Starting /dee2/code/volunteer_pipeline.sh SRR12712206 current disk space = 1540483325952 free memory = 1602358564 SRR12712206 SRAfilesize 287076cdf28c5d525d65008682d0a9c2 SRR12712206.sra SRR12712206.sra file validated SRR12712206 is paired end SRR12712206 is conventional basespace SRR12712206 read1 length is 80 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12712206_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 80 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.95075 38.0 38.0 38.0 32.0 38.0 2 36.7715 38.0 38.0 38.0 32.0 38.0 3 36.77175 38.0 38.0 38.0 32.0 38.0 4 36.79675 38.0 38.0 38.0 32.0 38.0 5 36.6625 38.0 38.0 38.0 32.0 38.0 6 38.7705 40.0 38.0 40.0 38.0 40.0 7 38.763 40.0 38.0 40.0 38.0 40.0 8 38.801 40.0 38.0 40.0 38.0 40.0 9 38.788 40.0 38.0 40.0 38.0 40.0 10-11 38.771375000000006 40.0 38.0 40.0 38.0 40.0 12-13 38.825625 40.0 38.0 40.0 38.0 40.0 14-15 38.685375 40.0 38.0 40.0 38.0 40.0 16-17 38.714375 40.0 38.0 40.0 38.0 40.0 18-19 38.782375 40.0 38.0 40.0 38.0 40.0 20-21 38.778999999999996 40.0 38.0 40.0 38.0 40.0 22-23 38.826750000000004 40.0 38.0 40.0 38.0 40.0 24-25 38.664375 40.0 38.0 40.0 38.0 40.0 26-27 38.6595 40.0 38.0 40.0 38.0 40.0 28-29 38.690124999999995 40.0 38.0 40.0 38.0 40.0 30-31 38.7265 40.0 38.0 40.0 38.0 40.0 32-33 38.666375 40.0 38.0 40.0 38.0 40.0 34-35 38.682874999999996 40.0 38.0 40.0 38.0 40.0 36-37 38.736625000000004 40.0 38.0 40.0 38.0 40.0 38-39 38.5805 40.0 38.0 40.0 38.0 40.0 40-41 38.579625 40.0 38.0 40.0 38.0 40.0 42-43 38.543625 40.0 38.0 40.0 38.0 40.0 44-45 38.438 40.0 38.0 40.0 38.0 40.0 46-47 38.52675 40.0 38.0 40.0 38.0 40.0 48-49 38.629 40.0 38.0 40.0 38.0 40.0 50-51 38.609624999999994 40.0 38.0 40.0 38.0 40.0 52-53 38.5565 40.0 38.0 40.0 38.0 40.0 54-55 38.554375 40.0 38.0 40.0 38.0 40.0 56-57 38.447 40.0 38.0 40.0 38.0 40.0 58-59 38.462875 40.0 38.0 40.0 38.0 40.0 60-61 38.359750000000005 40.0 38.0 40.0 38.0 40.0 62-63 38.342124999999996 40.0 38.0 40.0 38.0 40.0 64-65 38.4625 40.0 38.0 40.0 38.0 40.0 66-67 38.438125 40.0 38.0 40.0 38.0 40.0 68-69 38.417875 40.0 38.0 40.0 38.0 40.0 70-71 38.476 40.0 38.0 40.0 38.0 40.0 72-73 38.380125 40.0 38.0 40.0 38.0 40.0 74-75 38.385000000000005 40.0 38.0 40.0 38.0 40.0 76-77 38.309625 40.0 38.0 40.0 38.0 40.0 78-79 38.378125 40.0 38.0 40.0 38.0 40.0 80 37.5965 38.0 38.0 40.0 32.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 3.0 24 1.0 25 5.0 26 2.0 27 22.0 28 11.0 29 21.0 30 29.0 31 23.0 32 60.0 33 66.0 34 81.0 35 104.0 36 164.0 37 265.0 38 521.0 39 2622.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.0 11.799999999999999 6.925000000000001 44.275 2 24.291802456756077 14.264226623213839 33.94334419654049 27.500626723489596 3 21.925 17.275 21.425 39.375 4 27.474999999999998 25.35 20.025000000000002 27.150000000000002 5 28.275 29.425 22.05 20.25 6 22.875 30.325000000000003 23.75 23.05 7 17.625 23.425 38.375 20.575 8 20.625 21.9 32.025 25.45 9 20.05 21.4 33.375 25.174999999999997 10-11 23.4875 30.1375 22.7 23.674999999999997 12-13 23.1125 23.599999999999998 26.75 26.5375 14-15 23.400000000000002 25.25 26.4625 24.887500000000003 16-17 23.5125 24.8625 26.1 25.525 18-19 22.787499999999998 25.637500000000003 24.8 26.775 20-21 22.45 25.687500000000004 26.3125 25.55 22-23 23.4875 25.8 25.387500000000003 25.324999999999996 24-25 22.975 25.525 25.7125 25.7875 26-27 23.5875 25.2875 25.05 26.075 28-29 23.5625 25.35 25.324999999999996 25.7625 30-31 23.962500000000002 25.137500000000003 24.3125 26.5875 32-33 23.775 25.2875 25.4625 25.474999999999998 34-35 23.2875 25.337500000000002 25.2875 26.087500000000002 36-37 22.8375 25.937500000000004 24.8125 26.4125 38-39 23.525 24.575 25.087500000000002 26.8125 40-41 23.0125 24.9 26.187500000000004 25.900000000000002 42-43 23.200000000000003 25.85 24.9125 26.0375 44-45 24.0 25.0625 24.85 26.087500000000002 46-47 23.2375 25.775 25.575 25.412499999999998 48-49 23.4125 24.6125 25.112499999999997 26.8625 50-51 23.2875 25.124999999999996 25.825 25.7625 52-53 23.674999999999997 25.374999999999996 24.8125 26.137500000000003 54-55 24.275 25.662499999999998 24.9125 25.15 56-57 22.05 25.637500000000003 26.3625 25.95 58-59 23.4125 24.5125 25.75 26.325 60-61 23.5625 24.55 25.35 26.5375 62-63 23.2625 24.825 25.85 26.0625 64-65 23.7875 24.5 25.25 26.4625 66-67 23.474999999999998 25.424999999999997 24.962500000000002 26.137500000000003 68-69 23.125 25.162499999999998 25.2375 26.474999999999998 70-71 24.3875 24.099999999999998 26.0125 25.5 72-73 24.224999999999998 24.712500000000002 24.875 26.187500000000004 74-75 23.6125 23.7375 26.125 26.525 76-77 23.65 25.374999999999996 24.837500000000002 26.137500000000003 78-79 23.3375 25.05 25.587500000000002 26.025 80 24.175 25.374999999999996 25.275 25.174999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 1.0 25 1.0 26 1.0 27 1.5 28 1.5 29 3.5 30 6.0 31 8.5 32 17.0 33 24.5 34 40.5 35 55.0 36 68.0 37 86.5 38 112.0 39 137.5 40 143.0 41 159.5 42 200.5 43 231.5 44 240.0 45 242.0 46 244.5 47 233.0 48 222.5 49 219.0 50 212.0 51 218.0 52 186.0 53 159.5 54 144.5 55 118.0 56 135.0 57 121.0 58 94.5 59 94.5 60 90.0 61 91.5 62 85.0 63 75.0 64 66.0 65 59.0 66 51.5 67 46.5 68 44.5 69 32.0 70 24.0 71 28.5 72 30.0 73 20.5 74 9.0 75 4.0 76 4.5 77 5.0 78 2.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.27499999999999997 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 80 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14141414141415 98.15 2 0.7323232323232324 1.4500000000000002 3 0.10101010101010101 0.3 4 0.025252525252525252 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.025 0.0 0.0 0.0 0.0 65 0.025 0.0 0.0 0.0 0.0 66 0.05 0.0 0.0 0.0 0.0 67 0.075 0.0 0.0 0.0 0.0 68 0.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12712206 read2 length is 80 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12712206_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 80 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.45875 38.0 38.0 38.0 32.0 38.0 2 36.2115 38.0 38.0 38.0 32.0 38.0 3 36.38375 38.0 38.0 38.0 32.0 38.0 4 36.326 38.0 38.0 38.0 32.0 38.0 5 36.311 38.0 38.0 38.0 32.0 38.0 6 38.3445 40.0 38.0 40.0 38.0 40.0 7 38.4795 40.0 38.0 40.0 38.0 40.0 8 38.50975 40.0 38.0 40.0 38.0 40.0 9 38.467 40.0 38.0 40.0 38.0 40.0 10-11 38.53375 40.0 38.0 40.0 38.0 40.0 12-13 38.429249999999996 40.0 38.0 40.0 38.0 40.0 14-15 38.4805 40.0 38.0 40.0 38.0 40.0 16-17 38.48975 40.0 38.0 40.0 38.0 40.0 18-19 38.449125 40.0 38.0 40.0 38.0 40.0 20-21 38.455124999999995 40.0 38.0 40.0 38.0 40.0 22-23 38.417625 40.0 38.0 40.0 38.0 40.0 24-25 38.310125 40.0 38.0 40.0 38.0 40.0 26-27 38.365125 40.0 38.0 40.0 38.0 40.0 28-29 38.366625 40.0 38.0 40.0 38.0 40.0 30-31 38.36225 40.0 38.0 40.0 38.0 40.0 32-33 38.425375 40.0 38.0 40.0 38.0 40.0 34-35 38.310125 40.0 38.0 40.0 38.0 40.0 36-37 38.336875 40.0 38.0 40.0 38.0 40.0 38-39 38.291124999999994 40.0 38.0 40.0 38.0 40.0 40-41 38.32875 40.0 38.0 40.0 38.0 40.0 42-43 38.153625 40.0 38.0 40.0 38.0 40.0 44-45 38.2325 40.0 38.0 40.0 38.0 40.0 46-47 38.176249999999996 40.0 38.0 40.0 38.0 40.0 48-49 38.232375 40.0 38.0 40.0 38.0 40.0 50-51 38.084500000000006 40.0 38.0 40.0 38.0 40.0 52-53 38.027 40.0 38.0 40.0 38.0 40.0 54-55 38.052125000000004 40.0 38.0 40.0 38.0 40.0 56-57 38.1215 40.0 38.0 40.0 38.0 40.0 58-59 38.16675 40.0 38.0 40.0 38.0 40.0 60-61 38.070875 40.0 38.0 40.0 38.0 40.0 62-63 38.074625 40.0 38.0 40.0 38.0 40.0 64-65 38.098 40.0 38.0 40.0 38.0 40.0 66-67 37.99525 40.0 38.0 40.0 38.0 40.0 68-69 37.94075 40.0 38.0 40.0 38.0 40.0 70-71 37.916250000000005 40.0 38.0 40.0 38.0 40.0 72-73 37.88875 40.0 38.0 40.0 35.0 40.0 74-75 37.916375 40.0 38.0 40.0 38.0 40.0 76-77 37.832125000000005 40.0 38.0 40.0 35.0 40.0 78-79 37.609750000000005 38.0 38.0 40.0 32.0 40.0 80 36.0585 38.0 38.0 40.0 32.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 2.0 18 3.0 19 1.0 20 2.0 21 1.0 22 6.0 23 14.0 24 11.0 25 6.0 26 14.0 27 21.0 28 27.0 29 20.0 30 36.0 31 45.0 32 60.0 33 60.0 34 84.0 35 108.0 36 168.0 37 281.0 38 661.0 39 2368.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.775 19.5 10.075000000000001 36.65 2 28.999999999999996 22.8 30.45 17.75 3 22.075 24.575 29.549999999999997 23.799999999999997 4 26.474999999999998 29.075 21.475 22.975 5 28.050000000000004 31.674999999999997 19.225 21.05 6 23.75 34.699999999999996 19.85 21.7 7 24.0 19.925 33.800000000000004 22.275 8 22.8 22.25 26.375 28.575 9 24.575 21.85 28.175 25.4 10-11 26.55 27.962500000000002 21.349999999999998 24.1375 12-13 27.0 23.35 24.025 25.624999999999996 14-15 25.837500000000002 25.8625 24.075 24.224999999999998 16-17 27.1 25.137500000000003 23.5875 24.175 18-19 26.137500000000003 25.074999999999996 24.9875 23.799999999999997 20-21 27.1125 25.837500000000002 23.5625 23.4875 22-23 25.837500000000002 25.7 23.4375 25.025 24-25 26.400000000000002 24.95 25.162499999999998 23.4875 26-27 26.437500000000004 24.3875 24.3625 24.8125 28-29 26.1125 24.6 24.025 25.2625 30-31 26.1 25.124999999999996 24.925 23.849999999999998 32-33 25.874999999999996 24.8125 24.8125 24.5 34-35 26.35 25.2 23.7 24.75 36-37 26.700000000000003 25.424999999999997 23.8375 24.0375 38-39 26.625 25.75 24.4375 23.1875 40-41 26.6125 25.025 23.7 24.6625 42-43 26.1 25.0375 25.424999999999997 23.4375 44-45 26.200000000000003 24.7875 25.15 23.8625 46-47 27.1 24.5375 24.9375 23.425 48-49 26.087500000000002 24.6 25.0125 24.3 50-51 26.400000000000002 25.7125 24.3 23.5875 52-53 26.937499999999996 24.7875 24.474999999999998 23.799999999999997 54-55 25.775 25.174999999999997 24.462500000000002 24.587500000000002 56-57 26.7625 25.4375 24.65 23.150000000000002 58-59 26.474999999999998 24.887500000000003 24.575 24.0625 60-61 26.5875 24.4375 24.9875 23.9875 62-63 26.150000000000002 24.4125 25.525 23.9125 64-65 26.424999999999997 24.587500000000002 24.587500000000002 24.4 66-67 25.9625 25.0625 24.6625 24.3125 68-69 25.6 25.2625 25.25 23.8875 70-71 26.674999999999997 25.912499999999998 23.3375 24.075 72-73 26.637499999999996 25.575 24.4375 23.35 74-75 25.25 25.7 24.9125 24.1375 76-77 26.1125 24.962500000000002 24.9 24.025 78-79 26.9125 24.525 25.0375 23.525 80 27.1 25.1 24.95 22.85 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 1.5 27 1.0 28 2.0 29 4.0 30 4.0 31 6.5 32 11.0 33 18.0 34 32.5 35 42.0 36 47.0 37 64.0 38 104.5 39 141.5 40 150.0 41 184.5 42 220.0 43 220.5 44 229.0 45 238.0 46 249.5 47 233.5 48 224.5 49 211.0 50 179.0 51 169.5 52 149.0 53 137.0 54 133.5 55 131.0 56 132.5 57 123.0 58 109.0 59 112.0 60 118.0 61 114.0 62 107.5 63 96.5 64 79.5 65 71.0 66 68.0 67 62.0 68 52.5 69 39.5 70 33.0 71 31.5 72 28.5 73 21.0 74 15.0 75 15.0 76 9.0 77 2.0 78 0.5 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 80 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21736935117394 98.25 2 0.5806614491290077 1.15 3 0.20196919969704621 0.6 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.025 0.0 0.0 0.0 0.0 65 0.025 0.0 0.0 0.0 0.0 66 0.05 0.0 0.0 0.0 0.0 67 0.075 0.0 0.0 0.0 0.0 68 0.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1322973 spots for SRR12712206.sra Written 1322973 spots for SRR12712206.sra Read 1322973 spots for SRR12712206.sra Written 1322973 spots for SRR12712206.sra Read 1322973 spots for SRR12712206.sra Written 1322973 spots for SRR12712206.sra Read 1322973 spots for SRR12712206.sra Written 1322973 spots for SRR12712206.sra Read 1322973 spots for SRR12712206.sra Written 1322973 spots for SRR12712206.sra Read 1322973 spots for SRR12712206.sra Written 1322973 spots for SRR12712206.sra Read 1322973 spots for SRR12712206.sra Written 1322973 spots for SRR12712206.sra Read 1322973 spots for SRR12712206.sra Written 1322973 spots for SRR12712206.sra Read 1322973 spots for SRR12712206.sra Written 1322973 spots for SRR12712206.sra Read 1322973 spots for SRR12712206.sra Written 1322973 spots for SRR12712206.sra Read 1322973 spots for SRR12712206.sra Written 1322973 spots for SRR12712206.sra Read 1322973 spots for SRR12712206.sra Written 1322973 spots for SRR12712206.sra Read 1322973 spots for SRR12712206.sra Written 1322973 spots for SRR12712206.sra Read 1322973 spots for SRR12712206.sra Written 1322973 spots for SRR12712206.sra Read 1322973 spots for SRR12712206.sra Written 1322973 spots for SRR12712206.sra Read 1322973 spots for SRR12712206.sra Written 1322973 spots for SRR12712206.sra Read 1322982 spots for SRR12712206.sra Written 1322982 spots for SRR12712206.sra Read 1322973 spots for SRR12712206.sra Written 1322973 spots for SRR12712206.sra Read 1322973 spots for SRR12712206.sra Written 1322973 spots for SRR12712206.sra Read 1322973 spots for SRR12712206.sra Written 1322973 spots for SRR12712206.sra SRR ids: ['SRR12712206.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_sr9hprls SRR12712206.sra spots: 26459469 blocks: [[1, 1322973], [1322974, 2645946], [2645947, 3968919], [3968920, 5291892], [5291893, 6614865], [6614866, 7937838], [7937839, 9260811], [9260812, 10583784], [10583785, 11906757], [11906758, 13229730], [13229731, 14552703], [14552704, 15875676], [15875677, 17198649], [17198650, 18521622], [18521623, 19844595], [19844596, 21167568], [21167569, 22490541], [22490542, 23813514], [23813515, 25136487], [25136488, 26459469]] SRR12712206 file size 5275361 SRR12712206 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12712206 SRR12712206_1.fastq SRR12712206_2.fastq Input file: SRR12712206_1.fastq Paired file: SRR12712206_2.fastq trimmed: SRR12712206-trimmed-pair1.fastq, SRR12712206-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 18:34:53 2024 >> started Sat Dec 7 18:35:15 2024 >> done (22.140s) 26459469 read pairs processed; of these: 1397 ( 0.01%) short read pairs filtered out after trimming by size control 542 ( 0.00%) empty read pairs filtered out after trimming by size control 26457530 (99.99%) read pairs available; of these: 107899 ( 0.41%) trimmed read pairs available after processing 26349631 (99.59%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 4 0.00% 20 5 0.00% 21 4 0.00% 22 4 0.00% 23 4 0.00% 24 4 0.00% 25 8 0.00% 26 7 0.00% 27 4 0.00% 28 12 0.00% 29 20 0.00% 30 14 0.00% 31 20 0.00% 32 35 0.00% 33 34 0.00% 34 52 0.00% 35 30 0.00% 36 36 0.00% 37 46 0.00% 38 84 0.00% 39 74 0.00% 40 115 0.00% 41 112 0.00% 42 149 0.00% 43 133 0.00% 44 171 0.00% 45 181 0.00% 46 207 0.00% 47 253 0.00% 48 231 0.00% 49 945 0.00% 50 764 0.00% 51 1201 0.00% 52 1083 0.00% 53 808 0.00% 54 1656 0.01% 55 897 0.00% 56 1600 0.01% 57 1431 0.01% 58 2020 0.01% 59 1847 0.01% 60 1915 0.01% 61 2391 0.01% 62 1840 0.01% 63 2847 0.01% 64 2214 0.01% 65 3152 0.01% 66 2453 0.01% 67 3164 0.01% 68 2785 0.01% 69 3817 0.01% 70 3731 0.01% 71 4880 0.02% 72 4738 0.02% 73 5760 0.02% 74 6748 0.03% 75 6610 0.02% 76 6751 0.03% 77 7368 0.03% 78 8859 0.03% 79 9561 0.04% 80 26349631 99.59% 26457530 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=7.09 fanout-score-rank=9 prefix-density=0.28 prefix-fanout=3.8 sequence=CTTCTTGTGCTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=228.77 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=15.1 sequence=GCCGCCGCCACGTTCTCCGGCCGTCCTCCCCACGTCTTCAGGCACGTGTTCTGCAGCGCCCTCGCGTATGAGAAGGACACGTGCCACGGGTTCGGCGACTGGTTCATCGCGTTCAGGTTCAGCGTTGCCTCCACCTCTGACTGCCCGCCCGACAGGAACATGATGCCGGGGACGGAAGGAGGGATCCTCCTCTGGAGGAGCTTGAGGGTGTAGCTGGCGACTTGCTCAGGGGTGGCCCGCTCCTTGCACTCGGCGCCGGGTGTCACCATGCTGGGCTTGAGGAGGATGCCCTCGAACAAGACGTTGTTCTGGGCCATGTAGTAGAAAGTCTCCGCCCACACCTTCTGCGCCACCTCGAAGGTCCTGTCGATGCCGTGCTCGC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=29 prefix-density=0.21 prefix-fanout=2.0 sequence=GAAGATGTCTTGC criterion=fanout-score sequence-density=0.08 sequence-density-rank=9 fanout-score=102.68 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=16.9 sequence=GCCGCCGCCGCCA SRR12712206 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 18:35:52 Started mapping on | Dec 07 18:35:52 Finished on | Dec 07 18:37:05 Mapping speed, Million of reads per hour | 1304.75 Number of input reads | 26457530 Average input read length | 159 UNIQUE READS: Uniquely mapped reads number | 24036333 Uniquely mapped reads % | 90.85% Average mapped length | 159.37 Number of splices: Total | 13158274 Number of splices: Annotated (sjdb) | 12464911 Number of splices: GT/AG | 12965481 Number of splices: GC/AG | 162888 Number of splices: AT/AC | 5843 Number of splices: Non-canonical | 24062 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.02% Deletion average length | 2.16 Insertion rate per base | 0.01% Insertion average length | 2.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 629496 % of reads mapped to multiple loci | 2.38% Number of reads mapped to too many loci | 334238 % of reads mapped to too many loci | 1.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.79% % of reads unmapped: other | 3.72% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1792181 1792181 1792181 N_multimapping 629496 629496 629496 N_noFeature 977243 23338724 1181742 N_ambiguous 562313 3089 70007 UnstrandedReadsAssigned:22496777 PositiveStrandReadsAssigned:694520 NegativeStrandReadsAssigned:22784584 Dataset is classified negative stranded MeadianReadLen=80 20thPercentileLength=80 echo kmer=75 SRR12712206 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12712206-trimmed-pair1.fastq SRR12712206-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,457,530 reads, 22,980,317 reads pseudoaligned [quant] estimated average fragment length: 174.132 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,221 rounds 52973 SRR12712206.ke.tsv 35125 SRR12712206.se.tsv 88098 total ==> SRR12712206.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 763.009 0 0 PNS24247 1044 870.868 110.881 8.61227 PNS24249 1928 1754.87 76.3031 2.9411 PNS24246 1044 870.868 110.881 8.61227 PNS24248 1044 870.868 110.881 8.61227 PNS24244 1471 1297.87 286.053 14.9083 PNS24243 293 128.382 0 0 KQK14069 1603 1429.87 18697.7 884.513 KQK14071 474 302.681 219.496 49.0517 ==> SRR12712206.se.tsv <== BRADI_1g14170v3 20556 BRADI_1g53295v3 1268 BRADI_1g59795v3 147 BRADI_1g07683v3 0 BRADI_1g00485v3 12 BRADI_1g20270v3 446 BRADI_1g74790v3 203 BRADI_1g09890v3 0 BRADI_1g77505v3 381 BRADI_1g48960v3 0 SRR12712206 completed mapping pipeline successfully