Starting /dee2/code/volunteer_pipeline.sh SRR12712208 current disk space = 1540544118784 free memory = 1602357124 SRR12712208 SRAfilesize 3b8a628db3061540770744c580d9a5d4 SRR12712208.sra SRR12712208.sra file validated SRR12712208 is paired end SRR12712208 is conventional basespace SRR12712208 read1 length is 80 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12712208_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 80 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.67675 38.0 38.0 38.0 32.0 38.0 2 36.88275 38.0 38.0 38.0 32.0 38.0 3 36.53575 38.0 38.0 38.0 32.0 38.0 4 36.732 38.0 38.0 38.0 32.0 38.0 5 36.64675 38.0 38.0 38.0 32.0 38.0 6 38.716 40.0 38.0 40.0 38.0 40.0 7 38.7985 40.0 38.0 40.0 38.0 40.0 8 38.95025 40.0 38.0 40.0 38.0 40.0 9 39.065 40.0 38.0 40.0 38.0 40.0 10-11 38.985625 40.0 38.0 40.0 38.0 40.0 12-13 39.060249999999996 40.0 38.0 40.0 38.0 40.0 14-15 38.81 40.0 38.0 40.0 38.0 40.0 16-17 39.002875 40.0 38.0 40.0 38.0 40.0 18-19 39.017125 40.0 38.0 40.0 38.0 40.0 20-21 39.007999999999996 40.0 38.0 40.0 38.0 40.0 22-23 38.972375 40.0 38.0 40.0 38.0 40.0 24-25 39.05825 40.0 38.0 40.0 38.0 40.0 26-27 38.71725 40.0 38.0 40.0 38.0 40.0 28-29 38.734625 40.0 38.0 40.0 38.0 40.0 30-31 38.899249999999995 40.0 38.0 40.0 38.0 40.0 32-33 38.893375 40.0 38.0 40.0 38.0 40.0 34-35 38.51875 40.0 38.0 40.0 38.0 40.0 36-37 38.83925 40.0 38.0 40.0 38.0 40.0 38-39 38.795625 40.0 38.0 40.0 38.0 40.0 40-41 38.897 40.0 38.0 40.0 38.0 40.0 42-43 38.88225 40.0 38.0 40.0 38.0 40.0 44-45 38.592875 40.0 38.0 40.0 38.0 40.0 46-47 38.8155 40.0 38.0 40.0 38.0 40.0 48-49 38.6515 40.0 38.0 40.0 38.0 40.0 50-51 38.781 40.0 38.0 40.0 38.0 40.0 52-53 38.73925 40.0 38.0 40.0 38.0 40.0 54-55 38.630375 40.0 38.0 40.0 38.0 40.0 56-57 38.6195 40.0 38.0 40.0 38.0 40.0 58-59 38.732124999999996 40.0 38.0 40.0 38.0 40.0 60-61 38.79600000000001 40.0 38.0 40.0 38.0 40.0 62-63 38.708375000000004 40.0 38.0 40.0 38.0 40.0 64-65 38.7185 40.0 38.0 40.0 38.0 40.0 66-67 38.577625 40.0 38.0 40.0 38.0 40.0 68-69 38.319375 40.0 38.0 40.0 38.0 40.0 70-71 38.64325 40.0 38.0 40.0 38.0 40.0 72-73 38.1005 40.0 38.0 40.0 38.0 40.0 74-75 38.4195 40.0 38.0 40.0 38.0 40.0 76-77 38.53525 40.0 38.0 40.0 38.0 40.0 78-79 38.356875 40.0 38.0 40.0 38.0 40.0 80 37.761 38.0 38.0 40.0 32.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 3.0 25 3.0 26 5.0 27 7.0 28 18.0 29 17.0 30 29.0 31 25.0 32 54.0 33 51.0 34 77.0 35 90.0 36 138.0 37 237.0 38 472.0 39 2774.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.1 12.55 6.35 37.0 2 26.72176308539945 13.799148509892312 30.252942649636864 29.226145755071375 3 23.625 16.525000000000002 21.875 37.974999999999994 4 28.325 22.425 19.875 29.375 5 28.749999999999996 26.85 22.0 22.400000000000002 6 24.875 28.825 23.325000000000003 22.975 7 20.150000000000002 23.225 36.575 20.05 8 22.325 21.725 28.199999999999996 27.750000000000004 9 22.025 19.825 33.15 25.0 10-11 25.1 27.3125 22.125 25.4625 12-13 24.2375 22.975 25.324999999999996 27.462500000000002 14-15 24.175 24.15 25.3125 26.3625 16-17 24.3 24.212500000000002 25.0125 26.474999999999998 18-19 24.725 24.5 23.925 26.85 20-21 24.6875 24.675 24.762500000000003 25.874999999999996 22-23 24.474999999999998 23.724999999999998 25.0125 26.787499999999998 24-25 25.0625 23.825 24.1875 26.924999999999997 26-27 25.1875 23.6875 24.6625 26.4625 28-29 24.975 23.849999999999998 24.4375 26.737499999999997 30-31 24.925 24.2 22.9625 27.9125 32-33 24.9 23.7875 24.8625 26.450000000000003 34-35 24.95 23.875 24.887500000000003 26.2875 36-37 24.8 23.525 24.425 27.250000000000004 38-39 24.1125 22.475 25.775 27.6375 40-41 25.275 23.4875 24.175 27.0625 42-43 24.85 24.1125 24.0625 26.974999999999998 44-45 25.5625 23.125 23.849999999999998 27.462500000000002 46-47 25.637500000000003 22.912499999999998 24.1125 27.3375 48-49 25.3 23.8375 24.224999999999998 26.637499999999996 50-51 24.1625 23.3375 25.3125 27.187499999999996 52-53 25.3 23.4875 23.7875 27.425 54-55 24.9375 23.075000000000003 24.6 27.3875 56-57 26.25 23.3125 23.7 26.737499999999997 58-59 25.412499999999998 24.025 23.3875 27.175 60-61 25.074999999999996 23.325000000000003 23.925 27.675 62-63 24.9 23.724999999999998 24.3625 27.0125 64-65 25.3 22.8875 24.7375 27.075 66-67 25.0625 24.025 23.6875 27.224999999999998 68-69 25.2625 23.9 24.275 26.5625 70-71 26.25 23.0125 24.1625 26.575 72-73 25.95 23.4375 23.6875 26.924999999999997 74-75 24.8 23.425 24.1625 27.6125 76-77 25.7 22.575 23.35 28.375 78-79 25.6125 24.7 22.8625 26.825 80 25.85 23.5 24.224999999999998 26.424999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.0 27 1.0 28 2.0 29 6.0 30 8.0 31 8.5 32 9.0 33 20.0 34 35.5 35 40.0 36 43.0 37 51.0 38 71.5 39 95.5 40 104.0 41 129.0 42 152.0 43 180.5 44 196.0 45 181.0 46 194.0 47 216.0 48 230.5 49 217.0 50 198.0 51 180.0 52 161.5 53 161.5 54 164.0 55 166.0 56 160.0 57 145.0 58 132.0 59 125.5 60 123.0 61 114.5 62 106.0 63 95.5 64 82.0 65 79.0 66 83.5 67 87.0 68 77.0 69 62.5 70 57.0 71 48.5 72 39.5 73 36.0 74 27.0 75 21.0 76 20.5 77 16.0 78 8.0 79 4.0 80 4.0 81 3.0 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.17500000000000002 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 80 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14271306101867 98.3 2 0.8572869389813415 1.7000000000000002 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 57 0.025 0.0 0.0 0.0 0.0 58 0.025 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.05 0.0 0.0 0.0 0.0 61 0.05 0.0 0.0 0.0 0.0 62 0.05 0.0 0.0 0.0 0.0 63 0.1 0.0 0.0 0.0 0.0 64 0.1 0.0 0.0 0.0 0.0 65 0.1 0.0 0.0 0.0 0.0 66 0.1 0.0 0.0 0.0 0.0 67 0.1 0.0 0.0 0.0 0.0 68 0.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12712208 read2 length is 80 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12712208_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 80 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3505 38.0 38.0 38.0 32.0 38.0 2 36.5485 38.0 38.0 38.0 32.0 38.0 3 35.84975 38.0 32.0 38.0 32.0 38.0 4 36.62775 38.0 38.0 38.0 32.0 38.0 5 36.6165 38.0 38.0 38.0 32.0 38.0 6 38.8115 40.0 38.0 40.0 38.0 40.0 7 38.60325 40.0 38.0 40.0 38.0 40.0 8 38.779 40.0 38.0 40.0 38.0 40.0 9 38.615 40.0 38.0 40.0 38.0 40.0 10-11 38.569374999999994 40.0 38.0 40.0 38.0 40.0 12-13 38.59975 40.0 38.0 40.0 38.0 40.0 14-15 38.7715 40.0 38.0 40.0 38.0 40.0 16-17 38.577875000000006 40.0 38.0 40.0 38.0 40.0 18-19 38.638999999999996 40.0 38.0 40.0 38.0 40.0 20-21 38.6575 40.0 38.0 40.0 38.0 40.0 22-23 38.740875 40.0 38.0 40.0 38.0 40.0 24-25 38.399125 40.0 38.0 40.0 38.0 40.0 26-27 38.601124999999996 40.0 38.0 40.0 38.0 40.0 28-29 38.542125 40.0 38.0 40.0 38.0 40.0 30-31 38.712 40.0 38.0 40.0 38.0 40.0 32-33 38.667625 40.0 38.0 40.0 38.0 40.0 34-35 38.619 40.0 38.0 40.0 38.0 40.0 36-37 38.561875 40.0 38.0 40.0 38.0 40.0 38-39 38.573875 40.0 38.0 40.0 38.0 40.0 40-41 38.184875000000005 40.0 38.0 40.0 38.0 40.0 42-43 38.433625 40.0 38.0 40.0 38.0 40.0 44-45 38.231 40.0 38.0 40.0 38.0 40.0 46-47 38.41375 40.0 38.0 40.0 38.0 40.0 48-49 38.491625 40.0 38.0 40.0 38.0 40.0 50-51 38.587 40.0 38.0 40.0 38.0 40.0 52-53 38.554874999999996 40.0 38.0 40.0 38.0 40.0 54-55 38.4755 40.0 38.0 40.0 38.0 40.0 56-57 38.32325 40.0 38.0 40.0 38.0 40.0 58-59 38.052125000000004 40.0 38.0 40.0 35.0 40.0 60-61 38.199625 40.0 38.0 40.0 38.0 40.0 62-63 38.101749999999996 40.0 38.0 40.0 38.0 40.0 64-65 38.317499999999995 40.0 38.0 40.0 38.0 40.0 66-67 37.982625 40.0 38.0 40.0 35.0 40.0 68-69 38.140874999999994 40.0 38.0 40.0 38.0 40.0 70-71 37.949875 40.0 38.0 40.0 38.0 40.0 72-73 38.126000000000005 40.0 38.0 40.0 38.0 40.0 74-75 38.074375 40.0 38.0 40.0 38.0 40.0 76-77 37.94562500000001 40.0 38.0 40.0 35.0 40.0 78-79 38.0415 40.0 38.0 40.0 38.0 40.0 80 35.70775 38.0 38.0 40.0 27.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 2.0 18 3.0 19 4.0 20 2.0 21 3.0 22 2.0 23 9.0 24 8.0 25 9.0 26 11.0 27 10.0 28 18.0 29 33.0 30 39.0 31 33.0 32 44.0 33 59.0 34 71.0 35 101.0 36 149.0 37 250.0 38 579.0 39 2561.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.574999999999996 20.225 9.625 32.574999999999996 2 31.1 25.174999999999997 23.474999999999998 20.25 3 24.275 25.7 26.625 23.400000000000002 4 25.8 30.875000000000004 19.400000000000002 23.925 5 29.075 29.475 19.625 21.825 6 26.375 33.4 18.525 21.7 7 24.0 18.775 32.15 25.074999999999996 8 24.349999999999998 21.6 23.175 30.875000000000004 9 25.174999999999997 21.224999999999998 25.424999999999997 28.175 10-11 28.325 26.1 19.7625 25.8125 12-13 26.5875 22.6 24.3625 26.450000000000003 14-15 26.35 23.775 23.7125 26.1625 16-17 27.037499999999998 23.7625 22.6125 26.5875 18-19 26.5 24.75 22.5875 26.1625 20-21 27.250000000000004 23.9375 23.95 24.8625 22-23 28.15 23.599999999999998 22.55 25.7 24-25 27.1125 24.2625 22.8375 25.7875 26-27 27.287499999999998 24.425 22.037499999999998 26.25 28-29 26.900000000000002 24.1125 22.5125 26.474999999999998 30-31 26.8625 24.337500000000002 23.1875 25.6125 32-33 26.8375 24.212500000000002 22.4625 26.487500000000004 34-35 27.0875 23.7375 23.4125 25.7625 36-37 26.9625 24.6 22.75 25.687500000000004 38-39 26.825 23.7125 23.4375 26.025 40-41 27.025 24.5125 23.0625 25.4 42-43 28.025 24.9375 21.775 25.2625 44-45 27.125 24.825 22.625 25.424999999999997 46-47 27.875 23.75 21.762500000000003 26.6125 48-49 27.075 24.25 23.3625 25.3125 50-51 26.674999999999997 24.425 23.175 25.724999999999998 52-53 28.050000000000004 23.962500000000002 22.2625 25.724999999999998 54-55 27.6 24.75 22.675 24.975 56-57 27.0125 23.6125 24.1625 25.2125 58-59 27.5875 24.587500000000002 22.3 25.525 60-61 27.025 24.95 23.175 24.85 62-63 28.1375 23.799999999999997 22.6875 25.374999999999996 64-65 28.1375 23.7625 21.975 26.125 66-67 27.35 24.275 23.474999999999998 24.9 68-69 27.175 23.575 23.4125 25.837500000000002 70-71 28.4125 23.6375 22.900000000000002 25.05 72-73 27.750000000000004 23.674999999999997 23.2625 25.3125 74-75 26.775 24.55 23.400000000000002 25.275 76-77 27.437499999999996 24.125 23.5125 24.925 78-79 26.737499999999997 24.087500000000002 23.6125 25.5625 80 27.650000000000002 24.025 22.825 25.5 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.5 23 0.5 24 1.0 25 2.0 26 1.5 27 0.5 28 0.5 29 1.5 30 2.0 31 3.0 32 6.5 33 10.5 34 19.0 35 26.0 36 31.0 37 48.5 38 72.0 39 100.5 40 118.0 41 128.0 42 149.0 43 176.0 44 184.5 45 177.0 46 205.5 47 231.5 48 209.0 49 197.0 50 205.0 51 183.0 52 158.0 53 147.0 54 147.5 55 156.0 56 155.0 57 139.5 58 137.0 59 141.0 60 133.0 61 138.0 62 127.0 63 105.5 64 98.0 65 96.0 66 95.0 67 83.5 68 73.5 69 64.0 70 54.0 71 51.5 72 45.0 73 39.5 74 36.5 75 35.0 76 27.0 77 14.0 78 6.5 79 5.0 80 6.0 81 3.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 80 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44695827048768 98.9 2 0.5530417295123178 1.0999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 57 0.025 0.0 0.0 0.0 0.0 58 0.025 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.05 0.0 0.0 0.0 0.0 61 0.05 0.0 0.0 0.0 0.0 62 0.05 0.0 0.0 0.0 0.0 63 0.1 0.0 0.0 0.0 0.0 64 0.1 0.0 0.0 0.0 0.0 65 0.1 0.0 0.0 0.0 0.0 66 0.1 0.0 0.0 0.0 0.0 67 0.1 0.0 0.0 0.0 0.0 68 0.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1331324 spots for SRR12712208.sra Written 1331324 spots for SRR12712208.sra Read 1331324 spots for SRR12712208.sra Written 1331324 spots for SRR12712208.sra Read 1331324 spots for SRR12712208.sra Written 1331324 spots for SRR12712208.sra Read 1331324 spots for SRR12712208.sra Written 1331324 spots for SRR12712208.sra Read 1331324 spots for SRR12712208.sra Written 1331324 spots for SRR12712208.sra Read 1331324 spots for SRR12712208.sra Written 1331324 spots for SRR12712208.sra Read 1331324 spots for SRR12712208.sra Written 1331324 spots for SRR12712208.sra Read 1331324 spots for SRR12712208.sra Written 1331324 spots for SRR12712208.sra Read 1331324 spots for SRR12712208.sra Written 1331324 spots for SRR12712208.sra Read 1331324 spots for SRR12712208.sra Written 1331324 spots for SRR12712208.sra Read 1331324 spots for SRR12712208.sra Written 1331324 spots for SRR12712208.sra Read 1331324 spots for SRR12712208.sra Written 1331324 spots for SRR12712208.sra Read 1331324 spots for SRR12712208.sra Written 1331324 spots for SRR12712208.sra Read 1331324 spots for SRR12712208.sra Written 1331324 spots for SRR12712208.sra Read 1331324 spots for SRR12712208.sra Written 1331324 spots for SRR12712208.sra Read 1331324 spots for SRR12712208.sra Written 1331324 spots for SRR12712208.sra Read 1331338 spots for SRR12712208.sra Written 1331338 spots for SRR12712208.sra Read 1331324 spots for SRR12712208.sra Written 1331324 spots for SRR12712208.sra Read 1331324 spots for SRR12712208.sra Written 1331324 spots for SRR12712208.sra Read 1331324 spots for SRR12712208.sra Written 1331324 spots for SRR12712208.sra SRR ids: ['SRR12712208.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_eocfh4nh SRR12712208.sra spots: 26626494 blocks: [[1, 1331324], [1331325, 2662648], [2662649, 3993972], [3993973, 5325296], [5325297, 6656620], [6656621, 7987944], [7987945, 9319268], [9319269, 10650592], [10650593, 11981916], [11981917, 13313240], [13313241, 14644564], [14644565, 15975888], [15975889, 17307212], [17307213, 18638536], [18638537, 19969860], [19969861, 21301184], [21301185, 22632508], [22632509, 23963832], [23963833, 25295156], [25295157, 26626494]] SRR12712208 file size 5308798 SRR12712208 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12712208 SRR12712208_1.fastq SRR12712208_2.fastq Input file: SRR12712208_1.fastq Paired file: SRR12712208_2.fastq trimmed: SRR12712208-trimmed-pair1.fastq, SRR12712208-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 18:40:35 2024 >> started Sat Dec 7 18:40:57 2024 >> done (22.003s) 26626494 read pairs processed; of these: 1337 ( 0.01%) short read pairs filtered out after trimming by size control 2354 ( 0.01%) empty read pairs filtered out after trimming by size control 26622803 (99.99%) read pairs available; of these: 101258 ( 0.38%) trimmed read pairs available after processing 26521545 (99.62%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 4 0.00% 20 6 0.00% 21 2 0.00% 22 2 0.00% 23 4 0.00% 24 1 0.00% 25 5 0.00% 26 7 0.00% 27 7 0.00% 28 10 0.00% 29 7 0.00% 30 13 0.00% 31 16 0.00% 32 35 0.00% 33 36 0.00% 34 35 0.00% 35 33 0.00% 36 47 0.00% 37 48 0.00% 38 66 0.00% 39 64 0.00% 40 79 0.00% 41 107 0.00% 42 100 0.00% 43 158 0.00% 44 131 0.00% 45 148 0.00% 46 166 0.00% 47 178 0.00% 48 238 0.00% 49 893 0.00% 50 697 0.00% 51 1116 0.00% 52 985 0.00% 53 748 0.00% 54 1569 0.01% 55 818 0.00% 56 1392 0.01% 57 1334 0.01% 58 1954 0.01% 59 1705 0.01% 60 1848 0.01% 61 2265 0.01% 62 1628 0.01% 63 2853 0.01% 64 2039 0.01% 65 2832 0.01% 66 2295 0.01% 67 2851 0.01% 68 2301 0.01% 69 3678 0.01% 70 3343 0.01% 71 4522 0.02% 72 4393 0.02% 73 5593 0.02% 74 6498 0.02% 75 6233 0.02% 76 6345 0.02% 77 7100 0.03% 78 8497 0.03% 79 9173 0.03% 80 26521545 99.62% 26622803 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=7.28 fanout-score-rank=8 prefix-density=0.31 prefix-fanout=3.9 sequence=CTTCTTGTGCTC criterion=fanout-score sequence-density=0.10 sequence-density-rank=13 fanout-score=27.20 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=7.8 sequence=CTGCTGCTGCTGTGGCCGTCTTCCTTCTTGTGGCCCTCGCCGTGCTTCTTCT criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.33 fanout-score-rank=31 prefix-density=0.27 prefix-fanout=2.2 sequence=CCTAAGCAAGTT criterion=fanout-score sequence-density=0.09 sequence-density-rank=26 fanout-score=131.69 fanout-score-rank=1 prefix-density=0.63 prefix-fanout=17.9 sequence=CCGCCGCCGCCG SRR12712208 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 18:41:47 Started mapping on | Dec 07 18:41:47 Finished on | Dec 07 18:42:59 Mapping speed, Million of reads per hour | 1331.14 Number of input reads | 26622803 Average input read length | 159 UNIQUE READS: Uniquely mapped reads number | 23665553 Uniquely mapped reads % | 88.89% Average mapped length | 159.38 Number of splices: Total | 12333500 Number of splices: Annotated (sjdb) | 11678883 Number of splices: GT/AG | 12154805 Number of splices: GC/AG | 152948 Number of splices: AT/AC | 4635 Number of splices: Non-canonical | 21112 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.02% Deletion average length | 2.20 Insertion rate per base | 0.01% Insertion average length | 2.21 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 830571 % of reads mapped to multiple loci | 3.12% Number of reads mapped to too many loci | 415510 % of reads mapped to too many loci | 1.56% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.22% % of reads unmapped: other | 4.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2127168 2127168 2127168 N_multimapping 830571 830571 830571 N_noFeature 847401 22992859 1052109 N_ambiguous 538836 2599 71099 UnstrandedReadsAssigned:22279316 PositiveStrandReadsAssigned:670095 NegativeStrandReadsAssigned:22542345 Dataset is classified negative stranded MeadianReadLen=80 20thPercentileLength=80 echo kmer=75 SRR12712208 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12712208-trimmed-pair1.fastq SRR12712208-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,622,803 reads, 22,802,310 reads pseudoaligned [quant] estimated average fragment length: 167.748 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,205 rounds 52973 SRR12712208.ke.tsv 35125 SRR12712208.se.tsv 88098 total ==> SRR12712208.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 769.518 7.68804 0.623919 PNS24247 1044 877.252 86.7351 6.1745 PNS24249 1928 1761.25 115.414 4.0923 PNS24246 1044 877.252 86.7351 6.1745 PNS24248 1044 877.252 86.7351 6.1745 PNS24244 1471 1304.25 175.693 8.41248 PNS24243 293 132.046 1 0.472939 KQK14069 1603 1436.25 38562.4 1676.73 KQK14071 474 308.746 965.147 195.22 ==> SRR12712208.se.tsv <== BRADI_1g14170v3 41114 BRADI_1g53295v3 957 BRADI_1g59795v3 102 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 259 BRADI_1g74790v3 185 BRADI_1g09890v3 0 BRADI_1g77505v3 424 BRADI_1g48960v3 0 SRR12712208 completed mapping pipeline successfully