23.775 27.075 34-35 25.662499999999998 23.8125 24.0625 26.4625 36-37 25.374999999999996 23.1875 24.0125 27.425 38-39 26.05 22.925 24.349999999999998 26.674999999999997 40-41 25.4 23.275000000000002 24.25 27.075 42-43 26.0 22.8625 23.7375 27.400000000000002 44-45 26.087500000000002 23.400000000000002 23.125 27.3875 46-47 26.625 23.7375 23.4625 26.174999999999997 48-49 26.025 23.425 24.675 25.874999999999996 50-51 25.9625 22.825 23.974999999999998 27.237499999999997 52-53 25.674999999999997 23.7625 23.474999999999998 27.0875 54-55 25.637500000000003 23.8625 23.3125 27.187499999999996 56-57 26.174999999999997 23.549999999999997 22.825 27.450000000000003 58-59 26.887499999999996 23.175 24.099999999999998 25.837500000000002 60-61 25.837500000000002 23.2375 23.3 27.625 62-63 26.437500000000004 23.3875 22.662499999999998 27.5125 64-65 27.1625 23.1875 22.912499999999998 26.737499999999997 66-67 25.8125 24.212500000000002 23.775 26.200000000000003 68-69 26.625 23.7125 23.400000000000002 26.2625 70-71 26.4625 23.0875 23.75 26.700000000000003 72-73 25.928241030128767 22.86535816977122 23.15289411176397 28.053506688336043 74-75 25.662499999999998 23.75 23.3625 27.224999999999998 76-77 26.187500000000004 23.7625 23.5375 26.5125 78-79 26.474999999999998 23.1875 23.1625 27.175 80 26.35 22.85 22.425 28.375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 1.5 27 2.0 28 3.5 29 5.5 30 6.0 31 9.5 32 12.5 33 18.0 34 33.5 35 43.0 36 43.5 37 63.0 38 83.5 39 98.5 40 112.0 41 119.5 42 136.5 43 157.0 44 178.0 45 188.0 46 195.5 47 206.5 48 195.0 49 185.0 50 190.0 51 172.5 52 151.5 53 164.0 54 161.0 55 142.0 56 145.5 57 138.5 58 136.0 59 141.5 60 139.0 61 129.5 62 118.0 63 103.5 64 99.5 65 108.0 66 106.5 67 98.0 68 93.5 69 81.0 70 66.0 71 63.5 72 47.5 73 36.5 74 29.0 75 19.0 76 15.5 77 10.0 78 6.0 79 2.5 80 1.0 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0125 74-75 0.0 76-77 0.0 78-79 0.0 80 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 80 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14228052472251 98.25 2 0.8072653884964682 1.6 3 0.050454086781029264 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.025 0.0 0.0 0.0 0.0 65 0.075 0.0 0.0 0.0 0.0 66 0.1 0.0 0.0 0.0 0.0 67 0.15 0.0 0.0 0.0 0.0 68 0.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12711893 read2 length is 80 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12711893_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 80 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.36975 38.0 38.0 38.0 32.0 38.0 2 36.50775 38.0 38.0 38.0 32.0 38.0 3 35.79875 38.0 32.0 38.0 32.0 38.0 4 36.61075 38.0 38.0 38.0 32.0 38.0 5 36.5865 38.0 38.0 38.0 32.0 38.0 6 38.789 40.0 38.0 40.0 38.0 40.0 7 38.73725 40.0 38.0 40.0 38.0 40.0 8 38.74125 40.0 38.0 40.0 38.0 40.0 9 38.64425 40.0 38.0 40.0 38.0 40.0 10-11 38.5275 40.0 38.0 40.0 38.0 40.0 12-13 38.5715 40.0 38.0 40.0 38.0 40.0 14-15 38.73425 40.0 38.0 40.0 38.0 40.0 16-17 38.612750000000005 40.0 38.0 40.0 38.0 40.0 18-19 38.65575 40.0 38.0 40.0 38.0 40.0 20-21 38.657125 40.0 38.0 40.0 38.0 40.0 22-23 38.672625 40.0 38.0 40.0 38.0 40.0 24-25 38.3875 40.0 38.0 40.0 38.0 40.0 26-27 38.546625000000006 40.0 38.0 40.0 38.0 40.0 28-29 38.65575 40.0 38.0 40.0 38.0 40.0 30-31 38.722375 40.0 38.0 40.0 38.0 40.0 32-33 38.680625 40.0 38.0 40.0 38.0 40.0 34-35 38.65325 40.0 38.0 40.0 38.0 40.0 36-37 38.565124999999995 40.0 38.0 40.0 38.0 40.0 38-39 38.537375 40.0 38.0 40.0 38.0 40.0 40-41 38.31625 40.0 38.0 40.0 38.0 40.0 42-43 38.38225 40.0 38.0 40.0 38.0 40.0 44-45 38.160624999999996 40.0 38.0 40.0 38.0 40.0 46-47 38.320499999999996 40.0 38.0 40.0 38.0 40.0 48-49 38.4635 40.0 38.0 40.0 38.0 40.0 50-51 38.50875 40.0 38.0 40.0 38.0 40.0 52-53 38.5135 40.0 38.0 40.0 38.0 40.0 54-55 38.439875 40.0 38.0 40.0 38.0 40.0 56-57 38.316625 40.0 38.0 40.0 38.0 40.0 58-59 38.0215 40.0 38.0 40.0 35.0 40.0 60-61 38.175 40.0 38.0 40.0 38.0 40.0 62-63 38.1085 40.0 38.0 40.0 38.0 40.0 64-65 38.34975 40.0 38.0 40.0 38.0 40.0 66-67 38.0295 40.0 38.0 40.0 38.0 40.0 68-69 38.153875 40.0 38.0 40.0 38.0 40.0 70-71 37.892125 40.0 38.0 40.0 35.0 40.0 72-73 38.118 40.0 38.0 40.0 38.0 40.0 74-75 38.083125 40.0 38.0 40.0 38.0 40.0 76-77 37.984 40.0 38.0 40.0 38.0 40.0 78-79 37.973 40.0 38.0 40.0 38.0 40.0 80 35.47925 38.0 32.0 38.0 27.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 2.0 19 2.0 20 1.0 21 5.0 22 4.0 23 4.0 24 7.0 25 11.0 26 14.0 27 15.0 28 11.0 29 25.0 30 35.0 31 36.0 32 48.0 33 52.0 34 84.0 35 121.0 36 172.0 37 258.0 38 563.0 39 2529.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.175 20.1 8.55 31.175000000000004 2 31.075000000000003 24.625 24.275 20.025000000000002 3 24.525 26.325 23.474999999999998 25.674999999999997 4 26.625 31.025000000000002 18.85 23.5 5 29.299999999999997 31.35 17.599999999999998 21.75 6 25.874999999999996 33.324999999999996 17.525 23.275000000000002 7 24.45 18.875 31.5 25.174999999999997 8 26.0 21.0 22.8 30.2 9 25.174999999999997 22.05 24.725 28.050000000000004 10-11 27.962500000000002 25.474999999999998 19.8875 26.674999999999997 12-13 27.1125 21.512500000000003 22.625 28.749999999999996 14-15 27.875 23.5 22.275 26.35 16-17 27.6125 22.7125 22.3625 27.3125 18-19 27.0 23.375 21.65 27.975 20-21 27.425 23.7375 22.400000000000002 26.437500000000004 22-23 27.675 23.575 22.2 26.55 24-25 27.212500000000002 23.625 22.175 26.987499999999997 26-27 27.2625 24.637500000000003 21.875 26.224999999999998 28-29 27.187499999999996 23.724999999999998 22.175 26.9125 30-31 26.650000000000002 22.6375 22.775000000000002 27.9375 32-33 26.937499999999996 24.4125 22.0625 26.5875 34-35 27.462500000000002 23.4125 22.2125 26.9125 36-37 27.075 24.1125 22.4375 26.375 38-39 27.3125 23.65 22.5125 26.525 40-41 27.750000000000004 23.400000000000002 22.537499999999998 26.3125 42-43 27.9125 22.8 22.05 27.237499999999997 44-45 27.987499999999997 23.4125 22.6 26.0 46-47 27.0125 24.05 22.075 26.8625 48-49 26.5875 23.4375 23.125 26.85 50-51 26.5375 24.1875 22.112499999999997 27.1625 52-53 26.35 23.1375 22.7625 27.750000000000004 54-55 28.0625 23.175 22.55 26.2125 56-57 27.525 23.2875 23.7125 25.474999999999998 58-59 28.0625 23.65 21.925 26.3625 60-61 27.650000000000002 23.849999999999998 22.75 25.75 62-63 26.9125 24.6 22.1375 26.35 64-65 27.437499999999996 23.425 22.8625 26.275 66-67 25.937500000000004 23.4875 22.8625 27.712500000000002 68-69 26.6625 24.1625 22.9875 26.187500000000004 70-71 27.375 22.775000000000002 23.2875 26.5625 72-73 26.8625 23.4875 23.75 25.900000000000002 74-75 27.125 23.9125 23.5625 25.4 76-77 27.3 23.35 22.8875 26.4625 78-79 26.9625 23.1375 22.9625 26.937499999999996 80 27.650000000000002 25.25 21.875 25.224999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 0.5 27 1.5 28 2.0 29 1.0 30 1.0 31 2.5 32 7.0 33 11.0 34 14.5 35 17.0 36 22.5 37 43.0 38 66.0 39 81.5 40 89.0 41 104.5 42 132.0 43 159.5 44 176.0 45 177.0 46 185.0 47 195.0 48 185.5 49 174.5 50 175.0 51 173.0 52 165.0 53 155.0 54 163.0 55 175.0 56 161.0 57 158.5 58 163.5 59 154.0 60 151.0 61 149.0 62 131.5 63 120.0 64 123.5 65 123.0 66 112.5 67 101.5 68 102.0 69 90.5 70 78.0 71 61.5 72 45.5 73 40.0 74 27.5 75 21.0 76 15.0 77 8.0 78 6.0 79 3.0 80 1.0 81 1.5 82 1.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 80 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.9 #Duplication Level Percentage of deduplicated Percentage of total 1 98.93832153690597 97.85000000000001 2 1.0111223458038423 2.0 3 0.05055611729019212 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 57 0.025 0.0 0.0 0.0 0.0 58 0.025 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.025 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.05 0.0 0.0 0.0 0.0 64 0.05 0.0 0.0 0.0 0.0 65 0.1 0.0 0.0 0.0 0.0 66 0.125 0.0 0.0 0.0 0.0 67 0.175 0.0 0.0 0.0 0.0 68 0.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1437281 spots for SRR12711893.sra Written 1437281 spots for SRR12711893.sra Read 1437281 spots for SRR12711893.sra Written 1437281 spots for SRR12711893.sra Read 1437281 spots for SRR12711893.sra Written 1437281 spots for SRR12711893.sra Read 1437281 spots for SRR12711893.sra Written 1437281 spots for SRR12711893.sra Read 1437281 spots for SRR12711893.sra Written 1437281 spots for SRR12711893.sra Read 1437281 spots for SRR12711893.sra Written 1437281 spots for SRR12711893.sra Read 1437281 spots for SRR12711893.sra Written 1437281 spots for SRR12711893.sra Read 1437281 spots for SRR12711893.sra Written 1437281 spots for SRR12711893.sra Read 1437281 spots for SRR12711893.sra Written 1437281 spots for SRR12711893.sra Read 1437295 spots for SRR12711893.sra Written 1437295 spots for SRR12711893.sra Read 1437281 spots for SRR12711893.sra Written 1437281 spots for SRR12711893.sra Read 1437281 spots for SRR12711893.sra Written 1437281 spots for SRR12711893.sra Read 1437281 spots for SRR12711893.sra Written 1437281 spots for SRR12711893.sra Read 1437281 spots for SRR12711893.sra Written 1437281 spots for SRR12711893.sra Read 1437281 spots for SRR12711893.sra Written 1437281 spots for SRR12711893.sra Read 1437281 spots for SRR12711893.sra Written 1437281 spots for SRR12711893.sra Read 1437281 spots for SRR12711893.sra Written 1437281 spots for SRR12711893.sra Read 1437281 spots for SRR12711893.sra Written 1437281 spots for SRR12711893.sra Read 1437281 spots for SRR12711893.sra Written 1437281 spots for SRR12711893.sra Read 1437281 spots for SRR12711893.sra Written 1437281 spots for SRR12711893.sra SRR ids: ['SRR12711893.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2zh0xvix SRR12711893.sra spots: 28745634 blocks: [[1, 1437281], [1437282, 2874562], [2874563, 4311843], [4311844, 5749124], [5749125, 7186405], [7186406, 8623686], [8623687, 10060967], [10060968, 11498248], [11498249, 12935529], [12935530, 14372810], [14372811, 15810091], [15810092, 17247372], [17247373, 18684653], [18684654, 20121934], [20121935, 21559215], [21559216, 22996496], [22996497, 24433777], [24433778, 25871058], [25871059, 27308339], [27308340, 28745634]] SRR12711893 file size 5733040 SRR12711893 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12711893 SRR12711893_1.fastq SRR12711893_2.fastq Input file: SRR12711893_1.fastq Paired file: SRR12711893_2.fastq trimmed: SRR12711893-trimmed-pair1.fastq, SRR12711893-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 18:29:23 2024 >> started Sat Dec 7 18:29:50 2024 >> done (26.637s) 28745634 read pairs processed; of these: 1628 ( 0.01%) short read pairs filtered out after trimming by size control 6672 ( 0.02%) empty read pairs filtered out after trimming by size control 28737334 (99.97%) read pairs available; of these: 206567 ( 0.72%) trimmed read pairs available after processing 28530767 (99.28%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 15 0.00% 20 18 0.00% 21 13 0.00% 22 10 0.00% 23 15 0.00% 24 16 0.00% 25 27 0.00% 26 19 0.00% 27 21 0.00% 28 38 0.00% 29 54 0.00% 30 58 0.00% 31 86 0.00% 32 106 0.00% 33 110 0.00% 34 124 0.00% 35 118 0.00% 36 137 0.00% 37 174 0.00% 38 207 0.00% 39 243 0.00% 40 279 0.00% 41 325 0.00% 42 339 0.00% 43 371 0.00% 44 443 0.00% 45 469 0.00% 46 504 0.00% 47 555 0.00% 48 668 0.00% 49 1517 0.01% 50 1406 0.00% 51 1878 0.01% 52 1769 0.01% 53 1664 0.01% 54 2494 0.01% 55 1807 0.01% 56 2613 0.01% 57 2400 0.01% 58 3140 0.01% 59 3138 0.01% 60 3608 0.01% 61 4093 0.01% 62 3913 0.01% 63 5121 0.02% 64 4468 0.02% 65 5380 0.02% 66 5185 0.02% 67 5724 0.02% 68 5653 0.02% 69 7432 0.03% 70 7611 0.03% 71 9142 0.03% 72 9554 0.03% 73 11422 0.04% 74 12961 0.05% 75 12954 0.05% 76 13630 0.05% 77 14450 0.05% 78 16819 0.06% 79 18047 0.06% 80 28530767 99.28% 28737334 reads passed initial QC criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=2.39 fanout-score-rank=18 prefix-density=0.67 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.19 sequence-density-rank=25 fanout-score=7.34 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=3.9 sequence=CTTGAACCAGACGGCCTCG criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=4.10 fanout-score-rank=10 prefix-density=0.62 prefix-fanout=3.6 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.13 sequence-density-rank=31 fanout-score=10.89 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=3.6 sequence=CAGAGCATCCTTGCCATCTGGGCCTGCCAGGTTGTACTCATGGGCGCCGTCGAGGGGTACCGTGTTGC SRR12711893 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 18:30:23 Started mapping on | Dec 07 18:30:23 Finished on | Dec 07 18:31:17 Mapping speed, Million of reads per hour | 1915.82 Number of input reads | 28737334 Average input read length | 159 UNIQUE READS: Uniquely mapped reads number | 27523530 Uniquely mapped reads % | 95.78% Average mapped length | 159.51 Number of splices: Total | 14118683 Number of splices: Annotated (sjdb) | 13489369 Number of splices: GT/AG | 13941459 Number of splices: GC/AG | 159909 Number of splices: AT/AC | 6189 Number of splices: Non-canonical | 11126 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 1.92 Insertion rate per base | 0.01% Insertion average length | 1.73 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 483785 % of reads mapped to multiple loci | 1.68% Number of reads mapped to too many loci | 104314 % of reads mapped to too many loci | 0.36% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.30% % of reads unmapped: other | 0.88% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 730524 730524 730524 N_multimapping 483785 483785 483785 N_noFeature 538902 26900034 719592 N_ambiguous 513147 2004 71481 UnstrandedReadsAssigned:26471481 PositiveStrandReadsAssigned:621492 NegativeStrandReadsAssigned:26732457 Dataset is classified negative stranded MeadianReadLen=80 20thPercentileLength=80 echo kmer=75 SRR12711893 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12711893-trimmed-pair1.fastq SRR12711893-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,737,334 reads, 26,952,365 reads pseudoaligned [quant] estimated average fragment length: 163.236 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,272 rounds 52973 SRR12711893.ke.tsv 35125 SRR12711893.se.tsv 88098 total ==> SRR12711893.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 773.877 10.4192 0.682427 PNS24247 1044 881.764 52.9906 3.04606 PNS24249 1928 1765.76 97.8173 2.80786 PNS24246 1044 881.764 52.9906 3.04606 PNS24248 1044 881.764 52.9906 3.04606 PNS24244 1471 1308.76 101.792 3.94224 PNS24243 293 135.301 0 0 KQK14069 1603 1440.76 878.312 30.8993 KQK14071 474 312.949 7.06705 1.14461 ==> SRR12711893.se.tsv <== BRADI_1g14170v3 947 BRADI_1g53295v3 19 BRADI_1g59795v3 285 BRADI_1g07683v3 0 BRADI_1g00485v3 22 BRADI_1g20270v3 2958 BRADI_1g74790v3 155 BRADI_1g09890v3 11 BRADI_1g77505v3 363 BRADI_1g48960v3 0 SRR12711893 completed mapping pipeline successfully