Starting /dee2/code/volunteer_pipeline.sh SRR12712207 current disk space = 1540508557312 free memory = 1595997720 SRR12712207 SRAfilesize 3b5589ba7c56b4875a9f3e109d556789 SRR12712207.sra SRR12712207.sra file validated SRR12712207 is paired end SRR12712207 is conventional basespace SRR12712207 read1 length is 80 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12712207_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 80 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5775 38.0 38.0 38.0 32.0 38.0 2 36.93575 38.0 38.0 38.0 32.0 38.0 3 36.60425 38.0 38.0 38.0 32.0 38.0 4 36.73475 38.0 38.0 38.0 32.0 38.0 5 36.58325 38.0 38.0 38.0 32.0 38.0 6 38.7255 40.0 38.0 40.0 38.0 40.0 7 38.797 40.0 38.0 40.0 38.0 40.0 8 38.958 40.0 38.0 40.0 38.0 40.0 9 39.0205 40.0 38.0 40.0 38.0 40.0 10-11 38.873875 40.0 38.0 40.0 38.0 40.0 12-13 39.00025 40.0 38.0 40.0 38.0 40.0 14-15 38.710125000000005 40.0 38.0 40.0 38.0 40.0 16-17 38.920875 40.0 38.0 40.0 38.0 40.0 18-19 38.97675 40.0 38.0 40.0 38.0 40.0 20-21 38.93175 40.0 38.0 40.0 38.0 40.0 22-23 38.886250000000004 40.0 38.0 40.0 38.0 40.0 24-25 38.92725 40.0 38.0 40.0 38.0 40.0 26-27 38.632374999999996 40.0 38.0 40.0 38.0 40.0 28-29 38.731875 40.0 38.0 40.0 38.0 40.0 30-31 38.89325 40.0 38.0 40.0 38.0 40.0 32-33 38.808499999999995 40.0 38.0 40.0 38.0 40.0 34-35 38.350125000000006 40.0 38.0 40.0 38.0 40.0 36-37 38.7875 40.0 38.0 40.0 38.0 40.0 38-39 38.732625 40.0 38.0 40.0 38.0 40.0 40-41 38.80375 40.0 38.0 40.0 38.0 40.0 42-43 38.822375 40.0 38.0 40.0 38.0 40.0 44-45 38.50775 40.0 38.0 40.0 38.0 40.0 46-47 38.736000000000004 40.0 38.0 40.0 38.0 40.0 48-49 38.6535 40.0 38.0 40.0 38.0 40.0 50-51 38.681 40.0 38.0 40.0 38.0 40.0 52-53 38.623 40.0 38.0 40.0 38.0 40.0 54-55 38.473124999999996 40.0 38.0 40.0 38.0 40.0 56-57 38.60225 40.0 38.0 40.0 38.0 40.0 58-59 38.67275 40.0 38.0 40.0 38.0 40.0 60-61 38.73325 40.0 38.0 40.0 38.0 40.0 62-63 38.5685 40.0 38.0 40.0 38.0 40.0 64-65 38.705 40.0 38.0 40.0 38.0 40.0 66-67 38.444625 40.0 38.0 40.0 38.0 40.0 68-69 38.242374999999996 40.0 38.0 40.0 38.0 40.0 70-71 38.608625 40.0 38.0 40.0 38.0 40.0 72-73 37.959500000000006 40.0 38.0 40.0 38.0 40.0 74-75 38.403499999999994 40.0 38.0 40.0 38.0 40.0 76-77 38.48075 40.0 38.0 40.0 38.0 40.0 78-79 38.2425 40.0 38.0 40.0 38.0 40.0 80 37.645 38.0 38.0 40.0 32.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 4.0 25 3.0 26 7.0 27 15.0 28 18.0 29 22.0 30 28.0 31 30.0 32 47.0 33 69.0 34 65.0 35 105.0 36 152.0 37 224.0 38 477.0 39 2734.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.05 14.875 6.5 34.575 2 25.882352941176475 15.018773466833544 29.536921151439298 29.561952440550687 3 22.6 17.775 23.599999999999998 36.025 4 27.68192048012003 23.980995248812203 20.305076269067268 28.032008002000502 5 27.675 26.875 21.625 23.825 6 23.65 29.175 23.400000000000002 23.775 7 19.475 22.975 35.9 21.65 8 21.099999999999998 22.85 27.1 28.95 9 21.05 20.875 31.474999999999998 26.6 10-11 24.3125 28.199999999999996 22.475 25.0125 12-13 24.5375 23.425 25.4375 26.6 14-15 24.275 24.8 24.975 25.95 16-17 23.9375 24.2375 25.637500000000003 26.187500000000004 18-19 25.0 24.8625 24.3125 25.825 20-21 23.825 24.8 25.4 25.974999999999998 22-23 24.7 25.025 24.25 26.025 24-25 24.962500000000002 24.6625 24.55 25.825 26-27 24.212500000000002 24.712500000000002 24.5 26.575 28-29 24.75 24.4125 24.375 26.4625 30-31 24.275 24.5375 24.4375 26.75 32-33 24.05 23.875 24.8 27.275 34-35 24.125 24.4125 23.6375 27.825 36-37 24.975 23.7625 24.8 26.4625 38-39 24.2875 24.65 24.625 26.437500000000004 40-41 25.05 24.825 23.849999999999998 26.275 42-43 24.775 23.95 24.6 26.674999999999997 44-45 24.887500000000003 24.775 24.25 26.087500000000002 46-47 24.875 24.0 24.775 26.35 48-49 24.2625 25.2375 23.775 26.724999999999998 50-51 24.5125 24.025 24.95 26.5125 52-53 24.775 24.775 23.8125 26.637499999999996 54-55 24.825 25.2375 23.575 26.3625 56-57 24.1125 23.95 25.2625 26.674999999999997 58-59 24.337500000000002 24.224999999999998 24.212500000000002 27.224999999999998 60-61 24.4875 23.65 24.6125 27.250000000000004 62-63 24.325 23.8125 25.1 26.7625 64-65 24.474999999999998 24.65 24.275 26.6 66-67 24.625 23.9125 25.15 26.3125 68-69 24.8 24.4375 24.975 25.7875 70-71 24.4125 24.587500000000002 24.1375 26.8625 72-73 24.725 23.400000000000002 25.0375 26.8375 74-75 24.5375 23.375 25.1 26.987499999999997 76-77 25.124999999999996 23.9125 24.2375 26.724999999999998 78-79 25.2375 23.549999999999997 24.25 26.9625 80 23.549999999999997 24.575 25.674999999999997 26.200000000000003 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 0.5 22 0.0 23 0.5 24 0.5 25 0.0 26 1.0 27 3.0 28 3.5 29 9.0 30 15.0 31 14.0 32 12.0 33 20.0 34 33.0 35 37.0 36 46.5 37 65.5 38 87.5 39 108.5 40 117.0 41 132.0 42 168.0 43 196.0 44 205.0 45 207.0 46 222.0 47 227.5 48 214.5 49 220.0 50 229.0 51 222.5 52 193.0 53 160.5 54 149.0 55 147.0 56 132.5 57 114.5 58 110.0 59 107.0 60 105.0 61 103.5 62 97.0 63 84.5 64 80.5 65 84.0 66 93.0 67 84.0 68 67.0 69 52.5 70 37.0 71 38.0 72 36.5 73 29.5 74 24.0 75 23.0 76 16.5 77 5.5 78 3.5 79 3.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.125 3 0.0 4 0.025 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 80 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49748743718592 99.0 2 0.5025125628140703 1.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 65 0.05 0.0 0.0 0.0 0.0 66 0.05 0.0 0.0 0.0 0.0 67 0.05 0.0 0.0 0.0 0.0 68 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12712207 read2 length is 80 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12712207_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 80 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.21275 38.0 38.0 38.0 32.0 38.0 2 36.4795 38.0 38.0 38.0 32.0 38.0 3 35.72 38.0 32.0 38.0 32.0 38.0 4 36.42625 38.0 38.0 38.0 32.0 38.0 5 36.55375 38.0 38.0 38.0 32.0 38.0 6 38.72475 40.0 38.0 40.0 38.0 40.0 7 38.6255 40.0 38.0 40.0 38.0 40.0 8 38.66825 40.0 38.0 40.0 38.0 40.0 9 38.51225 40.0 38.0 40.0 38.0 40.0 10-11 38.42 40.0 38.0 40.0 38.0 40.0 12-13 38.51175 40.0 38.0 40.0 38.0 40.0 14-15 38.695875 40.0 38.0 40.0 38.0 40.0 16-17 38.4525 40.0 38.0 40.0 38.0 40.0 18-19 38.545 40.0 38.0 40.0 38.0 40.0 20-21 38.586875 40.0 38.0 40.0 38.0 40.0 22-23 38.63575 40.0 38.0 40.0 38.0 40.0 24-25 38.34275 40.0 38.0 40.0 38.0 40.0 26-27 38.44725 40.0 38.0 40.0 38.0 40.0 28-29 38.442 40.0 38.0 40.0 38.0 40.0 30-31 38.633375 40.0 38.0 40.0 38.0 40.0 32-33 38.581500000000005 40.0 38.0 40.0 38.0 40.0 34-35 38.559875000000005 40.0 38.0 40.0 38.0 40.0 36-37 38.42700000000001 40.0 38.0 40.0 38.0 40.0 38-39 38.411375 40.0 38.0 40.0 38.0 40.0 40-41 38.132125 40.0 38.0 40.0 38.0 40.0 42-43 38.274 40.0 38.0 40.0 38.0 40.0 44-45 38.12175 40.0 38.0 40.0 38.0 40.0 46-47 38.304 40.0 38.0 40.0 38.0 40.0 48-49 38.381625 40.0 38.0 40.0 38.0 40.0 50-51 38.465875 40.0 38.0 40.0 38.0 40.0 52-53 38.496125000000006 40.0 38.0 40.0 38.0 40.0 54-55 38.4585 40.0 38.0 40.0 38.0 40.0 56-57 38.164 40.0 38.0 40.0 38.0 40.0 58-59 37.968125 40.0 38.0 40.0 38.0 40.0 60-61 38.134125 40.0 38.0 40.0 38.0 40.0 62-63 37.933375 40.0 38.0 40.0 38.0 40.0 64-65 38.209125 40.0 38.0 40.0 38.0 40.0 66-67 37.899249999999995 40.0 38.0 40.0 35.0 40.0 68-69 38.008125 40.0 38.0 40.0 38.0 40.0 70-71 37.810500000000005 40.0 38.0 40.0 35.0 40.0 72-73 38.000875 40.0 38.0 40.0 38.0 40.0 74-75 37.96625 40.0 38.0 40.0 38.0 40.0 76-77 37.846625 40.0 38.0 40.0 35.0 40.0 78-79 37.838375 40.0 38.0 40.0 35.0 40.0 80 35.36625 38.0 38.0 38.0 27.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 1.0 17 2.0 18 3.0 19 1.0 20 2.0 21 1.0 22 9.0 23 6.0 24 5.0 25 14.0 26 12.0 27 21.0 28 16.0 29 26.0 30 45.0 31 36.0 32 44.0 33 69.0 34 78.0 35 124.0 36 160.0 37 272.0 38 590.0 39 2462.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.5 22.775000000000002 10.05 29.675 2 30.925000000000004 25.75 24.224999999999998 19.1 3 24.081020255063766 26.206551637909474 24.756189047261813 24.956239059764943 4 25.881470367591895 31.957989497374346 20.05501375343836 22.1055263815954 5 29.375 30.599999999999998 18.85 21.175 6 25.1 33.1 20.175 21.625 7 23.0 19.25 33.75 24.0 8 26.275 22.325 22.8 28.599999999999998 9 24.575 21.5 26.25 27.675 10-11 27.3125 27.8125 20.349999999999998 24.525 12-13 26.0125 23.150000000000002 23.9875 26.85 14-15 25.9625 24.275 24.05 25.7125 16-17 27.6875 23.9875 22.75 25.575 18-19 26.85 24.4375 23.05 25.662499999999998 20-21 26.75 25.2 23.825 24.224999999999998 22-23 27.400000000000002 24.425 22.3 25.874999999999996 24-25 27.037499999999998 23.6875 24.1375 25.137500000000003 26-27 26.125 25.4875 22.7 25.687500000000004 28-29 26.3625 24.6875 22.7625 26.187500000000004 30-31 26.150000000000002 24.425 24.175 25.25 32-33 25.4 24.3875 23.8125 26.400000000000002 34-35 26.7625 24.212500000000002 23.1 25.924999999999997 36-37 26.75 25.0 23.1 25.15 38-39 26.450000000000003 26.275 22.4875 24.7875 40-41 27.537499999999998 24.3125 23.0375 25.112499999999997 42-43 26.125 24.9125 23.6125 25.35 44-45 26.6 24.5375 24.05 24.8125 46-47 27.2625 24.625 22.95 25.162499999999998 48-49 26.575 24.45 24.05 24.925 50-51 26.650000000000002 25.2 22.9875 25.162499999999998 52-53 27.3625 24.099999999999998 22.875 25.662499999999998 54-55 26.775 24.2875 23.724999999999998 25.2125 56-57 27.075 24.675 23.45 24.8 58-59 27.474999999999998 23.45 23.75 25.324999999999996 60-61 26.5625 24.2375 24.675 24.525 62-63 27.437499999999996 23.95 24.325 24.2875 64-65 27.3875 24.462500000000002 23.599999999999998 24.55 66-67 26.0125 24.575 23.7 25.7125 68-69 26.787499999999998 24.275 23.6875 25.25 70-71 26.724999999999998 23.974999999999998 23.5375 25.7625 72-73 26.8125 24.224999999999998 23.9 25.0625 74-75 27.625 24.15 23.2625 24.962500000000002 76-77 27.200000000000003 24.4375 24.175 24.1875 78-79 26.125 24.6 24.625 24.65 80 26.424999999999997 24.95 23.95 24.675 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.0 26 2.5 27 3.5 28 2.0 29 3.5 30 5.0 31 8.0 32 12.5 33 19.0 34 30.5 35 37.0 36 39.0 37 53.5 38 73.0 39 99.5 40 119.0 41 134.0 42 162.5 43 210.0 44 224.0 45 204.0 46 228.0 47 236.5 48 218.0 49 200.0 50 185.0 51 173.5 52 159.0 53 154.5 54 149.0 55 145.0 56 137.5 57 126.0 58 110.5 59 115.0 60 131.0 61 119.5 62 101.0 63 95.0 64 90.0 65 84.0 66 86.5 67 83.5 68 78.0 69 64.0 70 50.0 71 50.0 72 46.0 73 36.0 74 26.5 75 23.0 76 18.0 77 8.5 78 4.5 79 3.0 80 1.0 81 1.0 82 1.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.025 4 0.025 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 80 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 65 0.05 0.0 0.0 0.0 0.0 66 0.05 0.0 0.0 0.0 0.0 67 0.05 0.0 0.0 0.0 0.0 68 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1543257 spots for SRR12712207.sra Written 1543257 spots for SRR12712207.sra Read 1543257 spots for SRR12712207.sra Written 1543257 spots for SRR12712207.sra Read 1543257 spots for SRR12712207.sra Written 1543257 spots for SRR12712207.sra Read 1543257 spots for SRR12712207.sra Written 1543257 spots for SRR12712207.sra Read 1543257 spots for SRR12712207.sra Written 1543257 spots for SRR12712207.sra Read 1543257 spots for SRR12712207.sra Written 1543257 spots for SRR12712207.sra Read 1543260 spots for SRR12712207.sra Written 1543260 spots for SRR12712207.sra Read 1543257 spots for SRR12712207.sra Written 1543257 spots for SRR12712207.sra Read 1543257 spots for SRR12712207.sra Written 1543257 spots for SRR12712207.sra Read 1543257 spots for SRR12712207.sra Written 1543257 spots for SRR12712207.sra Read 1543257 spots for SRR12712207.sra Written 1543257 spots for SRR12712207.sra Read 1543257 spots for SRR12712207.sra Written 1543257 spots for SRR12712207.sra Read 1543257 spots for SRR12712207.sra Written 1543257 spots for SRR12712207.sra Read 1543257 spots for SRR12712207.sra Written 1543257 spots for SRR12712207.sra Read 1543257 spots for SRR12712207.sra Written 1543257 spots for SRR12712207.sra Read 1543257 spots for SRR12712207.sra Written 1543257 spots for SRR12712207.sra Read 1543257 spots for SRR12712207.sra Written 1543257 spots for SRR12712207.sra Read 1543257 spots for SRR12712207.sra Written 1543257 spots for SRR12712207.sra Read 1543257 spots for SRR12712207.sra Written 1543257 spots for SRR12712207.sra Read 1543257 spots for SRR12712207.sra Written 1543257 spots for SRR12712207.sra SRR ids: ['SRR12712207.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ll5qynyk SRR12712207.sra spots: 30865143 blocks: [[1, 1543257], [1543258, 3086514], [3086515, 4629771], [4629772, 6173028], [6173029, 7716285], [7716286, 9259542], [9259543, 10802799], [10802800, 12346056], [12346057, 13889313], [13889314, 15432570], [15432571, 16975827], [16975828, 18519084], [18519085, 20062341], [20062342, 21605598], [21605599, 23148855], [23148856, 24692112], [24692113, 26235369], [26235370, 27778626], [27778627, 29321883], [29321884, 30865143]] SRR12712207 file size 6157356 SRR12712207 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12712207 SRR12712207_1.fastq SRR12712207_2.fastq Input file: SRR12712207_1.fastq Paired file: SRR12712207_2.fastq trimmed: SRR12712207-trimmed-pair1.fastq, SRR12712207-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 18:40:34 2024 >> started Sat Dec 7 18:41:02 2024 >> done (27.649s) 30865143 read pairs processed; of these: 1701 ( 0.01%) short read pairs filtered out after trimming by size control 5784 ( 0.02%) empty read pairs filtered out after trimming by size control 30857658 (99.98%) read pairs available; of these: 149290 ( 0.48%) trimmed read pairs available after processing 30708368 (99.52%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 5 0.00% 20 4 0.00% 21 8 0.00% 22 6 0.00% 23 5 0.00% 24 9 0.00% 25 4 0.00% 26 6 0.00% 27 20 0.00% 28 13 0.00% 29 19 0.00% 30 24 0.00% 31 33 0.00% 32 39 0.00% 33 48 0.00% 34 49 0.00% 35 53 0.00% 36 58 0.00% 37 75 0.00% 38 93 0.00% 39 111 0.00% 40 139 0.00% 41 151 0.00% 42 177 0.00% 43 161 0.00% 44 219 0.00% 45 229 0.00% 46 212 0.00% 47 269 0.00% 48 351 0.00% 49 1178 0.00% 50 905 0.00% 51 1443 0.00% 52 1275 0.00% 53 1076 0.00% 54 1972 0.01% 55 1146 0.00% 56 1979 0.01% 57 1770 0.01% 58 2540 0.01% 59 2280 0.01% 60 2432 0.01% 61 3152 0.01% 62 2366 0.01% 63 3671 0.01% 64 2883 0.01% 65 4059 0.01% 66 3334 0.01% 67 4205 0.01% 68 3648 0.01% 69 5140 0.02% 70 5168 0.02% 71 6895 0.02% 72 6858 0.02% 73 8176 0.03% 74 9423 0.03% 75 9555 0.03% 76 10002 0.03% 77 11193 0.04% 78 12838 0.04% 79 14132 0.05% 80 30708368 99.52% 30857658 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=1.93 fanout-score-rank=29 prefix-density=0.16 prefix-fanout=1.9 sequence=CCCACTTGGAGC criterion=fanout-score sequence-density=0.07 sequence-density-rank=13 fanout-score=109.08 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=16.2 sequence=GGCGGCGGCGGCCT criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=8.27 fanout-score-rank=16 prefix-density=0.26 prefix-fanout=5.1 sequence=AAGGAGCTGGAGGAGGTGAAGAAGGAGTACCCTGACGCCTATGTCCGCATCATCGGCTTCGACAACACCAGGCAAGTGCAGTGCATCAGCTTCATCGCCTTCAAGCCACCGGGTTGTGAGGAGTCCGGCAAGGCCTAAGCAAGT criterion=fanout-score sequence-density=0.09 sequence-density-rank=8 fanout-score=138.00 fanout-score-rank=1 prefix-density=0.61 prefix-fanout=20.2 sequence=GCCGCCGCCGCC SRR12712207 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 18:42:02 Started mapping on | Dec 07 18:42:02 Finished on | Dec 07 18:43:22 Mapping speed, Million of reads per hour | 1388.59 Number of input reads | 30857658 Average input read length | 159 UNIQUE READS: Uniquely mapped reads number | 28579997 Uniquely mapped reads % | 92.62% Average mapped length | 159.35 Number of splices: Total | 15139197 Number of splices: Annotated (sjdb) | 14330935 Number of splices: GT/AG | 14917530 Number of splices: GC/AG | 187341 Number of splices: AT/AC | 6342 Number of splices: Non-canonical | 27984 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.02% Deletion average length | 2.18 Insertion rate per base | 0.01% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 625973 % of reads mapped to multiple loci | 2.03% Number of reads mapped to too many loci | 257082 % of reads mapped to too many loci | 0.83% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.21% % of reads unmapped: other | 2.31% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1652298 1652298 1652298 N_multimapping 625973 625973 625973 N_noFeature 976159 27748355 1221993 N_ambiguous 668965 3466 83583 UnstrandedReadsAssigned:26934873 PositiveStrandReadsAssigned:828176 NegativeStrandReadsAssigned:27274421 Dataset is classified negative stranded MeadianReadLen=80 20thPercentileLength=80 echo kmer=75 SRR12712207 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12712207-trimmed-pair1.fastq SRR12712207-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,857,658 reads, 27,519,166 reads pseudoaligned [quant] estimated average fragment length: 166.341 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,253 rounds 52973 SRR12712207.ke.tsv 35125 SRR12712207.se.tsv 88098 total ==> SRR12712207.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 770.808 2.65979e-08 1.89699e-09 PNS24247 1044 878.659 127.194 7.95812 PNS24249 1928 1762.66 163.921 5.11248 PNS24246 1044 878.659 127.194 7.95812 PNS24248 1044 878.659 127.194 7.95812 PNS24244 1471 1305.66 305.499 12.8631 PNS24243 293 133.85 0 0 KQK14069 1603 1437.66 37970.9 1451.98 KQK14071 474 310.162 574.685 101.861 ==> SRR12712207.se.tsv <== BRADI_1g14170v3 40187 BRADI_1g53295v3 1302 BRADI_1g59795v3 144 BRADI_1g07683v3 0 BRADI_1g00485v3 10 BRADI_1g20270v3 466 BRADI_1g74790v3 288 BRADI_1g09890v3 1 BRADI_1g77505v3 501 BRADI_1g48960v3 0 SRR12712207 completed mapping pipeline successfully