Starting /dee2/code/volunteer_pipeline.sh SRR12712204 current disk space = 1540558127104 free memory = 1597602056 SRR12712204 SRAfilesize b58360f53a1369eb214f44f75d134701 SRR12712204.sra SRR12712204.sra file validated SRR12712204 is paired end SRR12712204 is conventional basespace SRR12712204 read1 length is 80 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12712204_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 80 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.65075 38.0 38.0 38.0 32.0 38.0 2 36.865 38.0 38.0 38.0 32.0 38.0 3 36.5485 38.0 38.0 38.0 32.0 38.0 4 36.725 38.0 38.0 38.0 32.0 38.0 5 36.52075 38.0 38.0 38.0 32.0 38.0 6 38.66075 40.0 38.0 40.0 38.0 40.0 7 38.78125 40.0 38.0 40.0 38.0 40.0 8 38.85975 40.0 38.0 40.0 38.0 40.0 9 38.98225 40.0 38.0 40.0 38.0 40.0 10-11 38.9165 40.0 38.0 40.0 38.0 40.0 12-13 38.994875 40.0 38.0 40.0 38.0 40.0 14-15 38.7175 40.0 38.0 40.0 38.0 40.0 16-17 38.865125 40.0 38.0 40.0 38.0 40.0 18-19 38.938500000000005 40.0 38.0 40.0 38.0 40.0 20-21 38.953 40.0 38.0 40.0 38.0 40.0 22-23 38.86425 40.0 38.0 40.0 38.0 40.0 24-25 38.97125 40.0 38.0 40.0 38.0 40.0 26-27 38.649375 40.0 38.0 40.0 38.0 40.0 28-29 38.667625 40.0 38.0 40.0 38.0 40.0 30-31 38.86525 40.0 38.0 40.0 38.0 40.0 32-33 38.83025 40.0 38.0 40.0 38.0 40.0 34-35 38.450375 40.0 38.0 40.0 38.0 40.0 36-37 38.791624999999996 40.0 38.0 40.0 38.0 40.0 38-39 38.713875 40.0 38.0 40.0 38.0 40.0 40-41 38.842749999999995 40.0 38.0 40.0 38.0 40.0 42-43 38.792875 40.0 38.0 40.0 38.0 40.0 44-45 38.529125 40.0 38.0 40.0 38.0 40.0 46-47 38.767125 40.0 38.0 40.0 38.0 40.0 48-49 38.6725 40.0 38.0 40.0 38.0 40.0 50-51 38.70425 40.0 38.0 40.0 38.0 40.0 52-53 38.686 40.0 38.0 40.0 38.0 40.0 54-55 38.582125000000005 40.0 38.0 40.0 38.0 40.0 56-57 38.585 40.0 38.0 40.0 38.0 40.0 58-59 38.6085 40.0 38.0 40.0 38.0 40.0 60-61 38.736375 40.0 38.0 40.0 38.0 40.0 62-63 38.538124999999994 40.0 38.0 40.0 38.0 40.0 64-65 38.653625000000005 40.0 38.0 40.0 38.0 40.0 66-67 38.42875 40.0 38.0 40.0 38.0 40.0 68-69 38.149 40.0 38.0 40.0 38.0 40.0 70-71 38.587875 40.0 38.0 40.0 38.0 40.0 72-73 38.06975 40.0 38.0 40.0 38.0 40.0 74-75 38.372749999999996 40.0 38.0 40.0 38.0 40.0 76-77 38.4835 40.0 38.0 40.0 38.0 40.0 78-79 38.22987500000001 40.0 38.0 40.0 38.0 40.0 80 37.64975 38.0 38.0 40.0 32.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 1.0 24 2.0 25 4.0 26 6.0 27 9.0 28 11.0 29 21.0 30 29.0 31 38.0 32 47.0 33 68.0 34 70.0 35 103.0 36 149.0 37 271.0 38 468.0 39 2702.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.75 13.4 6.9750000000000005 35.875 2 27.595696772579437 15.036277207905929 28.971728796597446 28.396297222917187 3 22.525000000000002 19.400000000000002 23.125 34.949999999999996 4 26.775 24.375 20.775 28.075 5 27.200000000000003 27.6 20.75 24.45 6 23.625 29.95 23.150000000000002 23.275000000000002 7 19.775000000000002 22.775000000000002 36.975 20.474999999999998 8 21.224999999999998 23.025000000000002 28.175 27.575 9 22.175 22.05 30.875000000000004 24.9 10-11 25.4375 28.1625 22.0125 24.3875 12-13 24.474999999999998 23.4625 25.7625 26.3 14-15 23.5875 24.0375 24.887500000000003 27.487499999999997 16-17 24.75 24.3625 25.0 25.887500000000003 18-19 25.7625 24.2875 24.1875 25.7625 20-21 24.099999999999998 24.8625 25.55 25.4875 22-23 25.324999999999996 24.474999999999998 24.625 25.575 24-25 25.137500000000003 23.599999999999998 23.674999999999997 27.5875 26-27 24.637500000000003 23.799999999999997 24.625 26.937499999999996 28-29 25.412499999999998 24.725 24.1875 25.674999999999997 30-31 25.4 23.6375 24.5125 26.450000000000003 32-33 24.85 24.4125 24.975 25.7625 34-35 25.2 23.95 23.9125 26.937499999999996 36-37 24.925 24.2 24.3875 26.487500000000004 38-39 24.0375 23.775 24.837500000000002 27.35 40-41 24.85 24.337500000000002 24.5 26.3125 42-43 25.7375 24.15 24.4 25.7125 44-45 24.2625 24.2625 24.3625 27.1125 46-47 24.6625 24.05 25.2625 26.025 48-49 24.5125 23.2625 24.8 27.425 50-51 23.825 23.7375 24.4 28.037499999999998 52-53 25.912499999999998 24.0 24.5 25.587500000000002 54-55 24.9875 23.9125 24.587500000000002 26.5125 56-57 25.15 23.1875 25.0125 26.650000000000002 58-59 25.25 24.4375 23.3375 26.974999999999998 60-61 24.975 23.724999999999998 24.325 26.974999999999998 62-63 24.6 23.875 24.474999999999998 27.05 64-65 25.1 24.2875 24.5 26.1125 66-67 25.074999999999996 24.3875 23.7375 26.8 68-69 25.6 23.0125 24.587500000000002 26.8 70-71 25.6125 23.325000000000003 24.5625 26.5 72-73 25.7375 23.6375 23.275000000000002 27.35 74-75 25.087500000000002 23.724999999999998 24.25 26.937499999999996 76-77 26.275 24.025 23.65 26.05 78-79 25.074999999999996 24.025 24.725 26.174999999999997 80 23.775 23.325000000000003 25.5 27.400000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 2.0 26 1.0 27 2.0 28 3.0 29 7.0 30 12.0 31 13.0 32 18.5 33 32.0 34 39.5 35 38.0 36 55.5 37 78.5 38 97.0 39 113.5 40 117.0 41 129.5 42 143.0 43 164.0 44 186.5 45 189.0 46 199.5 47 203.0 48 197.5 49 193.5 50 188.0 51 172.5 52 157.5 53 162.5 54 168.5 55 170.0 56 158.5 57 153.5 58 146.5 59 132.0 60 131.0 61 130.5 62 121.5 63 102.5 64 92.5 65 93.0 66 85.0 67 65.0 68 56.5 69 52.5 70 45.0 71 45.0 72 45.5 73 36.5 74 18.5 75 10.0 76 7.0 77 5.5 78 4.5 79 1.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 80 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.2 #Duplication Level Percentage of deduplicated Percentage of total 1 98.24338085539715 96.475 2 1.680244399185336 3.3000000000000003 3 0.07637474541751527 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.025 0.0 0.0 0.0 29 0.0 0.025 0.0 0.0 0.0 30 0.0 0.025 0.0 0.0 0.0 31 0.0 0.025 0.0 0.0 0.0 32 0.0 0.025 0.0 0.0 0.0 33 0.0 0.025 0.0 0.0 0.0 34 0.0 0.025 0.0 0.0 0.0 35 0.0 0.025 0.0 0.0 0.0 36 0.0 0.025 0.0 0.0 0.0 37 0.0 0.025 0.0 0.0 0.0 38 0.0 0.025 0.0 0.0 0.0 39 0.0 0.025 0.0 0.0 0.0 40 0.0 0.025 0.0 0.0 0.0 41 0.0 0.025 0.0 0.0 0.0 42 0.0 0.025 0.0 0.0 0.0 43 0.0 0.025 0.0 0.0 0.0 44 0.0 0.025 0.0 0.0 0.0 45 0.0 0.025 0.0 0.0 0.0 46 0.0 0.025 0.0 0.0 0.0 47 0.0 0.025 0.0 0.0 0.0 48 0.0 0.025 0.0 0.0 0.0 49 0.0 0.025 0.0 0.0 0.0 50 0.0 0.025 0.0 0.0 0.0 51 0.0 0.025 0.0 0.0 0.0 52 0.0 0.025 0.0 0.0 0.0 53 0.0 0.025 0.0 0.0 0.0 54 0.025 0.025 0.0 0.0 0.0 55 0.025 0.025 0.0 0.0 0.0 56 0.025 0.025 0.0 0.0 0.0 57 0.025 0.025 0.0 0.0 0.0 58 0.025 0.025 0.0 0.0 0.0 59 0.025 0.025 0.0 0.0 0.0 60 0.025 0.025 0.0 0.0 0.0 61 0.025 0.025 0.0 0.0 0.0 62 0.025 0.025 0.0 0.0 0.0 63 0.025 0.025 0.0 0.0 0.0 64 0.025 0.025 0.0 0.0 0.0 65 0.025 0.025 0.0 0.0 0.0 66 0.025 0.025 0.0 0.0 0.0 67 0.05 0.025 0.0 0.0 0.0 68 0.075 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12712204 read2 length is 80 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12712204_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 80 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.01525 38.0 38.0 38.0 32.0 38.0 2 36.1445 38.0 38.0 38.0 32.0 38.0 3 35.48825 38.0 32.0 38.0 32.0 38.0 4 36.204 38.0 38.0 38.0 32.0 38.0 5 36.22375 38.0 38.0 38.0 32.0 38.0 6 38.36925 40.0 38.0 40.0 38.0 40.0 7 38.222 40.0 38.0 40.0 38.0 40.0 8 38.37675 40.0 38.0 40.0 38.0 40.0 9 38.11675 40.0 38.0 40.0 38.0 40.0 10-11 38.130875 40.0 38.0 40.0 35.0 40.0 12-13 38.160125 40.0 38.0 40.0 38.0 40.0 14-15 38.372749999999996 40.0 38.0 40.0 38.0 40.0 16-17 38.187875 40.0 38.0 40.0 38.0 40.0 18-19 38.2035 40.0 38.0 40.0 38.0 40.0 20-21 38.28575 40.0 38.0 40.0 38.0 40.0 22-23 38.292125 40.0 38.0 40.0 38.0 40.0 24-25 38.007000000000005 40.0 38.0 40.0 35.0 40.0 26-27 38.113625 40.0 38.0 40.0 35.0 40.0 28-29 38.16825 40.0 38.0 40.0 38.0 40.0 30-31 38.323 40.0 38.0 40.0 38.0 40.0 32-33 38.339124999999996 40.0 38.0 40.0 38.0 40.0 34-35 38.28125 40.0 38.0 40.0 38.0 40.0 36-37 38.10325 40.0 38.0 40.0 38.0 40.0 38-39 38.153 40.0 38.0 40.0 38.0 40.0 40-41 37.780125 40.0 38.0 40.0 35.0 40.0 42-43 37.873000000000005 40.0 38.0 40.0 32.0 40.0 44-45 37.787 40.0 38.0 40.0 32.0 40.0 46-47 38.016999999999996 40.0 38.0 40.0 38.0 40.0 48-49 38.019125 40.0 38.0 40.0 38.0 40.0 50-51 38.120625000000004 40.0 38.0 40.0 38.0 40.0 52-53 38.084125 40.0 38.0 40.0 38.0 40.0 54-55 38.06625 40.0 38.0 40.0 38.0 40.0 56-57 37.781375 40.0 38.0 40.0 35.0 40.0 58-59 37.450374999999994 40.0 38.0 40.0 32.0 40.0 60-61 37.676 40.0 38.0 40.0 32.0 40.0 62-63 37.682874999999996 40.0 38.0 40.0 32.0 40.0 64-65 37.922875000000005 40.0 38.0 40.0 38.0 40.0 66-67 37.509874999999994 40.0 38.0 40.0 32.0 40.0 68-69 37.602000000000004 40.0 38.0 40.0 32.0 40.0 70-71 37.43 39.0 38.0 40.0 32.0 40.0 72-73 37.659375 40.0 38.0 40.0 32.0 40.0 74-75 37.587125 40.0 38.0 40.0 32.0 40.0 76-77 37.5265 38.0 38.0 40.0 35.0 40.0 78-79 37.530375 39.0 38.0 40.0 32.0 40.0 80 34.887 38.0 32.0 38.0 27.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 6.0 17 3.0 18 2.0 19 2.0 20 1.0 21 6.0 22 10.0 23 12.0 24 13.0 25 21.0 26 19.0 27 20.0 28 29.0 29 29.0 30 54.0 31 54.0 32 54.0 33 71.0 34 91.0 35 130.0 36 158.0 37 266.0 38 669.0 39 2280.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.475 20.474999999999998 10.6 28.449999999999996 2 31.624999999999996 24.099999999999998 24.2 20.075000000000003 3 23.9 26.025 25.174999999999997 24.9 4 26.674999999999997 30.9 19.2 23.225 5 28.799999999999997 30.425 18.975 21.8 6 24.825 33.475 20.075000000000003 21.625 7 24.3 18.9 31.874999999999996 24.925 8 25.45 22.3 22.425 29.825000000000003 9 24.675 23.175 25.374999999999996 26.775 10-11 27.925 25.687500000000004 20.5125 25.874999999999996 12-13 27.1625 21.912499999999998 23.724999999999998 27.200000000000003 14-15 26.674999999999997 24.875 23.0375 25.412499999999998 16-17 27.200000000000003 23.875 22.325 26.6 18-19 26.6 24.4875 22.975 25.937500000000004 20-21 26.025 25.087500000000002 23.425 25.4625 22-23 28.0875 24.5375 21.725 25.650000000000002 24-25 26.687499999999996 24.575 22.7375 26.0 26-27 27.237499999999997 24.3 23.2625 25.2 28-29 27.0625 24.975 21.95 26.0125 30-31 27.1 24.325 23.2375 25.337500000000002 32-33 26.200000000000003 24.3875 23.962500000000002 25.45 34-35 26.3125 25.924999999999997 22.625 25.137500000000003 36-37 26.8 24.3 23.1375 25.7625 38-39 27.400000000000002 24.6125 22.525000000000002 25.4625 40-41 26.6 25.15 23.0625 25.1875 42-43 26.4625 24.837500000000002 23.4875 25.2125 44-45 26.737499999999997 24.275 23.5375 25.45 46-47 26.4625 24.2375 23.1125 26.187500000000004 48-49 26.950000000000003 24.0375 23.3875 25.624999999999996 50-51 26.6625 24.3875 23.9 25.05 52-53 27.950000000000003 23.375 23.849999999999998 24.825 54-55 27.5625 23.8625 23.275000000000002 25.3 56-57 25.974999999999998 24.875 24.025 25.124999999999996 58-59 27.175 23.849999999999998 23.025000000000002 25.95 60-61 26.724999999999998 24.125 23.9875 25.162499999999998 62-63 27.0 24.1625 23.0875 25.75 64-65 27.575 23.7375 23.4625 25.224999999999998 66-67 27.237499999999997 25.724999999999998 21.925 25.112499999999997 68-69 26.637499999999996 24.2625 23.7875 25.3125 70-71 26.887499999999996 23.8875 23.724999999999998 25.5 72-73 26.8 23.4625 24.4125 25.324999999999996 74-75 26.55 24.587500000000002 24.05 24.8125 76-77 26.700000000000003 24.05 22.775000000000002 26.474999999999998 78-79 27.3 23.825 22.725 26.150000000000002 80 26.674999999999997 24.4 24.05 24.875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.5 23 2.0 24 2.0 25 1.0 26 1.5 27 2.0 28 3.5 29 5.5 30 6.0 31 10.5 32 13.5 33 19.0 34 23.0 35 20.0 36 39.0 37 59.5 38 70.5 39 91.5 40 103.0 41 128.5 42 168.5 43 174.0 44 171.0 45 177.0 46 185.0 47 196.0 48 200.5 49 186.0 50 170.0 51 168.5 52 160.5 53 153.0 54 172.5 55 193.0 56 175.0 57 162.0 58 167.0 59 154.0 60 141.0 61 130.0 62 110.5 63 108.5 64 111.5 65 108.0 66 97.0 67 78.0 68 73.5 69 61.5 70 46.0 71 44.0 72 39.5 73 31.0 74 18.0 75 11.0 76 12.0 77 9.0 78 4.5 79 2.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 80 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.03967652261815 97.975 2 0.859236795552186 1.7000000000000002 3 0.0758150113722517 0.22499999999999998 4 0.025271670457417232 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 57 0.025 0.0 0.0 0.0 0.0 58 0.025 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.025 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.025 0.0 0.0 0.0 0.0 65 0.025 0.0 0.0 0.0 0.0 66 0.025 0.0 0.0 0.0 0.0 67 0.05 0.0 0.0 0.0 0.0 68 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1392172 spots for SRR12712204.sra Written 1392172 spots for SRR12712204.sra Read 1392172 spots for SRR12712204.sra Written 1392172 spots for SRR12712204.sra Read 1392172 spots for SRR12712204.sra Written 1392172 spots for SRR12712204.sra Read 1392172 spots for SRR12712204.sra Written 1392172 spots for SRR12712204.sra Read 1392172 spots for SRR12712204.sra Written 1392172 spots for SRR12712204.sra Read 1392172 spots for SRR12712204.sra Written 1392172 spots for SRR12712204.sra Read 1392172 spots for SRR12712204.sra Written 1392172 spots for SRR12712204.sra Read 1392172 spots for SRR12712204.sra Written 1392172 spots for SRR12712204.sra Read 1392172 spots for SRR12712204.sra Written 1392172 spots for SRR12712204.sra Read 1392172 spots for SRR12712204.sra Written 1392172 spots for SRR12712204.sra Read 1392172 spots for SRR12712204.sra Written 1392172 spots for SRR12712204.sra Read 1392172 spots for SRR12712204.sra Written 1392172 spots for SRR12712204.sra Read 1392172 spots for SRR12712204.sra Written 1392172 spots for SRR12712204.sra Read 1392172 spots for SRR12712204.sra Written 1392172 spots for SRR12712204.sra Read 1392172 spots for SRR12712204.sra Written 1392172 spots for SRR12712204.sra Read 1392179 spots for SRR12712204.sra Written 1392179 spots for SRR12712204.sra Read 1392172 spots for SRR12712204.sra Written 1392172 spots for SRR12712204.sra Read 1392172 spots for SRR12712204.sra Written 1392172 spots for SRR12712204.sra Read 1392172 spots for SRR12712204.sra Written 1392172 spots for SRR12712204.sra Read 1392172 spots for SRR12712204.sra Written 1392172 spots for SRR12712204.sra SRR ids: ['SRR12712204.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_06a9ocfi SRR12712204.sra spots: 27843447 blocks: [[1, 1392172], [1392173, 2784344], [2784345, 4176516], [4176517, 5568688], [5568689, 6960860], [6960861, 8353032], [8353033, 9745204], [9745205, 11137376], [11137377, 12529548], [12529549, 13921720], [13921721, 15313892], [15313893, 16706064], [16706065, 18098236], [18098237, 19490408], [19490409, 20882580], [20882581, 22274752], [22274753, 23666924], [23666925, 25059096], [25059097, 26451268], [26451269, 27843447]] SRR12712204 file size 5552427 SRR12712204 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12712204 SRR12712204_1.fastq SRR12712204_2.fastq Input file: SRR12712204_1.fastq Paired file: SRR12712204_2.fastq trimmed: SRR12712204-trimmed-pair1.fastq, SRR12712204-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 18:34:01 2024 >> started Sat Dec 7 18:34:25 2024 >> done (24.073s) 27843447 read pairs processed; of these: 1453 ( 0.01%) short read pairs filtered out after trimming by size control 5458 ( 0.02%) empty read pairs filtered out after trimming by size control 27836536 (99.98%) read pairs available; of these: 136137 ( 0.49%) trimmed read pairs available after processing 27700399 (99.51%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 4 0.00% 20 10 0.00% 21 3 0.00% 22 6 0.00% 23 3 0.00% 24 6 0.00% 25 6 0.00% 26 9 0.00% 27 12 0.00% 28 11 0.00% 29 16 0.00% 30 18 0.00% 31 39 0.00% 32 44 0.00% 33 36 0.00% 34 56 0.00% 35 53 0.00% 36 80 0.00% 37 94 0.00% 38 84 0.00% 39 139 0.00% 40 153 0.00% 41 153 0.00% 42 179 0.00% 43 192 0.00% 44 195 0.00% 45 216 0.00% 46 260 0.00% 47 275 0.00% 48 326 0.00% 49 1082 0.00% 50 902 0.00% 51 1309 0.00% 52 1276 0.00% 53 973 0.00% 54 1876 0.01% 55 1091 0.00% 56 1841 0.01% 57 1692 0.01% 58 2400 0.01% 59 2190 0.01% 60 2334 0.01% 61 2905 0.01% 62 2361 0.01% 63 3461 0.01% 64 2874 0.01% 65 3847 0.01% 66 3216 0.01% 67 3939 0.01% 68 3481 0.01% 69 4886 0.02% 70 4815 0.02% 71 6065 0.02% 72 6429 0.02% 73 7647 0.03% 74 8498 0.03% 75 8378 0.03% 76 8855 0.03% 77 9526 0.03% 78 11137 0.04% 79 12166 0.04% 80 27700399 99.51% 27836536 reads passed initial QC criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=2.40 fanout-score-rank=21 prefix-density=0.62 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCAGGGTACTCCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=33.02 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=1.7 sequence=GCACTTGCAGGTGCTGCAGCCGCAGCCGCCGTTCTCCGCGGCCATCTCCATCCCGCCGGAGCTCGCCTTGTGGGCGGGGGTGGCGACGACGAGGAGGCTGGAGGTCTGGACCTCGGCTTCAGGGTACATGTTGCAGCCGTTGCAGCCGCTGCCGCACTTGCAGGATGACCCGCAGTTGCAGTTTCCTCCGCAGCAAGACATCTTC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=3.39 fanout-score-rank=16 prefix-density=0.62 prefix-fanout=2.8 sequence=AAGGAGCTGGAGGAGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=24.88 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=1.8 sequence=CCTCAAGCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAGCCATGGCACCCACCGTGATGGCTTCCTCCGCCACCTCCGTGGC SRR12712204 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 18:34:58 Started mapping on | Dec 07 18:34:58 Finished on | Dec 07 18:36:16 Mapping speed, Million of reads per hour | 1284.76 Number of input reads | 27836536 Average input read length | 159 UNIQUE READS: Uniquely mapped reads number | 24676383 Uniquely mapped reads % | 88.65% Average mapped length | 159.36 Number of splices: Total | 12234173 Number of splices: Annotated (sjdb) | 11634726 Number of splices: GT/AG | 12066430 Number of splices: GC/AG | 143269 Number of splices: AT/AC | 4259 Number of splices: Non-canonical | 20215 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.02% Deletion average length | 2.18 Insertion rate per base | 0.01% Insertion average length | 2.05 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1707231 % of reads mapped to multiple loci | 6.13% Number of reads mapped to too many loci | 280078 % of reads mapped to too many loci | 1.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.13% % of reads unmapped: other | 2.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1453441 1453441 1453441 N_multimapping 1707231 1707231 1707231 N_noFeature 1113909 24010026 1284840 N_ambiguous 574714 2847 80249 UnstrandedReadsAssigned:22987760 PositiveStrandReadsAssigned:663510 NegativeStrandReadsAssigned:23311294 Dataset is classified negative stranded MeadianReadLen=80 20thPercentileLength=80 echo kmer=75 SRR12712204 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12712204-trimmed-pair1.fastq SRR12712204-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,836,536 reads, 23,746,864 reads pseudoaligned [quant] estimated average fragment length: 167.812 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,195 rounds 52973 SRR12712204.ke.tsv 35125 SRR12712204.se.tsv 88098 total ==> SRR12712204.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 769.314 4.84252 0.370176 PNS24247 1044 877.188 75.8435 5.08472 PNS24249 1928 1761.19 98.2843 3.28186 PNS24246 1044 877.188 75.8435 5.08472 PNS24248 1044 877.188 75.8435 5.08472 PNS24244 1471 1304.19 262.343 11.8296 PNS24243 293 131.969 0 0 KQK14069 1603 1436.19 10585.7 433.462 KQK14071 474 308.633 109.454 20.856 ==> SRR12712204.se.tsv <== BRADI_1g14170v3 11044 BRADI_1g53295v3 755 BRADI_1g59795v3 145 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 269 BRADI_1g74790v3 111 BRADI_1g09890v3 12 BRADI_1g77505v3 305 BRADI_1g48960v3 0 SRR12712204 completed mapping pipeline successfully