Starting /dee2/code/volunteer_pipeline.sh SRR12897241 current disk space = 1542947426304 free memory = 1596856088 SRR12897241 SRAfilesize 88bd63683d492b205157aec33c05b7cf SRR12897241.sra SRR12897241.sra file validated SRR12897241 is single end SRR12897241 is conventional basespace SRR12897241 read1 length is 45-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12897241_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 45-101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.662 37.0 37.0 37.0 37.0 37.0 2 36.597 37.0 37.0 37.0 37.0 37.0 3 36.7095 37.0 37.0 37.0 37.0 37.0 4 36.7225 37.0 37.0 37.0 37.0 37.0 5 36.7455 37.0 37.0 37.0 37.0 37.0 6 36.769 37.0 37.0 37.0 37.0 37.0 7 36.6705 37.0 37.0 37.0 37.0 37.0 8 36.737 37.0 37.0 37.0 37.0 37.0 9 36.741 37.0 37.0 37.0 37.0 37.0 10-11 36.75925 37.0 37.0 37.0 37.0 37.0 12-13 36.7475 37.0 37.0 37.0 37.0 37.0 14-15 36.73925 37.0 37.0 37.0 37.0 37.0 16-17 36.711749999999995 37.0 37.0 37.0 37.0 37.0 18-19 36.76975 37.0 37.0 37.0 37.0 37.0 20-21 36.758250000000004 37.0 37.0 37.0 37.0 37.0 22-23 36.71125 37.0 37.0 37.0 37.0 37.0 24-25 36.72075 37.0 37.0 37.0 37.0 37.0 26-27 36.65975 37.0 37.0 37.0 37.0 37.0 28-29 36.64875 37.0 37.0 37.0 37.0 37.0 30-31 36.72825 37.0 37.0 37.0 37.0 37.0 32-33 36.655 37.0 37.0 37.0 37.0 37.0 34-35 36.7 37.0 37.0 37.0 37.0 37.0 36-37 36.643 37.0 37.0 37.0 37.0 37.0 38-39 36.657 37.0 37.0 37.0 37.0 37.0 40-41 36.690749999999994 37.0 37.0 37.0 37.0 37.0 42-43 36.635999999999996 37.0 37.0 37.0 37.0 37.0 44-45 36.635 37.0 37.0 37.0 37.0 37.0 46-47 36.65791447861966 37.0 37.0 37.0 37.0 37.0 48-49 36.66116529132283 37.0 37.0 37.0 37.0 37.0 50-51 36.72218054513628 37.0 37.0 37.0 37.0 37.0 52-53 36.65557778889445 37.0 37.0 37.0 37.0 37.0 54-55 36.670335167583794 37.0 37.0 37.0 37.0 37.0 56-57 36.66458229114557 37.0 37.0 37.0 37.0 37.0 58-59 36.59954977488744 37.0 37.0 37.0 37.0 37.0 60-61 36.62381190595298 37.0 37.0 37.0 37.0 37.0 62-63 36.63581790895448 37.0 37.0 37.0 37.0 37.0 64-65 36.67208604302151 37.0 37.0 37.0 37.0 37.0 66-67 36.6895947973987 37.0 37.0 37.0 37.0 37.0 68-69 36.637525355121895 37.0 37.0 37.0 37.0 37.0 70-71 36.58758758758759 37.0 37.0 37.0 37.0 37.0 72-73 36.62648058445616 37.0 37.0 37.0 37.0 37.0 74-75 36.66499749624437 37.0 37.0 37.0 37.0 37.0 76-77 36.605912150032964 37.0 37.0 37.0 37.0 37.0 78-79 36.549150598523404 37.0 37.0 37.0 37.0 37.0 80-81 36.58568443367046 37.0 37.0 37.0 37.0 37.0 82-83 36.5773193275615 37.0 37.0 37.0 37.0 37.0 84-85 36.54047825764671 37.0 37.0 37.0 37.0 37.0 86-87 36.59610027325879 37.0 37.0 37.0 37.0 37.0 88-89 36.62525201612903 37.0 37.0 37.0 37.0 37.0 90-91 36.624549426006666 37.0 37.0 37.0 37.0 37.0 92-93 36.601612772522905 37.0 37.0 37.0 37.0 37.0 94-95 36.52025612656878 37.0 37.0 37.0 37.0 37.0 96-97 36.57051281509247 37.0 37.0 37.0 37.0 37.0 98-99 36.59852133287559 37.0 37.0 37.0 37.0 37.0 100-101 36.53519334024354 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 2.0 23 0.0 24 2.0 25 2.0 26 2.0 27 3.0 28 4.0 29 4.0 30 10.0 31 19.0 32 22.0 33 28.0 34 48.0 35 96.0 36 2072.0 37 1685.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.11905952976488 11.305652826413207 4.377188594297149 46.19809904952476 2 20.575 12.975 37.125 29.325000000000003 3 16.75 15.45 26.474999999999998 41.325 4 24.175 24.55 22.1 29.175 5 25.924999999999997 28.825 22.525000000000002 22.725 6 22.8 31.6 22.825 22.775000000000002 7 16.35 25.55 39.0 19.1 8 18.6 24.65 32.1 24.65 9 18.45 21.175 34.475 25.900000000000002 10-11 22.662499999999998 30.725 23.375 23.2375 12-13 21.55 24.7375 27.05 26.6625 14-15 21.587500000000002 26.387500000000003 26.5625 25.4625 16-17 23.7125 25.25 25.85 25.1875 18-19 21.512500000000003 26.75 25.650000000000002 26.087500000000002 20-21 22.225 25.724999999999998 26.7625 25.2875 22-23 22.237499999999997 26.0375 25.974999999999998 25.75 24-25 22.3125 26.25 26.200000000000003 25.2375 26-27 21.925 25.162499999999998 26.8625 26.05 28-29 22.787499999999998 25.4875 26.700000000000003 25.025 30-31 23.6125 25.25 25.1875 25.95 32-33 22.5 25.900000000000002 26.400000000000002 25.2 34-35 22.05 26.8625 25.2625 25.825 36-37 22.7 25.05 26.2875 25.9625 38-39 22.3125 25.6125 25.0375 27.037499999999998 40-41 23.9375 26.650000000000002 24.8 24.6125 42-43 22.4375 26.5125 25.412499999999998 25.637500000000003 44-45 23.025000000000002 26.6 25.775 24.6 46-47 23.36834208552138 26.219054763690924 25.64391097774444 24.76869217304326 48-49 22.61815453863466 26.70667666916729 25.206301575393848 25.468867216804203 50-51 23.15578894723681 25.71892973243311 25.756439109777446 25.36884221055264 52-53 22.811405702851424 26.40070035017509 26.350675337668832 24.437218609304654 54-55 20.885442721360683 26.675837918959477 25.812906453226613 26.625812906453227 56-57 21.61080540270135 26.18809404702351 26.738369184592298 25.46273136568284 58-59 23.336668334167083 25.850425212606304 25.137568784392194 25.67533766883442 60-61 23.51175587793897 25.700350175087543 26.113056528264135 24.674837418709355 62-63 23.974487243621812 25.325162581290645 26.388194097048522 24.312156078039017 64-65 22.823911955977987 25.76288144072036 26.700850425212607 24.712356178089045 66-67 23.411705852926463 25.700350175087543 24.92496248124062 25.962981490745374 68-69 22.22639149468418 26.391494684177612 25.67854909318324 25.70356472795497 70-71 22.25975975975976 26.238738738738736 26.45145145145145 25.05005005005005 72-73 22.38077356365002 25.923144323444735 25.747903367129805 25.94817874577544 74-75 22.69654481722584 26.10165247871808 25.901352028042062 25.30045067601402 76-77 22.923712889891018 26.19316046599023 25.86746837028686 25.015658273831892 78-79 22.204112337011033 25.576730190571716 26.165997993981943 26.053159478435305 80-81 23.074027603513176 26.097867001254706 25.558343789209538 25.269761606022584 82-83 22.30035158211954 26.594676042189853 26.04218985434455 25.062782521346055 84-85 22.385620915032682 25.816993464052292 26.47058823529412 25.326797385620914 86-87 23.51830879577199 24.902478922863974 25.456146973700765 26.123065307663268 88-89 23.4375 26.86491935483871 24.760584677419356 24.936995967741936 90-91 23.431384926145686 25.956318646635523 25.47658123974246 25.135715187476325 92-93 22.23487724626677 25.702353834472287 25.436598329536825 26.62617058972412 94-95 23.36294416243655 26.49746192893401 25.279187817258887 24.860406091370557 96-97 23.004335628666155 25.388931395052282 26.154042336138737 25.452690640142823 98-99 22.56263793327275 24.7436063871219 26.625989874075035 26.067765805530314 100-101 24.093392945851964 11.806590495115085 31.495280675608544 32.60473588342441 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 1.0 27 1.5 28 3.0 29 4.0 30 8.0 31 11.5 32 11.5 33 16.0 34 28.0 35 38.5 36 44.0 37 59.0 38 77.5 39 92.5 40 127.5 41 157.0 42 172.0 43 195.5 44 219.5 45 224.5 46 205.5 47 205.5 48 198.0 49 177.5 50 172.5 51 168.0 52 160.5 53 154.0 54 135.0 55 110.0 56 101.0 57 90.5 58 91.5 59 89.5 60 68.5 61 59.5 62 62.0 63 55.0 64 45.5 65 40.5 66 30.0 67 27.0 68 26.5 69 18.0 70 10.5 71 4.5 72 2.5 73 1.0 74 0.5 75 0.5 76 0.5 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 44-45 1.0 46-47 0.0 48-49 0.0 50-51 1.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 2.0 70-71 1.0 72-73 1.0 74-75 2.0 76-77 2.0 78-79 4.0 80-81 2.0 82-83 5.0 84-85 3.0 86-87 8.0 88-89 4.0 90-91 9.0 92-93 10.0 94-95 16.0 96-97 37.0 98-99 379.0 100-101 3513.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.55 #Duplication Level Percentage of deduplicated Percentage of total 1 94.60602855631942 89.45 2 5.023796932839767 9.5 3 0.370174510840825 1.05 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0125 0.0 0.0 54-55 0.0 0.0 0.025 0.0 0.0 56-57 0.0 0.0 0.025 0.0 0.0 58-59 0.0 0.0 0.025 0.0 0.0 60-61 0.0 0.0 0.025 0.0 0.0 62-63 0.0 0.0 0.025 0.0 0.0 64-65 0.0 0.0 0.025 0.0 0.0 66-67 0.0 0.0 0.025 0.0 0.0 68-69 0.0 0.0 0.025 0.0 0.0 70-71 0.0 0.0 0.025 0.0 0.0 72-73 0.0 0.0 0.025 0.0 0.0 74-75 0.0 0.0 0.025 0.0 0.0 76-77 0.0 0.0 0.025 0.0 0.0 78-79 0.0 0.0 0.025 0.0 0.0 80-81 0.0 0.0 0.025 0.0 0.0 82-83 0.0 0.0 0.025 0.0 0.0 84-85 0.0 0.0 0.025 0.0 0.0 86-87 0.0 0.0 0.025 0.0 0.0 88-89 0.0 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 896151 READS because READLEN < 1 Read 896151 spots for SRR12897241.sra Written 896151 spots for SRR12897241.sra Rejected 896151 READS because READLEN < 1 Read 896151 spots for SRR12897241.sra Written 896151 spots for SRR12897241.sra Rejected 896151 READS because READLEN < 1 Read 896151 spots for SRR12897241.sra Written 896151 spots for SRR12897241.sra Rejected 896151 READS because READLEN < 1 Read 896151 spots for SRR12897241.sra Written 896151 spots for SRR12897241.sra Rejected 896151 READS because READLEN < 1 Read 896151 spots for SRR12897241.sra Written 896151 spots for SRR12897241.sra Rejected 896151 READS because READLEN < 1 Read 896151 spots for SRR12897241.sra Written 896151 spots for SRR12897241.sra Rejected 896151 READS because READLEN < 1 Read 896151 spots for SRR12897241.sra Written 896151 spots for SRR12897241.sra Rejected 896151 READS because READLEN < 1 Read 896151 spots for SRR12897241.sra Written 896151 spots for SRR12897241.sra Rejected 896151 READS because READLEN < 1 Read 896151 spots for SRR12897241.sra Written 896151 spots for SRR12897241.sra Rejected 896151 READS because READLEN < 1 Read 896151 spots for SRR12897241.sra Written 896151 spots for SRR12897241.sra Rejected 896153 READS because READLEN < 1 Read 896153 spots for SRR12897241.sra Written 896153 spots for SRR12897241.sra Rejected 896151 READS because READLEN < 1 Read 896151 spots for SRR12897241.sra Written 896151 spots for SRR12897241.sra Rejected 896151 READS because READLEN < 1 Read 896151 spots for SRR12897241.sra Written 896151 spots for SRR12897241.sra Rejected 896151 READS because READLEN < 1 Read 896151 spots for SRR12897241.sra Written 896151 spots for SRR12897241.sra Rejected 896151 READS because READLEN < 1 Read 896151 spots for SRR12897241.sra Written 896151 spots for SRR12897241.sra Rejected 896151 READS because READLEN < 1 Read 896151 spots for SRR12897241.sra Written 896151 spots for SRR12897241.sra Rejected 896151 READS because READLEN < 1 Read 896151 spots for SRR12897241.sra Written 896151 spots for SRR12897241.sra Rejected 896151 READS because READLEN < 1 Read 896151 spots for SRR12897241.sra Written 896151 spots for SRR12897241.sra Rejected 896151 READS because READLEN < 1 Read 896151 spots for SRR12897241.sra Written 896151 spots for SRR12897241.sra Rejected 896151 READS because READLEN < 1 Read 896151 spots for SRR12897241.sra Written 896151 spots for SRR12897241.sra SRR ids: ['SRR12897241.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_e7fhaozd SRR12897241.sra spots: 17923022 blocks: [[1, 896151], [896152, 1792302], [1792303, 2688453], [2688454, 3584604], [3584605, 4480755], [4480756, 5376906], [5376907, 6273057], [6273058, 7169208], [7169209, 8065359], [8065360, 8961510], [8961511, 9857661], [9857662, 10753812], [10753813, 11649963], [11649964, 12546114], [12546115, 13442265], [13442266, 14338416], [14338417, 15234567], [15234568, 16130718], [16130719, 17026869], [17026870, 17923022]] SRR12897241 file size 4289968 SRR12897241 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12897241 SRR12897241_1.fastq Input file: SRR12897241_1.fastq trimmed: SRR12897241-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 11:59:06 2024 >> started Sat Dec 7 11:59:15 2024 >> done (9.042s) 17923022 reads processed; of these: 8 ( 0.00%) short reads filtered out after trimming by size control 2366 ( 0.01%) empty reads filtered out after trimming by size control 17920648 (99.99%) reads available; of these: 311 ( 0.00%) trimmed reads available after processing 17920337 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 21 1 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 1 0.00% 27 2 0.00% 28 2 0.00% 29 2 0.00% 30 0 0.00% 31 1 0.00% 32 0 0.00% 33 1 0.00% 34 1 0.00% 35 34 0.00% 36 52 0.00% 37 44 0.00% 38 74 0.00% 39 76 0.00% 40 85 0.00% 41 95 0.00% 42 88 0.00% 43 100 0.00% 44 106 0.00% 45 100 0.00% 46 131 0.00% 47 167 0.00% 48 194 0.00% 49 231 0.00% 50 300 0.00% 51 311 0.00% 52 339 0.00% 53 378 0.00% 54 378 0.00% 55 393 0.00% 56 492 0.00% 57 573 0.00% 58 668 0.00% 59 812 0.00% 60 939 0.01% 61 1089 0.01% 62 1173 0.01% 63 1269 0.01% 64 1393 0.01% 65 1442 0.01% 66 1536 0.01% 67 1718 0.01% 68 1918 0.01% 69 2251 0.01% 70 2619 0.01% 71 2911 0.02% 72 3319 0.02% 73 3687 0.02% 74 4134 0.02% 75 4438 0.02% 76 4954 0.03% 77 5527 0.03% 78 6018 0.03% 79 6822 0.04% 80 7728 0.04% 81 8306 0.05% 82 9615 0.05% 83 10628 0.06% 84 11881 0.07% 85 13336 0.07% 86 14372 0.08% 87 15823 0.09% 88 17448 0.10% 89 18639 0.10% 90 20727 0.12% 91 23015 0.13% 92 23451 0.13% 93 26072 0.15% 94 29464 0.16% 95 34133 0.19% 96 56391 0.31% 97 119293 0.67% 98 365597 2.04% 99 1214131 6.78% 100 4229111 23.60% 101 11586098 64.65% 17920648 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.89 fanout-score-rank=28 prefix-density=0.14 prefix-fanout=2.9 sequence=GTGATGGTCTTGCC criterion=fanout-score sequence-density=0.06 sequence-density-rank=19 fanout-score=391.11 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=32.9 sequence=CTTCTTCTTCCT Started job on | Dec 07 11:59:36 Started mapping on | Dec 07 11:59:36 Finished on | Dec 07 12:00:14 Mapping speed, Million of reads per hour | 1697.75 Number of input reads | 17920648 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 16623657 Uniquely mapped reads % | 92.76% Average mapped length | 100.00 Number of splices: Total | 5463907 Number of splices: Annotated (sjdb) | 5193381 Number of splices: GT/AG | 5382303 Number of splices: GC/AG | 70191 Number of splices: AT/AC | 3355 Number of splices: Non-canonical | 8058 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 2.34 Insertion rate per base | 0.01% Insertion average length | 1.76 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 241745 % of reads mapped to multiple loci | 1.35% Number of reads mapped to too many loci | 87801 % of reads mapped to too many loci | 0.49% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.36% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1055246 1055246 1055246 N_multimapping 241745 241745 241745 N_noFeature 721970 16191688 833558 N_ambiguous 344031 1335 24835 UnstrandedReadsAssigned:15557656 PositiveStrandReadsAssigned:430634 NegativeStrandReadsAssigned:15765264 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR12897241 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR12897241-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,920,648 reads, 15,880,616 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,211 rounds 52973 SRR12897241.ke.tsv 35125 SRR12897241.se.tsv 88098 total ==> SRR12897241.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 96.4398 12.4375 PNS24247 1044 945 67.4278 7.70214 PNS24249 1928 1829 3.75279 0.221485 PNS24246 1044 945 67.4278 7.70214 PNS24248 1044 945 67.4278 7.70214 PNS24244 1471 1372 135.524 10.6627 PNS24243 293 194 0 0 KQK14069 1603 1504 4256.46 305.496 KQK14071 474 375 115.06 33.1206 ==> SRR12897241.se.tsv <== BRADI_1g14170v3 4595 BRADI_1g53295v3 52 BRADI_1g59795v3 335 BRADI_1g07683v3 0 BRADI_1g00485v3 23 BRADI_1g20270v3 504 BRADI_1g74790v3 95 BRADI_1g09890v3 0 BRADI_1g77505v3 131 BRADI_1g48960v3 0 SRR12897241 completed mapping pipeline successfully