Starting /dee2/code/volunteer_pipeline.sh SRR12712203 current disk space = 1540549799936 free memory = 1408656360 SRR12712203 SRAfilesize 22b0dcb5007101bc639ddcfeffe998dd SRR12712203.sra SRR12712203.sra file validated SRR12712203 is paired end SRR12712203 is conventional basespace SRR12712203 read1 length is 80 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12712203_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 80 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 37.0655 38.0 38.0 38.0 32.0 38.0 2 36.75825 38.0 38.0 38.0 32.0 38.0 3 36.7985 38.0 38.0 38.0 32.0 38.0 4 36.864 38.0 38.0 38.0 32.0 38.0 5 36.7765 38.0 38.0 38.0 32.0 38.0 6 38.8715 40.0 38.0 40.0 38.0 40.0 7 38.77475 40.0 38.0 40.0 38.0 40.0 8 38.72325 40.0 38.0 40.0 38.0 40.0 9 38.74 40.0 38.0 40.0 38.0 40.0 10-11 38.772499999999994 40.0 38.0 40.0 38.0 40.0 12-13 38.843375 40.0 38.0 40.0 38.0 40.0 14-15 38.739375 40.0 38.0 40.0 38.0 40.0 16-17 38.664249999999996 40.0 38.0 40.0 38.0 40.0 18-19 38.834625 40.0 38.0 40.0 38.0 40.0 20-21 38.9255 40.0 38.0 40.0 38.0 40.0 22-23 38.8735 40.0 38.0 40.0 38.0 40.0 24-25 38.729875 40.0 38.0 40.0 38.0 40.0 26-27 38.71225 40.0 38.0 40.0 38.0 40.0 28-29 38.778375 40.0 38.0 40.0 38.0 40.0 30-31 38.730374999999995 40.0 38.0 40.0 38.0 40.0 32-33 38.709500000000006 40.0 38.0 40.0 38.0 40.0 34-35 38.75175 40.0 38.0 40.0 38.0 40.0 36-37 38.75125 40.0 38.0 40.0 38.0 40.0 38-39 38.656125 40.0 38.0 40.0 38.0 40.0 40-41 38.637 40.0 38.0 40.0 38.0 40.0 42-43 38.661500000000004 40.0 38.0 40.0 38.0 40.0 44-45 38.594625 40.0 38.0 40.0 38.0 40.0 46-47 38.63275 40.0 38.0 40.0 38.0 40.0 48-49 38.654125 40.0 38.0 40.0 38.0 40.0 50-51 38.613249999999994 40.0 38.0 40.0 38.0 40.0 52-53 38.624375 40.0 38.0 40.0 38.0 40.0 54-55 38.644875 40.0 38.0 40.0 38.0 40.0 56-57 38.504875 40.0 38.0 40.0 38.0 40.0 58-59 38.622625 40.0 38.0 40.0 38.0 40.0 60-61 38.466375 40.0 38.0 40.0 38.0 40.0 62-63 38.520375 40.0 38.0 40.0 38.0 40.0 64-65 38.503 40.0 38.0 40.0 38.0 40.0 66-67 38.528625 40.0 38.0 40.0 38.0 40.0 68-69 38.4675 40.0 38.0 40.0 38.0 40.0 70-71 38.480999999999995 40.0 38.0 40.0 38.0 40.0 72-73 38.409875 40.0 38.0 40.0 38.0 40.0 74-75 38.546625 40.0 38.0 40.0 38.0 40.0 76-77 38.416125 40.0 38.0 40.0 38.0 40.0 78-79 38.451375 40.0 38.0 40.0 38.0 40.0 80 37.63275 38.0 38.0 40.0 32.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 2.0 25 1.0 26 10.0 27 6.0 28 14.0 29 19.0 30 27.0 31 39.0 32 50.0 33 57.0 34 81.0 35 126.0 36 132.0 37 236.0 38 525.0 39 2674.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.95 14.224999999999998 7.449999999999999 35.375 2 26.654964894684053 15.772316950852558 30.416248746238715 27.156469408224677 3 22.325 19.775000000000002 23.599999999999998 34.300000000000004 4 25.224999999999998 25.074999999999996 21.224999999999998 28.475 5 26.0 28.475 21.575 23.95 6 23.65 30.575000000000003 23.724999999999998 22.05 7 18.975 23.7 38.175 19.15 8 21.025 23.5 29.125 26.35 9 19.650000000000002 22.85 32.175 25.324999999999996 10-11 22.3625 29.15 23.325000000000003 25.162499999999998 12-13 23.5625 23.875 26.325 26.237500000000004 14-15 23.3 25.2 26.0125 25.4875 16-17 23.775 25.4625 25.2875 25.474999999999998 18-19 23.4625 25.8625 25.2 25.474999999999998 20-21 22.675 25.7875 25.55 25.9875 22-23 23.775 25.374999999999996 24.95 25.900000000000002 24-25 23.4125 24.975 25.5625 26.05 26-27 23.3375 25.15 25.2875 26.224999999999998 28-29 24.3 25.2 24.0125 26.487500000000004 30-31 23.849999999999998 25.0 24.762500000000003 26.387500000000003 32-33 22.925 25.825 25.0 26.25 34-35 24.1125 24.837500000000002 25.575 25.474999999999998 36-37 24.0375 24.55 24.975 26.437500000000004 38-39 23.1875 25.374999999999996 25.412499999999998 26.025 40-41 24.3125 25.1 25.575 25.0125 42-43 23.5 24.975 25.4375 26.087500000000002 44-45 23.7375 25.5375 25.0125 25.7125 46-47 23.6375 25.75 24.1625 26.450000000000003 48-49 23.65 24.7 24.875 26.775 50-51 24.0375 25.0125 24.6125 26.337500000000002 52-53 23.2125 25.3 25.112499999999997 26.375 54-55 23.8875 24.425 25.112499999999997 26.575 56-57 24.2 25.0375 24.925 25.837500000000002 58-59 23.2875 25.2875 25.162499999999998 26.2625 60-61 24.25 24.25 25.0625 26.437500000000004 62-63 24.025 24.7 25.2625 26.0125 64-65 24.0625 24.4125 24.45 27.075 66-67 24.975 23.6875 25.3 26.0375 68-69 23.75 24.375 25.7375 26.137500000000003 70-71 24.5 24.625 24.325 26.55 72-73 23.525 24.9 24.587500000000002 26.987499999999997 74-75 23.8125 23.825 25.337500000000002 27.025 76-77 23.4375 24.45 25.4625 26.650000000000002 78-79 24.0125 24.75 24.962500000000002 26.275 80 22.55 26.450000000000003 25.374999999999996 25.624999999999996 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 2.0 24 3.5 25 4.0 26 3.5 27 2.5 28 6.5 29 11.0 30 11.0 31 16.0 32 25.5 33 36.5 34 48.0 35 53.0 36 62.0 37 88.5 38 123.0 39 133.5 40 127.0 41 148.5 42 178.5 43 196.5 44 214.5 45 223.0 46 234.0 47 218.0 48 191.0 49 185.0 50 179.0 51 190.0 52 178.5 53 156.5 54 158.0 55 159.0 56 143.5 57 127.0 58 118.0 59 111.5 60 113.0 61 115.5 62 104.5 63 86.0 64 71.0 65 61.0 66 63.0 67 67.5 68 55.5 69 38.0 70 35.0 71 30.5 72 22.5 73 16.0 74 10.0 75 7.0 76 4.5 77 1.5 78 0.5 79 0.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.3 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 80 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.01365705614568 97.875 2 0.8851795649974709 1.7500000000000002 3 0.025290844714213456 0.075 4 0.07587253414264036 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.05 0.0 0.0 0.0 0.0 55 0.05 0.0 0.0 0.0 0.0 56 0.05 0.0 0.0 0.0 0.0 57 0.05 0.0 0.0 0.0 0.0 58 0.05 0.0 0.0 0.0 0.0 59 0.05 0.0 0.0 0.0 0.0 60 0.05 0.0 0.0 0.0 0.0 61 0.05 0.0 0.0 0.0 0.0 62 0.05 0.0 0.0 0.0 0.0 63 0.075 0.0 0.0 0.0 0.0 64 0.075 0.0 0.0 0.0 0.0 65 0.1 0.0 0.0 0.0 0.0 66 0.1 0.0 0.0 0.0 0.0 67 0.1 0.0 0.0 0.0 0.0 68 0.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12712203 read2 length is 80 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12712203_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 80 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.47725 38.0 38.0 38.0 32.0 38.0 2 36.339 38.0 38.0 38.0 32.0 38.0 3 36.4575 38.0 38.0 38.0 32.0 38.0 4 36.4415 38.0 38.0 38.0 32.0 38.0 5 36.4385 38.0 38.0 38.0 32.0 38.0 6 38.46375 40.0 38.0 40.0 38.0 40.0 7 38.49625 40.0 38.0 40.0 38.0 40.0 8 38.5765 40.0 38.0 40.0 38.0 40.0 9 38.5915 40.0 38.0 40.0 38.0 40.0 10-11 38.637375 40.0 38.0 40.0 38.0 40.0 12-13 38.505624999999995 40.0 38.0 40.0 38.0 40.0 14-15 38.4815 40.0 38.0 40.0 38.0 40.0 16-17 38.38975 40.0 38.0 40.0 38.0 40.0 18-19 38.537875 40.0 38.0 40.0 38.0 40.0 20-21 38.530625 40.0 38.0 40.0 38.0 40.0 22-23 38.486000000000004 40.0 38.0 40.0 38.0 40.0 24-25 38.49225 40.0 38.0 40.0 38.0 40.0 26-27 38.528875 40.0 38.0 40.0 38.0 40.0 28-29 38.494625 40.0 38.0 40.0 38.0 40.0 30-31 38.563375 40.0 38.0 40.0 38.0 40.0 32-33 38.515625 40.0 38.0 40.0 38.0 40.0 34-35 38.484750000000005 40.0 38.0 40.0 38.0 40.0 36-37 38.38275 40.0 38.0 40.0 38.0 40.0 38-39 38.37075 40.0 38.0 40.0 38.0 40.0 40-41 38.421625 40.0 38.0 40.0 38.0 40.0 42-43 38.33425 40.0 38.0 40.0 38.0 40.0 44-45 38.347 40.0 38.0 40.0 38.0 40.0 46-47 38.291624999999996 40.0 38.0 40.0 38.0 40.0 48-49 38.295 40.0 38.0 40.0 38.0 40.0 50-51 38.1655 40.0 38.0 40.0 38.0 40.0 52-53 38.15675 40.0 38.0 40.0 38.0 40.0 54-55 38.241125 40.0 38.0 40.0 38.0 40.0 56-57 38.134125 40.0 38.0 40.0 38.0 40.0 58-59 38.195499999999996 40.0 38.0 40.0 38.0 40.0 60-61 38.194625 40.0 38.0 40.0 38.0 40.0 62-63 38.235749999999996 40.0 38.0 40.0 38.0 40.0 64-65 38.283500000000004 40.0 38.0 40.0 38.0 40.0 66-67 38.174 40.0 38.0 40.0 38.0 40.0 68-69 38.034625 40.0 38.0 40.0 38.0 40.0 70-71 38.043375 40.0 38.0 40.0 38.0 40.0 72-73 37.916624999999996 40.0 38.0 40.0 38.0 40.0 74-75 38.023875000000004 40.0 38.0 40.0 38.0 40.0 76-77 37.968625 40.0 38.0 40.0 38.0 40.0 78-79 37.81162500000001 40.0 38.0 40.0 35.0 40.0 80 36.08025 38.0 38.0 40.0 32.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 1.0 17 3.0 18 3.0 19 2.0 20 0.0 21 4.0 22 4.0 23 4.0 24 10.0 25 9.0 26 6.0 27 19.0 28 22.0 29 28.0 30 35.0 31 40.0 32 46.0 33 72.0 34 81.0 35 108.0 36 163.0 37 245.0 38 625.0 39 2469.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.175 20.599999999999998 9.35 31.874999999999996 2 29.875 25.75 25.874999999999996 18.5 3 22.775000000000002 27.925 25.95 23.35 4 25.45 31.6 20.875 22.075 5 27.6 32.25 19.05 21.099999999999998 6 24.925 34.975 19.0 21.099999999999998 7 24.025 18.7 32.824999999999996 24.45 8 24.8 23.125 23.849999999999998 28.225 9 24.975 22.95 26.450000000000003 25.624999999999996 10-11 27.1375 28.012500000000003 20.549999999999997 24.3 12-13 27.400000000000002 23.2875 23.275000000000002 26.0375 14-15 25.5375 24.4125 24.5125 25.5375 16-17 26.9625 24.775 23.8625 24.4 18-19 27.3375 25.525 23.7125 23.425 20-21 26.737499999999997 25.2875 23.5875 24.3875 22-23 27.150000000000002 24.75 23.5125 24.587500000000002 24-25 26.887499999999996 24.6875 23.6375 24.7875 26-27 26.9125 25.25 22.9875 24.85 28-29 27.400000000000002 25.0125 23.2875 24.3 30-31 26.087500000000002 25.074999999999996 23.775 25.0625 32-33 26.55 25.575 24.1375 23.7375 34-35 26.950000000000003 24.375 24.337500000000002 24.337500000000002 36-37 26.8125 24.9 23.6625 24.625 38-39 26.674999999999997 25.112499999999997 23.75 24.462500000000002 40-41 26.35 25.6 23.5125 24.5375 42-43 26.187500000000004 25.224999999999998 23.6875 24.9 44-45 26.25 25.575 24.1125 24.0625 46-47 26.787499999999998 24.474999999999998 24.3125 24.425 48-49 26.3625 24.7 24.4125 24.525 50-51 26.387500000000003 24.8625 24.25 24.5 52-53 26.737499999999997 24.3625 24.1125 24.7875 54-55 25.387500000000003 25.362499999999997 23.875 25.374999999999996 56-57 25.674999999999997 25.6125 24.325 24.3875 58-59 26.75 25.025 24.1875 24.0375 60-61 26.387500000000003 25.4375 23.925 24.25 62-63 26.6 24.5625 24.5375 24.3 64-65 26.174999999999997 25.95 23.9375 23.9375 66-67 25.912499999999998 25.7375 24.462500000000002 23.8875 68-69 26.937499999999996 25.25 24.0 23.8125 70-71 27.3625 24.5625 24.1125 23.962500000000002 72-73 25.887500000000003 25.5 24.5375 24.075 74-75 26.1625 25.124999999999996 24.825 23.8875 76-77 26.55 24.6875 24.1625 24.6 78-79 26.150000000000002 25.5 24.625 23.724999999999998 80 27.425 24.175 24.425 23.974999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 0.5 23 1.5 24 4.5 25 6.0 26 4.0 27 4.5 28 4.5 29 4.0 30 6.0 31 13.5 32 19.0 33 22.0 34 31.5 35 36.0 36 54.5 37 72.0 38 82.5 39 106.5 40 119.0 41 133.5 42 173.0 43 193.0 44 201.0 45 214.0 46 213.5 47 217.0 48 230.5 49 214.5 50 189.0 51 188.0 52 180.0 53 170.5 54 155.5 55 143.0 56 155.0 57 149.0 58 129.0 59 125.5 60 124.0 61 124.5 62 105.5 63 91.5 64 85.5 65 74.0 66 71.0 67 63.5 68 55.0 69 47.5 70 44.0 71 36.0 72 25.0 73 20.5 74 12.0 75 5.0 76 3.0 77 2.0 78 2.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 80 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.9 #Duplication Level Percentage of deduplicated Percentage of total 1 98.93832153690597 97.85000000000001 2 1.0111223458038423 2.0 3 0.05055611729019212 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.05 0.0 0.0 0.0 0.0 55 0.05 0.0 0.0 0.0 0.0 56 0.05 0.0 0.0 0.0 0.0 57 0.05 0.0 0.0 0.0 0.0 58 0.05 0.0 0.0 0.0 0.0 59 0.05 0.0 0.0 0.0 0.0 60 0.05 0.0 0.0 0.0 0.0 61 0.05 0.0 0.0 0.0 0.0 62 0.05 0.0 0.0 0.0 0.0 63 0.075 0.0 0.0 0.0 0.0 64 0.075 0.0 0.0 0.0 0.0 65 0.1 0.0 0.0 0.0 0.0 66 0.1 0.0 0.0 0.0 0.0 67 0.1 0.0 0.0 0.0 0.0 68 0.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1360338 spots for SRR12712203.sra Written 1360338 spots for SRR12712203.sra Read 1360338 spots for SRR12712203.sra Written 1360338 spots for SRR12712203.sra Read 1360338 spots for SRR12712203.sra Written 1360338 spots for SRR12712203.sra Read 1360338 spots for SRR12712203.sra Written 1360338 spots for SRR12712203.sra Read 1360338 spots for SRR12712203.sra Written 1360338 spots for SRR12712203.sra Read 1360338 spots for SRR12712203.sra Written 1360338 spots for SRR12712203.sra Read 1360338 spots for SRR12712203.sra Written 1360338 spots for SRR12712203.sra Read 1360338 spots for SRR12712203.sra Written 1360338 spots for SRR12712203.sra Read 1360338 spots for SRR12712203.sra Written 1360338 spots for SRR12712203.sra Read 1360338 spots for SRR12712203.sra Written 1360338 spots for SRR12712203.sra Read 1360338 spots for SRR12712203.sra Written 1360338 spots for SRR12712203.sra Read 1360338 spots for SRR12712203.sra Written 1360338 spots for SRR12712203.sra Read 1360338 spots for SRR12712203.sra Written 1360338 spots for SRR12712203.sra Read 1360338 spots for SRR12712203.sra Written 1360338 spots for SRR12712203.sra Read 1360338 spots for SRR12712203.sra Written 1360338 spots for SRR12712203.sra Read 1360338 spots for SRR12712203.sra Written 1360338 spots for SRR12712203.sra Read 1360354 spots for SRR12712203.sra Written 1360354 spots for SRR12712203.sra Read 1360338 spots for SRR12712203.sra Written 1360338 spots for SRR12712203.sra Read 1360338 spots for SRR12712203.sra Written 1360338 spots for SRR12712203.sra Read 1360338 spots for SRR12712203.sra Written 1360338 spots for SRR12712203.sra SRR ids: ['SRR12712203.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kl3ks38a SRR12712203.sra spots: 27206776 blocks: [[1, 1360338], [1360339, 2720676], [2720677, 4081014], [4081015, 5441352], [5441353, 6801690], [6801691, 8162028], [8162029, 9522366], [9522367, 10882704], [10882705, 12243042], [12243043, 13603380], [13603381, 14963718], [14963719, 16324056], [16324057, 17684394], [17684395, 19044732], [19044733, 20405070], [20405071, 21765408], [21765409, 23125746], [23125747, 24486084], [24486085, 25846422], [25846423, 27206776]] SRR12712203 file size 5424968 SRR12712203 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12712203 SRR12712203_1.fastq SRR12712203_2.fastq Input file: SRR12712203_1.fastq Paired file: SRR12712203_2.fastq trimmed: SRR12712203-trimmed-pair1.fastq, SRR12712203-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 18:35:38 2024 >> started Sat Dec 7 18:37:47 2024 >> done (129.294s) 27206776 read pairs processed; of these: 1394 ( 0.01%) short read pairs filtered out after trimming by size control 5292 ( 0.02%) empty read pairs filtered out after trimming by size control 27200090 (99.98%) read pairs available; of these: 153653 ( 0.56%) trimmed read pairs available after processing 27046437 (99.44%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 5 0.00% 20 3 0.00% 21 3 0.00% 22 5 0.00% 23 5 0.00% 24 7 0.00% 25 8 0.00% 26 10 0.00% 27 20 0.00% 28 23 0.00% 29 27 0.00% 30 34 0.00% 31 52 0.00% 32 51 0.00% 33 76 0.00% 34 77 0.00% 35 76 0.00% 36 103 0.00% 37 90 0.00% 38 110 0.00% 39 150 0.00% 40 153 0.00% 41 203 0.00% 42 204 0.00% 43 239 0.00% 44 278 0.00% 45 305 0.00% 46 301 0.00% 47 341 0.00% 48 385 0.00% 49 1157 0.00% 50 988 0.00% 51 1467 0.01% 52 1346 0.00% 53 1171 0.00% 54 1960 0.01% 55 1244 0.00% 56 1914 0.01% 57 1808 0.01% 58 2500 0.01% 59 2296 0.01% 60 2541 0.01% 61 3213 0.01% 62 2645 0.01% 63 3676 0.01% 64 3147 0.01% 65 4279 0.02% 66 3763 0.01% 67 4431 0.02% 68 4050 0.01% 69 5274 0.02% 70 5661 0.02% 71 6865 0.03% 72 7195 0.03% 73 8608 0.03% 74 9537 0.04% 75 9963 0.04% 76 10239 0.04% 77 11164 0.04% 78 12590 0.05% 79 13615 0.05% 80 27046437 99.44% 27200090 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=30 prefix-density=0.23 prefix-fanout=2.0 sequence=TTACCGCGGCTGCTGGCAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=13.97 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=1.1 sequence=GCTTTCTTTTCTTCAAAAATTCTTATATGTTAGCGGAAAAACCTTATCCATTAATAGCGGGAACTTCAAGAGCAGCTAGATCTAGAGGGAAGTTGTGAGCATTACGTTCGTGCATTACTTCCATACCAAGATTAGCACGGTTGATGATATCAGCCCAAGTATTAATAACGCGACCTTGACTATCAACTACAGATTGGTTGAAATTGAATCCATTTAGGTTGAACGCCATAGTACTAATACCTAAAGCAGTGAACCAGATTCCTACTACAGGCCAAGCAGCCAAGAAGAAGTGTAAAGAACGAGAGTTGTTGAAACTAGCATATTGGAAGATTAATCGGCCAAAATAACCATGAGCAGCCACAATATTATAAGTCTCTTCCTCTTGACCAAATTTGTAACCCTCATTAGCAGATTCATTTTCAGTAGTTTCCCTGATCAAACTAGAGGTTACCAAGGAACCATGCATAGCACTGAATAGGGAACCGCCGAAAACACCAGCTACACCTAACAT criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=3.35 fanout-score-rank=16 prefix-density=0.46 prefix-fanout=2.8 sequence=AAGGAGCTGGAGGAGGTGAAGAAGGAGTACCCTGACGCCTATGTCCGCATCATCGGCTTCGACAACACCAGGCAAGTGCAGTGCATCAGCTTCATCGCCTTCAAGCCACCGGGTTGTGAGGAGTCCGGCAAGGCCTAAGCAAGTTGATTTCTTATAATACAAGAACGGGTCACACCGATTTTATTTACCTTTTTCACACGTTTGTTTCATGTTGTATTTATGCATGTGATCTCTCCCAACAACCCGGATTAACTGTATTCATGAGTACTACTATTATAAGAGTACTACAACTATCGTTGGGAGAGGGGCATGTAATATAAACTCCGGTTATACATATTAAGATAAGTATA criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=19.85 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=5.5 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT SRR12712203 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 18:42:05 Started mapping on | Dec 07 18:42:06 Finished on | Dec 07 18:52:48 Mapping speed, Million of reads per hour | 152.52 Number of input reads | 27200090 Average input read length | 159 UNIQUE READS: Uniquely mapped reads number | 23556045 Uniquely mapped reads % | 86.60% Average mapped length | 159.32 Number of splices: Total | 11588241 Number of splices: Annotated (sjdb) | 10986255 Number of splices: GT/AG | 11421586 Number of splices: GC/AG | 139079 Number of splices: AT/AC | 5037 Number of splices: Non-canonical | 22539 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.02% Deletion average length | 2.16 Insertion rate per base | 0.02% Insertion average length | 1.99 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2092187 % of reads mapped to multiple loci | 7.69% Number of reads mapped to too many loci | 312128 % of reads mapped to too many loci | 1.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.88% % of reads unmapped: other | 2.68% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1552355 1552355 1552355 N_multimapping 2092187 2092187 2092187 N_noFeature 1175308 22855394 1358154 N_ambiguous 594392 2825 78290 UnstrandedReadsAssigned:21786345 PositiveStrandReadsAssigned:697826 NegativeStrandReadsAssigned:22119601 Dataset is classified negative stranded MeadianReadLen=80 20thPercentileLength=80 echo kmer=75 SRR12712203 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12712203-trimmed-pair1.fastq SRR12712203-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,200,090 reads, 22,850,579 reads pseudoaligned [quant] estimated average fragment length: 161.709 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,197 rounds 52973 SRR12712203.ke.tsv 35125 SRR12712203.se.tsv 88098 total ==> SRR12712203.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 775.445 0 0 PNS24247 1044 883.291 95.4755 6.67407 PNS24249 1928 1767.29 60.9339 2.12889 PNS24246 1044 883.291 95.4755 6.67407 PNS24248 1044 883.291 95.4755 6.67407 PNS24244 1471 1310.29 372.64 17.56 PNS24243 293 136.134 0 0 KQK14069 1603 1442.29 19940.7 853.669 KQK14071 474 314.49 133.372 26.1855 ==> SRR12712203.se.tsv <== BRADI_1g14170v3 20705 BRADI_1g53295v3 870 BRADI_1g59795v3 180 BRADI_1g07683v3 0 BRADI_1g00485v3 15 BRADI_1g20270v3 317 BRADI_1g74790v3 104 BRADI_1g09890v3 0 BRADI_1g77505v3 323 BRADI_1g48960v3 0 SRR12712203 completed mapping pipeline successfully