Starting /dee2/code/volunteer_pipeline.sh SRR12712205 current disk space = 1540558274560 free memory = 1598870496 SRR12712205 SRAfilesize 7d87e102220f64ea872d6c00abddf502 SRR12712205.sra SRR12712205.sra file validated SRR12712205 is paired end SRR12712205 is conventional basespace SRR12712205 read1 length is 80 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12712205_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 80 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.972 38.0 38.0 38.0 32.0 38.0 2 36.68175 38.0 38.0 38.0 32.0 38.0 3 36.738 38.0 38.0 38.0 32.0 38.0 4 36.85675 38.0 38.0 38.0 32.0 38.0 5 36.617 38.0 38.0 38.0 32.0 38.0 6 38.83375 40.0 38.0 40.0 38.0 40.0 7 38.71775 40.0 38.0 40.0 38.0 40.0 8 38.81225 40.0 38.0 40.0 38.0 40.0 9 38.685 40.0 38.0 40.0 38.0 40.0 10-11 38.696625 40.0 38.0 40.0 38.0 40.0 12-13 38.794125 40.0 38.0 40.0 38.0 40.0 14-15 38.619249999999994 40.0 38.0 40.0 38.0 40.0 16-17 38.615624999999994 40.0 38.0 40.0 38.0 40.0 18-19 38.707875 40.0 38.0 40.0 38.0 40.0 20-21 38.746624999999995 40.0 38.0 40.0 38.0 40.0 22-23 38.769625 40.0 38.0 40.0 38.0 40.0 24-25 38.696625 40.0 38.0 40.0 38.0 40.0 26-27 38.72175 40.0 38.0 40.0 38.0 40.0 28-29 38.68 40.0 38.0 40.0 38.0 40.0 30-31 38.62875 40.0 38.0 40.0 38.0 40.0 32-33 38.6345 40.0 38.0 40.0 38.0 40.0 34-35 38.719125 40.0 38.0 40.0 38.0 40.0 36-37 38.65325 40.0 38.0 40.0 38.0 40.0 38-39 38.505250000000004 40.0 38.0 40.0 38.0 40.0 40-41 38.558625 40.0 38.0 40.0 38.0 40.0 42-43 38.55775 40.0 38.0 40.0 38.0 40.0 44-45 38.426625 40.0 38.0 40.0 38.0 40.0 46-47 38.405375 40.0 38.0 40.0 38.0 40.0 48-49 38.4965 40.0 38.0 40.0 38.0 40.0 50-51 38.571875 40.0 38.0 40.0 38.0 40.0 52-53 38.473124999999996 40.0 38.0 40.0 38.0 40.0 54-55 38.478625 40.0 38.0 40.0 38.0 40.0 56-57 38.380125 40.0 38.0 40.0 38.0 40.0 58-59 38.409875 40.0 38.0 40.0 38.0 40.0 60-61 38.440375 40.0 38.0 40.0 38.0 40.0 62-63 38.360625 40.0 38.0 40.0 38.0 40.0 64-65 38.39325 40.0 38.0 40.0 38.0 40.0 66-67 38.418499999999995 40.0 38.0 40.0 38.0 40.0 68-69 38.438625 40.0 38.0 40.0 38.0 40.0 70-71 38.387 40.0 38.0 40.0 38.0 40.0 72-73 38.3875 40.0 38.0 40.0 38.0 40.0 74-75 38.413625 40.0 38.0 40.0 38.0 40.0 76-77 38.321124999999995 40.0 38.0 40.0 38.0 40.0 78-79 38.416 40.0 38.0 40.0 38.0 40.0 80 37.38275 38.0 38.0 40.0 32.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 0.0 24 2.0 25 4.0 26 7.0 27 12.0 28 19.0 29 25.0 30 29.0 31 47.0 32 52.0 33 64.0 34 79.0 35 111.0 36 143.0 37 260.0 38 528.0 39 2617.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.824999999999996 14.05 6.375 35.75 2 27.31609339693698 14.260607582224456 28.822495606326886 29.600803414511674 3 23.175 18.575 21.375 36.875 4 28.299999999999997 24.175 19.675 27.85 5 27.125 27.950000000000003 20.625 24.3 6 25.3 29.45 23.25 22.0 7 20.925 24.075 34.525 20.474999999999998 8 21.975 23.799999999999997 26.5 27.725 9 21.55 21.675 30.8 25.974999999999998 10-11 24.962500000000002 28.4375 21.837500000000002 24.762500000000003 12-13 25.05 23.1 24.6875 27.1625 14-15 24.2625 24.525 24.55 26.6625 16-17 26.275 22.6125 24.4 26.7125 18-19 25.224999999999998 23.4875 25.1 26.187500000000004 20-21 25.35 23.9875 24.3 26.3625 22-23 24.1875 24.2625 24.5125 27.037499999999998 24-25 24.6875 24.3625 24.3 26.650000000000002 26-27 25.1875 24.2 24.3875 26.224999999999998 28-29 24.637500000000003 23.7125 24.3125 27.3375 30-31 24.8625 24.587500000000002 24.05 26.5 32-33 25.0125 25.337500000000002 22.787499999999998 26.8625 34-35 26.187500000000004 24.712500000000002 23.425 25.674999999999997 36-37 25.5 23.962500000000002 23.724999999999998 26.8125 38-39 24.3625 24.575 24.6 26.4625 40-41 25.337500000000002 25.124999999999996 23.625 25.912499999999998 42-43 24.3875 23.9125 24.4375 27.2625 44-45 25.0625 24.0375 24.2375 26.6625 46-47 25.15 23.6875 23.974999999999998 27.187499999999996 48-49 24.6125 25.124999999999996 23.3 26.9625 50-51 25.1 23.575 24.25 27.075 52-53 25.4 24.224999999999998 23.1 27.275 54-55 25.55 23.275000000000002 23.4125 27.762500000000003 56-57 24.9375 24.45 23.8125 26.8 58-59 25.4 23.5875 23.799999999999997 27.212500000000002 60-61 25.0125 23.525 23.962500000000002 27.500000000000004 62-63 24.4 24.087500000000002 23.925 27.5875 64-65 25.424999999999997 24.4375 23.0625 27.075 66-67 24.8625 23.599999999999998 23.8625 27.675 68-69 25.174999999999997 22.7125 24.474999999999998 27.6375 70-71 25.55 23.4375 24.1625 26.85 72-73 25.35 23.2625 24.4375 26.950000000000003 74-75 25.362499999999997 23.962500000000002 23.65 27.025 76-77 26.125 23.9125 24.0125 25.95 78-79 24.5375 23.625 24.3875 27.450000000000003 80 25.525 23.9 23.849999999999998 26.724999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 1.0 25 2.0 26 2.0 27 2.5 28 5.0 29 6.0 30 5.0 31 9.0 32 13.0 33 22.5 34 33.0 35 34.0 36 47.5 37 68.5 38 88.0 39 108.0 40 116.0 41 143.5 42 178.5 43 183.5 44 187.0 45 193.0 46 192.5 47 189.0 48 202.0 49 198.0 50 178.0 51 171.5 52 148.5 53 132.5 54 136.5 55 140.0 56 136.5 57 134.5 58 128.0 59 129.0 60 138.0 61 132.5 62 118.5 63 123.0 64 111.5 65 87.0 66 92.0 67 92.5 68 79.0 69 63.0 70 56.0 71 50.5 72 42.5 73 37.5 74 26.5 75 18.0 76 14.5 77 9.0 78 6.5 79 3.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.42500000000000004 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 80 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.625 #Duplication Level Percentage of deduplicated Percentage of total 1 98.75792141951838 97.39999999999999 2 1.1153358681875791 2.1999999999999997 3 0.10139416983523447 0.3 4 0.025348542458808618 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.025 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.05 0.0 0.0 0.0 0.0 64 0.05 0.0 0.0 0.0 0.0 65 0.05 0.0 0.0 0.0 0.0 66 0.075 0.0 0.0 0.0 0.0 67 0.075 0.0 0.0 0.0 0.0 68 0.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12712205 read2 length is 80 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12712205_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 80 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3895 38.0 38.0 38.0 32.0 38.0 2 36.25925 38.0 38.0 38.0 32.0 38.0 3 36.3815 38.0 38.0 38.0 32.0 38.0 4 36.2875 38.0 38.0 38.0 32.0 38.0 5 36.43525 38.0 38.0 38.0 32.0 38.0 6 38.46375 40.0 38.0 40.0 38.0 40.0 7 38.55 40.0 38.0 40.0 38.0 40.0 8 38.404 40.0 38.0 40.0 38.0 40.0 9 38.47325 40.0 38.0 40.0 38.0 40.0 10-11 38.526375 40.0 38.0 40.0 38.0 40.0 12-13 38.414375 40.0 38.0 40.0 38.0 40.0 14-15 38.40975 40.0 38.0 40.0 38.0 40.0 16-17 38.457875 40.0 38.0 40.0 38.0 40.0 18-19 38.546375 40.0 38.0 40.0 38.0 40.0 20-21 38.501000000000005 40.0 38.0 40.0 38.0 40.0 22-23 38.466625 40.0 38.0 40.0 38.0 40.0 24-25 38.33125 40.0 38.0 40.0 38.0 40.0 26-27 38.471625 40.0 38.0 40.0 38.0 40.0 28-29 38.425250000000005 40.0 38.0 40.0 38.0 40.0 30-31 38.45025 40.0 38.0 40.0 38.0 40.0 32-33 38.400999999999996 40.0 38.0 40.0 38.0 40.0 34-35 38.296125 40.0 38.0 40.0 38.0 40.0 36-37 38.258875 40.0 38.0 40.0 38.0 40.0 38-39 38.2365 40.0 38.0 40.0 38.0 40.0 40-41 38.3845 40.0 38.0 40.0 38.0 40.0 42-43 38.254625000000004 40.0 38.0 40.0 38.0 40.0 44-45 38.250375 40.0 38.0 40.0 38.0 40.0 46-47 38.165125 40.0 38.0 40.0 38.0 40.0 48-49 38.136750000000006 40.0 38.0 40.0 38.0 40.0 50-51 38.121875 40.0 38.0 40.0 38.0 40.0 52-53 38.058125000000004 40.0 38.0 40.0 38.0 40.0 54-55 38.04175 40.0 38.0 40.0 38.0 40.0 56-57 38.024875 40.0 38.0 40.0 38.0 40.0 58-59 38.117625000000004 40.0 38.0 40.0 38.0 40.0 60-61 38.073125000000005 40.0 38.0 40.0 38.0 40.0 62-63 38.075 40.0 38.0 40.0 38.0 40.0 64-65 38.063125 40.0 38.0 40.0 38.0 40.0 66-67 37.99225 40.0 38.0 40.0 38.0 40.0 68-69 37.867 40.0 38.0 40.0 35.0 40.0 70-71 37.925375 40.0 38.0 40.0 38.0 40.0 72-73 37.768375 40.0 38.0 40.0 35.0 40.0 74-75 37.80475 40.0 38.0 40.0 32.0 40.0 76-77 37.834625 40.0 38.0 40.0 35.0 40.0 78-79 37.650625 39.0 38.0 40.0 32.0 40.0 80 35.86475 38.0 38.0 40.0 32.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 2.0 18 0.0 19 2.0 20 3.0 21 5.0 22 5.0 23 2.0 24 7.0 25 12.0 26 12.0 27 24.0 28 28.0 29 32.0 30 45.0 31 39.0 32 42.0 33 77.0 34 84.0 35 120.0 36 160.0 37 264.0 38 664.0 39 2370.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.9 20.175 9.925 31.0 2 30.2 25.05 25.2 19.55 3 23.875 25.775 25.55 24.8 4 27.05 29.45 19.6 23.9 5 28.675 31.674999999999997 17.525 22.125 6 24.875 31.724999999999998 19.875 23.525 7 25.15 17.325 32.7 24.825 8 26.125 20.925 22.375 30.575000000000003 9 25.45 21.65 25.25 27.650000000000002 10-11 28.212500000000002 25.662499999999998 19.6875 26.437500000000004 12-13 26.787499999999998 22.5625 23.275000000000002 27.375 14-15 26.900000000000002 24.55 22.5875 25.9625 16-17 27.35 24.224999999999998 22.7625 25.662499999999998 18-19 27.575 23.400000000000002 23.0125 26.0125 20-21 26.174999999999997 24.375 23.3 26.150000000000002 22-23 27.6125 23.6375 22.8375 25.912499999999998 24-25 26.674999999999997 23.1 23.3875 26.8375 26-27 26.687499999999996 23.525 23.0625 26.724999999999998 28-29 27.85 22.8375 23.2625 26.05 30-31 27.1 23.799999999999997 22.5625 26.5375 32-33 27.35 23.4875 23.075000000000003 26.087500000000002 34-35 27.025 24.0125 23.5875 25.374999999999996 36-37 27.275 23.525 23.2125 25.9875 38-39 27.787499999999998 23.0875 23.6375 25.4875 40-41 27.450000000000003 23.5875 23.599999999999998 25.362499999999997 42-43 26.775 23.8375 23.4875 25.900000000000002 44-45 27.150000000000002 24.7375 22.5 25.6125 46-47 26.900000000000002 24.275 22.662499999999998 26.1625 48-49 27.750000000000004 23.05 23.0625 26.137500000000003 50-51 27.075 24.125 22.925 25.874999999999996 52-53 26.0625 23.425 23.575 26.937499999999996 54-55 25.674999999999997 24.462500000000002 23.3375 26.525 56-57 27.3125 24.7 22.287499999999998 25.7 58-59 27.6125 23.775 22.825 25.7875 60-61 26.8375 24.087500000000002 23.4625 25.6125 62-63 26.900000000000002 23.7375 24.325 25.0375 64-65 27.650000000000002 23.7 23.175 25.474999999999998 66-67 27.1625 24.25 22.662499999999998 25.924999999999997 68-69 26.737499999999997 23.775 23.8375 25.650000000000002 70-71 27.287499999999998 23.9875 22.787499999999998 25.937500000000004 72-73 26.3125 24.2 23.625 25.8625 74-75 26.9625 23.625 24.1625 25.25 76-77 26.8125 24.2375 23.474999999999998 25.474999999999998 78-79 26.6125 23.3125 24.175 25.900000000000002 80 27.275 23.45 24.075 25.2 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.5 24 2.0 25 2.0 26 1.0 27 1.0 28 2.0 29 3.5 30 5.0 31 5.5 32 5.0 33 13.0 34 20.5 35 19.0 36 32.0 37 54.5 38 75.0 39 101.5 40 117.0 41 128.0 42 161.5 43 182.5 44 183.5 45 186.0 46 182.5 47 197.5 48 205.0 49 193.5 50 193.0 51 175.5 52 155.0 53 142.0 54 131.0 55 130.0 56 142.5 57 141.5 58 129.5 59 145.5 60 160.0 61 150.0 62 130.0 63 114.0 64 113.5 65 119.0 66 112.5 67 96.5 68 86.5 69 75.0 70 64.0 71 60.5 72 50.5 73 36.0 74 22.5 75 17.0 76 16.5 77 12.5 78 6.0 79 1.5 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 80 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16666666666667 98.175 2 0.6818181818181818 1.35 3 0.12626262626262627 0.375 4 0.025252525252525252 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.025 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.05 0.0 0.0 0.0 0.0 64 0.05 0.0 0.0 0.0 0.0 65 0.05 0.0 0.0 0.0 0.0 66 0.075 0.0 0.0 0.0 0.0 67 0.075 0.0 0.0 0.0 0.0 68 0.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1487572 spots for SRR12712205.sra Written 1487572 spots for SRR12712205.sra Read 1487572 spots for SRR12712205.sra Written 1487572 spots for SRR12712205.sra Read 1487572 spots for SRR12712205.sra Written 1487572 spots for SRR12712205.sra Read 1487572 spots for SRR12712205.sra Written 1487572 spots for SRR12712205.sra Read 1487572 spots for SRR12712205.sra Written 1487572 spots for SRR12712205.sra Read 1487572 spots for SRR12712205.sra Written 1487572 spots for SRR12712205.sra Read 1487572 spots for SRR12712205.sra Written 1487572 spots for SRR12712205.sra Read 1487572 spots for SRR12712205.sra Written 1487572 spots for SRR12712205.sra Read 1487572 spots for SRR12712205.sra Written 1487572 spots for SRR12712205.sra Read 1487572 spots for SRR12712205.sra Written 1487572 spots for SRR12712205.sra Read 1487572 spots for SRR12712205.sra Written 1487572 spots for SRR12712205.sra Read 1487572 spots for SRR12712205.sra Written 1487572 spots for SRR12712205.sra Read 1487572 spots for SRR12712205.sra Written 1487572 spots for SRR12712205.sra Read 1487572 spots for SRR12712205.sra Written 1487572 spots for SRR12712205.sra Read 1487572 spots for SRR12712205.sra Written 1487572 spots for SRR12712205.sra Read 1487572 spots for SRR12712205.sra Written 1487572 spots for SRR12712205.sra Read 1487572 spots for SRR12712205.sra Written 1487572 spots for SRR12712205.sra Read 1487572 spots for SRR12712205.sra Written 1487572 spots for SRR12712205.sra Read 1487578 spots for SRR12712205.sra Written 1487578 spots for SRR12712205.sra Read 1487572 spots for SRR12712205.sra Written 1487572 spots for SRR12712205.sra SRR ids: ['SRR12712205.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ssp0ohbu SRR12712205.sra spots: 29751446 blocks: [[1, 1487572], [1487573, 2975144], [2975145, 4462716], [4462717, 5950288], [5950289, 7437860], [7437861, 8925432], [8925433, 10413004], [10413005, 11900576], [11900577, 13388148], [13388149, 14875720], [14875721, 16363292], [16363293, 17850864], [17850865, 19338436], [19338437, 20826008], [20826009, 22313580], [22313581, 23801152], [23801153, 25288724], [25288725, 26776296], [26776297, 28263868], [28263869, 29751446]] SRR12712205 file size 5934399 SRR12712205 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12712205 SRR12712205_1.fastq SRR12712205_2.fastq Input file: SRR12712205_1.fastq Paired file: SRR12712205_2.fastq trimmed: SRR12712205-trimmed-pair1.fastq, SRR12712205-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 18:34:50 2024 >> started Sat Dec 7 18:35:17 2024 >> done (26.865s) 29751446 read pairs processed; of these: 1600 ( 0.01%) short read pairs filtered out after trimming by size control 6913 ( 0.02%) empty read pairs filtered out after trimming by size control 29742933 (99.97%) read pairs available; of these: 156047 ( 0.52%) trimmed read pairs available after processing 29586886 (99.48%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 8 0.00% 20 3 0.00% 21 6 0.00% 22 8 0.00% 23 7 0.00% 24 12 0.00% 25 8 0.00% 26 17 0.00% 27 14 0.00% 28 21 0.00% 29 34 0.00% 30 43 0.00% 31 50 0.00% 32 61 0.00% 33 68 0.00% 34 53 0.00% 35 81 0.00% 36 104 0.00% 37 108 0.00% 38 134 0.00% 39 173 0.00% 40 176 0.00% 41 217 0.00% 42 233 0.00% 43 233 0.00% 44 247 0.00% 45 262 0.00% 46 353 0.00% 47 354 0.00% 48 471 0.00% 49 1256 0.00% 50 975 0.00% 51 1434 0.00% 52 1363 0.00% 53 1218 0.00% 54 2119 0.01% 55 1304 0.00% 56 2062 0.01% 57 1935 0.01% 58 2651 0.01% 59 2556 0.01% 60 2688 0.01% 61 3345 0.01% 62 2633 0.01% 63 4036 0.01% 64 3299 0.01% 65 4189 0.01% 66 3763 0.01% 67 4457 0.01% 68 3881 0.01% 69 5535 0.02% 70 5566 0.02% 71 6758 0.02% 72 6944 0.02% 73 8467 0.03% 74 9843 0.03% 75 9798 0.03% 76 10061 0.03% 77 11033 0.04% 78 13040 0.04% 79 14273 0.05% 80 29586886 99.48% 29742933 reads passed initial QC criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=2.84 fanout-score-rank=21 prefix-density=0.80 prefix-fanout=2.5 sequence=ACCTCCTCCAGCTCCTT criterion=fanout-score sequence-density=0.12 sequence-density-rank=22 fanout-score=9.35 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=2.9 sequence=GTTCTCGAGGGACACGTTCACGGCCTCCTTTTCCAAGACGGCGCATTGGTCATCGAAAGGCATGGAGGCGCACTCGGTCTGCACCTTCTTCTTGGCCGGGAACCCGATCCTGACCCAGTCCTCGACGAAGTGGAAGCTGTCATCTGCACCATCCTTGAGCGAGAGGAGTGCCTTGATTCCACCGCAGCGGCTGTGGCCAATCACCACGATGACCTCAACCTTGAGGGCACACACGGCGTACTCGATGGCCGACCCAACACCGGCGTACTTGTTCTTGCAGTAGGACGGGACCATGTTGGCGATGTTGCGGACGGTGAAGGCCTCGCCGGGCTCCAGGCCCAGGGTCACCGACGGGCACACACGTGAGTCGGCGCAGGCGAACACCATGTACTTGGGGGCCTGGCCGGCCTTGAGCGGCTCGAAGACATCCGGCTTCTTGTCGTAGACCTCGGTCTTGAACTTCTCGAACCCGGTCTTGAGG criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=3.35 fanout-score-rank=19 prefix-density=0.76 prefix-fanout=2.8 sequence=AAGGAGCTGGAGGAGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=25.92 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=1.9 sequence=CCTCAAGCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAGCCATGGCACCCACCGTGATGGCTTCCTCCGCCACCTCCGTGGC SRR12712205 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 18:35:54 Started mapping on | Dec 07 18:35:54 Finished on | Dec 07 18:37:08 Mapping speed, Million of reads per hour | 1446.95 Number of input reads | 29742933 Average input read length | 159 UNIQUE READS: Uniquely mapped reads number | 28108426 Uniquely mapped reads % | 94.50% Average mapped length | 159.38 Number of splices: Total | 14255686 Number of splices: Annotated (sjdb) | 13566539 Number of splices: GT/AG | 14061724 Number of splices: GC/AG | 167570 Number of splices: AT/AC | 4390 Number of splices: Non-canonical | 22002 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.02% Deletion average length | 2.24 Insertion rate per base | 0.01% Insertion average length | 2.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 661017 % of reads mapped to multiple loci | 2.22% Number of reads mapped to too many loci | 113083 % of reads mapped to too many loci | 0.38% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.95% % of reads unmapped: other | 0.95% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 974029 974029 974029 N_multimapping 661017 661017 661017 N_noFeature 898732 27364113 1104077 N_ambiguous 629639 3024 91329 UnstrandedReadsAssigned:26580055 PositiveStrandReadsAssigned:741289 NegativeStrandReadsAssigned:26913020 Dataset is classified negative stranded MeadianReadLen=80 20thPercentileLength=80 echo kmer=75 SRR12712205 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12712205-trimmed-pair1.fastq SRR12712205-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,742,933 reads, 27,087,056 reads pseudoaligned [quant] estimated average fragment length: 163.973 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,206 rounds 52973 SRR12712205.ke.tsv 35125 SRR12712205.se.tsv 88098 total ==> SRR12712205.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 773.188 43.3501 2.87619 PNS24247 1044 881.027 85.107 4.95551 PNS24249 1928 1765.03 153.007 4.44704 PNS24246 1044 881.027 85.107 4.95551 PNS24248 1044 881.027 85.107 4.95551 PNS24244 1471 1308.03 229.322 8.99378 PNS24243 293 134.722 0 0 KQK14069 1603 1440.03 9956.32 354.683 KQK14071 474 312.184 123.697 20.3264 ==> SRR12712205.se.tsv <== BRADI_1g14170v3 10467 BRADI_1g53295v3 777 BRADI_1g59795v3 172 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 451 BRADI_1g74790v3 125 BRADI_1g09890v3 0 BRADI_1g77505v3 356 BRADI_1g48960v3 0 SRR12712205 completed mapping pipeline successfully