Starting /dee2/code/volunteer_pipeline.sh SRR12711894 current disk space = 1540584222720 free memory = 1602346252 SRR12711894 SRAfilesize f6737c958e3f70786c7c4fdd74aaa40b SRR12711894.sra SRR12711894.sra file validated SRR12711894 is paired end SRR12711894 is conventional basespace SRR12711894 read1 length is 80 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12711894_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 80 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.918 38.0 38.0 38.0 32.0 38.0 2 36.6945 38.0 38.0 38.0 32.0 38.0 3 36.705 38.0 38.0 38.0 32.0 38.0 4 36.72675 38.0 38.0 38.0 32.0 38.0 5 36.71375 38.0 38.0 38.0 32.0 38.0 6 38.82725 40.0 38.0 40.0 38.0 40.0 7 38.686 40.0 38.0 40.0 38.0 40.0 8 38.68275 40.0 38.0 40.0 38.0 40.0 9 38.70475 40.0 38.0 40.0 38.0 40.0 10-11 38.719750000000005 40.0 38.0 40.0 38.0 40.0 12-13 38.764125 40.0 38.0 40.0 38.0 40.0 14-15 38.687375 40.0 38.0 40.0 38.0 40.0 16-17 38.64575 40.0 38.0 40.0 38.0 40.0 18-19 38.705625 40.0 38.0 40.0 38.0 40.0 20-21 38.817875 40.0 38.0 40.0 38.0 40.0 22-23 38.708749999999995 40.0 38.0 40.0 38.0 40.0 24-25 38.599625 40.0 38.0 40.0 38.0 40.0 26-27 38.662125 40.0 38.0 40.0 38.0 40.0 28-29 38.630375 40.0 38.0 40.0 38.0 40.0 30-31 38.671375 40.0 38.0 40.0 38.0 40.0 32-33 38.629125 40.0 38.0 40.0 38.0 40.0 34-35 38.6345 40.0 38.0 40.0 38.0 40.0 36-37 38.55525 40.0 38.0 40.0 38.0 40.0 38-39 38.536 40.0 38.0 40.0 38.0 40.0 40-41 38.573625 40.0 38.0 40.0 38.0 40.0 42-43 38.472125000000005 40.0 38.0 40.0 38.0 40.0 44-45 38.426500000000004 40.0 38.0 40.0 38.0 40.0 46-47 38.462999999999994 40.0 38.0 40.0 38.0 40.0 48-49 38.55825 40.0 38.0 40.0 38.0 40.0 50-51 38.493750000000006 40.0 38.0 40.0 38.0 40.0 52-53 38.53 40.0 38.0 40.0 38.0 40.0 54-55 38.467875 40.0 38.0 40.0 38.0 40.0 56-57 38.332875 40.0 38.0 40.0 38.0 40.0 58-59 38.441 40.0 38.0 40.0 38.0 40.0 60-61 38.39325 40.0 38.0 40.0 38.0 40.0 62-63 38.290125 40.0 38.0 40.0 38.0 40.0 64-65 38.395875000000004 40.0 38.0 40.0 38.0 40.0 66-67 38.337 40.0 38.0 40.0 38.0 40.0 68-69 38.32575 40.0 38.0 40.0 38.0 40.0 70-71 38.428250000000006 40.0 38.0 40.0 38.0 40.0 72-73 38.294875000000005 40.0 38.0 40.0 38.0 40.0 74-75 38.26525 40.0 38.0 40.0 38.0 40.0 76-77 38.290499999999994 40.0 38.0 40.0 38.0 40.0 78-79 38.29175 40.0 38.0 40.0 38.0 40.0 80 37.3405 38.0 38.0 40.0 32.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 2.0 24 2.0 25 4.0 26 8.0 27 13.0 28 19.0 29 21.0 30 36.0 31 37.0 32 64.0 33 57.0 34 74.0 35 125.0 36 163.0 37 257.0 38 532.0 39 2586.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.175 13.275 8.375 34.175 2 28.14070351758794 14.597989949748744 28.190954773869347 29.070351758793972 3 23.974999999999998 20.849999999999998 22.625 32.550000000000004 4 27.425 24.7 21.675 26.200000000000003 5 27.55 27.625 22.15 22.675 6 24.925 28.975 24.325 21.775 7 19.5 22.650000000000002 36.425000000000004 21.425 8 22.45 24.425 26.924999999999997 26.200000000000003 9 20.849999999999998 23.150000000000002 30.65 25.35 10-11 24.775 28.349999999999998 22.412499999999998 24.462500000000002 12-13 24.4875 23.6125 25.7 26.200000000000003 14-15 24.2875 25.1 24.762500000000003 25.85 16-17 23.9375 25.974999999999998 24.7375 25.35 18-19 24.1625 25.05 24.6 26.187500000000004 20-21 24.45 24.837500000000002 25.362499999999997 25.35 22-23 24.425 24.825 24.087500000000002 26.6625 24-25 24.462500000000002 24.625 24.175 26.737499999999997 26-27 24.1625 24.212500000000002 25.074999999999996 26.55 28-29 24.0625 24.525 24.712500000000002 26.700000000000003 30-31 25.275 24.9875 24.2875 25.45 32-33 24.925 23.974999999999998 24.3625 26.737499999999997 34-35 23.8125 24.575 25.1 26.5125 36-37 25.15 24.349999999999998 23.8625 26.637499999999996 38-39 24.45 24.2875 24.125 27.1375 40-41 23.8375 25.7125 24.2 26.25 42-43 25.35 24.224999999999998 24.2875 26.137500000000003 44-45 25.0625 24.337500000000002 24.325 26.275 46-47 24.25 24.5 24.45 26.8 48-49 24.9875 25.087500000000002 23.974999999999998 25.95 50-51 24.887500000000003 24.337500000000002 24.125 26.650000000000002 52-53 24.8 24.1125 23.549999999999997 27.537499999999998 54-55 25.2625 24.5375 23.575 26.625 56-57 25.3125 24.6125 24.1875 25.887500000000003 58-59 24.4125 24.425 23.8875 27.275 60-61 24.8625 24.0125 24.8 26.325 62-63 24.587500000000002 24.025 24.725 26.6625 64-65 24.962500000000002 24.05 23.925 27.0625 66-67 25.15 24.3625 23.5125 26.974999999999998 68-69 25.4625 24.462500000000002 24.3875 25.687500000000004 70-71 25.825 24.6625 23.45 26.0625 72-73 25.45 23.9 23.6875 26.9625 74-75 25.6 24.1125 23.9375 26.35 76-77 25.7625 24.4125 23.775 26.05 78-79 24.1875 25.474999999999998 23.5875 26.75 80 24.675 24.474999999999998 24.525 26.325 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 1.0 26 1.5 27 3.5 28 6.0 29 11.0 30 15.0 31 17.5 32 19.5 33 30.0 34 51.0 35 61.0 36 58.5 37 71.5 38 106.5 39 119.0 40 112.0 41 137.5 42 160.5 43 171.5 44 203.5 45 222.0 46 196.5 47 189.5 48 198.0 49 184.5 50 181.0 51 173.0 52 152.5 53 142.5 54 151.5 55 158.0 56 157.0 57 140.0 58 131.0 59 156.5 60 175.0 61 148.5 62 111.5 63 99.5 64 91.5 65 85.0 66 84.5 67 76.0 68 61.0 69 50.5 70 47.0 71 38.0 72 27.5 73 26.5 74 23.5 75 20.0 76 12.0 77 4.0 78 2.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 80 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.7062404870624 97.275 2 1.141552511415525 2.25 3 0.12683916793505834 0.375 4 0.025367833587011668 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 41 0.025 0.0 0.0 0.0 0.0 42 0.025 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.05 0.0 0.0 0.0 0.0 46 0.05 0.0 0.0 0.0 0.0 47 0.05 0.0 0.0 0.0 0.0 48 0.05 0.0 0.0 0.0 0.0 49 0.05 0.0 0.0 0.0 0.0 50 0.05 0.0 0.0 0.0 0.0 51 0.05 0.0 0.0 0.0 0.0 52 0.05 0.0 0.0 0.0 0.0 53 0.05 0.0 0.0 0.0 0.0 54 0.05 0.0 0.0 0.0 0.0 55 0.05 0.0 0.0 0.0 0.0 56 0.05 0.0 0.0 0.0 0.0 57 0.05 0.0 0.0 0.0 0.0 58 0.05 0.0 0.0 0.0 0.0 59 0.05 0.0 0.0 0.0 0.0 60 0.05 0.0 0.0 0.0 0.0 61 0.05 0.0 0.0 0.0 0.0 62 0.1 0.0 0.0 0.0 0.0 63 0.1 0.0 0.0 0.0 0.0 64 0.125 0.0 0.0 0.0 0.0 65 0.15 0.0 0.0 0.0 0.0 66 0.15 0.0 0.0 0.0 0.0 67 0.225 0.0 0.0 0.0 0.0 68 0.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12711894 read2 length is 80 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12711894_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 80 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.546 38.0 38.0 38.0 32.0 38.0 2 36.53 38.0 38.0 38.0 32.0 38.0 3 36.5015 38.0 38.0 38.0 32.0 38.0 4 36.4235 38.0 38.0 38.0 32.0 38.0 5 36.49275 38.0 38.0 38.0 32.0 38.0 6 38.49475 40.0 38.0 40.0 38.0 40.0 7 38.66 40.0 38.0 40.0 38.0 40.0 8 38.618 40.0 38.0 40.0 38.0 40.0 9 38.62725 40.0 38.0 40.0 38.0 40.0 10-11 38.642875000000004 40.0 38.0 40.0 38.0 40.0 12-13 38.510625000000005 40.0 38.0 40.0 38.0 40.0 14-15 38.604 40.0 38.0 40.0 38.0 40.0 16-17 38.58325 40.0 38.0 40.0 38.0 40.0 18-19 38.6165 40.0 38.0 40.0 38.0 40.0 20-21 38.515 40.0 38.0 40.0 38.0 40.0 22-23 38.59925 40.0 38.0 40.0 38.0 40.0 24-25 38.567625 40.0 38.0 40.0 38.0 40.0 26-27 38.50375 40.0 38.0 40.0 38.0 40.0 28-29 38.625125 40.0 38.0 40.0 38.0 40.0 30-31 38.5995 40.0 38.0 40.0 38.0 40.0 32-33 38.599999999999994 40.0 38.0 40.0 38.0 40.0 34-35 38.495374999999996 40.0 38.0 40.0 38.0 40.0 36-37 38.472375 40.0 38.0 40.0 38.0 40.0 38-39 38.3655 40.0 38.0 40.0 38.0 40.0 40-41 38.518375 40.0 38.0 40.0 38.0 40.0 42-43 38.401624999999996 40.0 38.0 40.0 38.0 40.0 44-45 38.289125 40.0 38.0 40.0 38.0 40.0 46-47 38.310874999999996 40.0 38.0 40.0 38.0 40.0 48-49 38.36775 40.0 38.0 40.0 38.0 40.0 50-51 38.297 40.0 38.0 40.0 38.0 40.0 52-53 38.178 40.0 38.0 40.0 38.0 40.0 54-55 38.235375 40.0 38.0 40.0 38.0 40.0 56-57 38.323625 40.0 38.0 40.0 38.0 40.0 58-59 38.31075 40.0 38.0 40.0 38.0 40.0 60-61 38.248875 40.0 38.0 40.0 38.0 40.0 62-63 38.243125 40.0 38.0 40.0 38.0 40.0 64-65 38.23825 40.0 38.0 40.0 38.0 40.0 66-67 38.13275 40.0 38.0 40.0 38.0 40.0 68-69 38.054625 40.0 38.0 40.0 38.0 40.0 70-71 37.98525 40.0 38.0 40.0 38.0 40.0 72-73 37.992125 40.0 38.0 40.0 38.0 40.0 74-75 38.016999999999996 40.0 38.0 40.0 38.0 40.0 76-77 38.002125 40.0 38.0 40.0 38.0 40.0 78-79 37.781000000000006 40.0 38.0 40.0 35.0 40.0 80 36.0145 38.0 38.0 40.0 32.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 5.0 18 2.0 19 0.0 20 2.0 21 1.0 22 5.0 23 9.0 24 4.0 25 6.0 26 10.0 27 12.0 28 35.0 29 12.0 30 28.0 31 38.0 32 46.0 33 48.0 34 84.0 35 128.0 36 168.0 37 273.0 38 644.0 39 2439.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.1 19.2 10.45 30.25 2 30.725 24.65 22.975 21.65 3 24.6 25.825 24.75 24.825 4 26.150000000000002 30.325000000000003 19.725 23.799999999999997 5 29.775000000000002 29.975 19.2 21.05 6 25.85 31.775 19.75 22.625 7 25.025 17.9 32.15 24.925 8 26.35 20.849999999999998 21.7 31.1 9 25.35 21.8 25.1 27.750000000000004 10-11 28.7 26.375 19.2625 25.662499999999998 12-13 27.0 22.662499999999998 22.95 27.3875 14-15 26.6625 24.625 23.375 25.337500000000002 16-17 26.950000000000003 23.674999999999997 22.475 26.900000000000002 18-19 26.187500000000004 24.1125 23.3875 26.3125 20-21 27.1375 24.3875 23.1 25.374999999999996 22-23 27.150000000000002 24.0375 22.900000000000002 25.912499999999998 24-25 28.012500000000003 23.2875 22.787499999999998 25.912499999999998 26-27 26.775 24.375 23.2625 25.587500000000002 28-29 26.8125 23.6375 23.1875 26.3625 30-31 26.437500000000004 24.425 22.900000000000002 26.237500000000004 32-33 26.437500000000004 23.849999999999998 22.85 26.8625 34-35 26.9625 23.849999999999998 23.2375 25.95 36-37 26.950000000000003 23.95 23.1375 25.9625 38-39 27.3875 23.925 22.8625 25.825 40-41 27.125 23.962500000000002 23.1625 25.75 42-43 27.525 23.7 22.4625 26.3125 44-45 26.8375 24.3875 24.025 24.75 46-47 27.35 23.875 22.900000000000002 25.874999999999996 48-49 26.75 23.9375 23.2375 26.075 50-51 27.8125 24.8125 22.787499999999998 24.587500000000002 52-53 27.4125 23.775 22.875 25.937500000000004 54-55 26.5375 24.1125 23.375 25.974999999999998 56-57 26.8625 24.1625 23.3375 25.637500000000003 58-59 26.55 24.9875 23.549999999999997 24.9125 60-61 26.5 24.087500000000002 23.75 25.662499999999998 62-63 27.5625 24.6125 22.7375 25.087500000000002 64-65 26.75 24.175 23.974999999999998 25.1 66-67 26.3125 24.5625 24.349999999999998 24.775 68-69 27.025 24.462500000000002 24.125 24.3875 70-71 26.55 24.325 24.2875 24.837500000000002 72-73 27.462500000000002 23.7875 24.175 24.575 74-75 27.0625 24.45 23.1375 25.35 76-77 26.05 22.55 25.0 26.400000000000002 78-79 25.6125 24.3625 24.825 25.2 80 26.85 23.3 23.625 26.224999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 1.0 28 2.5 29 4.0 30 5.0 31 5.0 32 5.5 33 12.0 34 20.0 35 22.0 36 30.0 37 42.0 38 61.5 39 89.0 40 101.0 41 120.5 42 148.0 43 163.0 44 175.0 45 180.0 46 193.5 47 217.5 48 212.5 49 185.5 50 174.0 51 193.0 52 196.0 53 185.5 54 185.0 55 179.0 56 163.0 57 148.5 58 147.0 59 158.0 60 172.0 61 155.0 62 121.0 63 105.5 64 103.0 65 99.0 66 94.0 67 85.5 68 73.0 69 60.0 70 56.0 71 49.0 72 36.5 73 23.5 74 14.0 75 12.0 76 8.5 77 4.0 78 2.5 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 80 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.7 #Duplication Level Percentage of deduplicated Percentage of total 1 98.91084093211752 97.625 2 0.9371833839918946 1.8499999999999999 3 0.10131712259371835 0.3 4 0.025329280648429587 0.1 5 0.025329280648429587 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 5 0.125 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 57 0.025 0.0 0.0 0.0 0.0 58 0.025 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.025 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.075 0.0 0.0 0.0 0.0 63 0.075 0.0 0.0 0.0 0.0 64 0.1 0.0 0.0 0.0 0.0 65 0.125 0.0 0.0 0.0 0.0 66 0.125 0.0 0.0 0.0 0.0 67 0.2 0.0 0.0 0.0 0.0 68 0.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1446455 spots for SRR12711894.sra Written 1446455 spots for SRR12711894.sra Read 1446465 spots for SRR12711894.sra Written 1446465 spots for SRR12711894.sra Read 1446455 spots for SRR12711894.sra Written 1446455 spots for SRR12711894.sra Read 1446455 spots for SRR12711894.sra Written 1446455 spots for SRR12711894.sra Read 1446455 spots for SRR12711894.sra Written 1446455 spots for SRR12711894.sra Read 1446455 spots for SRR12711894.sra Written 1446455 spots for SRR12711894.sra Read 1446455 spots for SRR12711894.sra Written 1446455 spots for SRR12711894.sra Read 1446455 spots for SRR12711894.sra Written 1446455 spots for SRR12711894.sra Read 1446455 spots for SRR12711894.sra Written 1446455 spots for SRR12711894.sra Read 1446455 spots for SRR12711894.sra Written 1446455 spots for SRR12711894.sra Read 1446455 spots for SRR12711894.sra Written 1446455 spots for SRR12711894.sra Read 1446455 spots for SRR12711894.sra Written 1446455 spots for SRR12711894.sra Read 1446455 spots for SRR12711894.sra Written 1446455 spots for SRR12711894.sra Read 1446455 spots for SRR12711894.sra Written 1446455 spots for SRR12711894.sra Read 1446455 spots for SRR12711894.sra Written 1446455 spots for SRR12711894.sra Read 1446455 spots for SRR12711894.sra Written 1446455 spots for SRR12711894.sra Read 1446455 spots for SRR12711894.sra Written 1446455 spots for SRR12711894.sra Read 1446455 spots for SRR12711894.sra Written 1446455 spots for SRR12711894.sra Read 1446455 spots for SRR12711894.sra Written 1446455 spots for SRR12711894.sra Read 1446455 spots for SRR12711894.sra Written 1446455 spots for SRR12711894.sra SRR ids: ['SRR12711894.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3s1z1pb4 SRR12711894.sra spots: 28929110 blocks: [[1, 1446455], [1446456, 2892910], [2892911, 4339365], [4339366, 5785820], [5785821, 7232275], [7232276, 8678730], [8678731, 10125185], [10125186, 11571640], [11571641, 13018095], [13018096, 14464550], [14464551, 15911005], [15911006, 17357460], [17357461, 18803915], [18803916, 20250370], [20250371, 21696825], [21696826, 23143280], [23143281, 24589735], [24589736, 26036190], [26036191, 27482645], [27482646, 28929110]] SRR12711894 file size 5769771 SRR12711894 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12711894 SRR12711894_1.fastq SRR12711894_2.fastq Input file: SRR12711894_1.fastq Paired file: SRR12711894_2.fastq trimmed: SRR12711894-trimmed-pair1.fastq, SRR12711894-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 18:29:38 2024 >> started Sat Dec 7 18:30:02 2024 >> done (23.944s) 28929110 read pairs processed; of these: 1556 ( 0.01%) short read pairs filtered out after trimming by size control 31555 ( 0.11%) empty read pairs filtered out after trimming by size control 28895999 (99.89%) read pairs available; of these: 247818 ( 0.86%) trimmed read pairs available after processing 28648181 (99.14%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 5 0.00% 20 8 0.00% 21 8 0.00% 22 7 0.00% 23 11 0.00% 24 14 0.00% 25 16 0.00% 26 22 0.00% 27 35 0.00% 28 36 0.00% 29 48 0.00% 30 89 0.00% 31 81 0.00% 32 111 0.00% 33 120 0.00% 34 109 0.00% 35 186 0.00% 36 195 0.00% 37 221 0.00% 38 252 0.00% 39 275 0.00% 40 371 0.00% 41 349 0.00% 42 410 0.00% 43 441 0.00% 44 461 0.00% 45 494 0.00% 46 574 0.00% 47 695 0.00% 48 803 0.00% 49 1589 0.01% 50 1436 0.00% 51 1998 0.01% 52 1980 0.01% 53 1811 0.01% 54 2820 0.01% 55 2064 0.01% 56 2826 0.01% 57 2693 0.01% 58 3724 0.01% 59 3606 0.01% 60 4080 0.01% 61 4834 0.02% 62 4361 0.02% 63 5759 0.02% 64 5506 0.02% 65 6320 0.02% 66 5868 0.02% 67 6972 0.02% 68 7134 0.02% 69 8907 0.03% 70 9113 0.03% 71 11227 0.04% 72 11602 0.04% 73 13726 0.05% 74 15537 0.05% 75 16012 0.06% 76 16706 0.06% 77 17656 0.06% 78 20699 0.07% 79 22802 0.08% 80 28648181 99.14% 28895999 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=3.23 fanout-score-rank=13 prefix-density=0.40 prefix-fanout=3.1 sequence=AGGCAAGGAACCCACTTGGAGCGGATCAGGTACTCGATCTGCTTCAGGAGAGACTCCACGGAGAGAGGGGGCAGGTA criterion=fanout-score sequence-density=0.05 sequence-density-rank=33 fanout-score=7.60 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=3.6 sequence=GGCGGCGGTGGCGACGACGAGGAGGCTGGAGGTCTGGACCTCGGCTTCAGGGTACATGTTGCAGCCGTTGCAGCCGCTGCCGCACTTGCAGGATGACCCGCAGTTGCAGTTTCCTCCGCAGCAAGACATCTTCGGTCGAGTGCTCGAACTTGCTTAG criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=4.01 fanout-score-rank=11 prefix-density=0.54 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.16 sequence-density-rank=22 fanout-score=15.33 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=4.9 sequence=GAGAACCTCTTCGACCAC SRR12711894 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 18:30:35 Started mapping on | Dec 07 18:30:36 Finished on | Dec 07 18:31:34 Mapping speed, Million of reads per hour | 1793.54 Number of input reads | 28895999 Average input read length | 159 UNIQUE READS: Uniquely mapped reads number | 26954697 Uniquely mapped reads % | 93.28% Average mapped length | 159.45 Number of splices: Total | 12738131 Number of splices: Annotated (sjdb) | 12128426 Number of splices: GT/AG | 12571424 Number of splices: GC/AG | 148268 Number of splices: AT/AC | 5603 Number of splices: Non-canonical | 12836 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 1.87 Insertion rate per base | 0.01% Insertion average length | 1.67 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 959720 % of reads mapped to multiple loci | 3.32% Number of reads mapped to too many loci | 200136 % of reads mapped to too many loci | 0.69% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.94% % of reads unmapped: other | 1.77% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 982047 982047 982047 N_multimapping 959720 959720 959720 N_noFeature 718278 26279913 902521 N_ambiguous 558044 1930 68482 UnstrandedReadsAssigned:25678375 PositiveStrandReadsAssigned:672854 NegativeStrandReadsAssigned:25983694 Dataset is classified negative stranded MeadianReadLen=80 20thPercentileLength=80 echo kmer=75 SRR12711894 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12711894-trimmed-pair1.fastq SRR12711894-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,895,999 reads, 26,254,700 reads pseudoaligned [quant] estimated average fragment length: 146.949 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,273 rounds 52973 SRR12711894.ke.tsv 35125 SRR12711894.se.tsv 88098 total ==> SRR12711894.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 790.144 29.8141 1.95483 PNS24247 1044 898.051 47.6334 2.74793 PNS24249 1928 1782.05 41.6031 1.20948 PNS24246 1044 898.051 47.6334 2.74793 PNS24248 1044 898.051 47.6334 2.74793 PNS24244 1471 1325.05 162.683 6.36067 PNS24243 293 148.569 0 0 KQK14069 1603 1457.05 851.806 30.2873 KQK14071 474 328.943 32.5547 5.12728 ==> SRR12711894.se.tsv <== BRADI_1g14170v3 969 BRADI_1g53295v3 7 BRADI_1g59795v3 333 BRADI_1g07683v3 0 BRADI_1g00485v3 16 BRADI_1g20270v3 1528 BRADI_1g74790v3 107 BRADI_1g09890v3 0 BRADI_1g77505v3 516 BRADI_1g48960v3 0 SRR12711894 completed mapping pipeline successfully