Starting /dee2/code/volunteer_pipeline.sh SRR12897242 current disk space = 1543006810112 free memory = 1479052320 SRR12897242 SRAfilesize ea2dd409a24a2d25122ce981e94be0b5 SRR12897242.sra SRR12897242.sra file validated SRR12897242 is single end SRR12897242 is conventional basespace SRR12897242 read1 length is 41-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12897242_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 41-101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.63625 37.0 37.0 37.0 37.0 37.0 2 36.5755 37.0 37.0 37.0 37.0 37.0 3 36.6605 37.0 37.0 37.0 37.0 37.0 4 36.725 37.0 37.0 37.0 37.0 37.0 5 36.7055 37.0 37.0 37.0 37.0 37.0 6 36.737 37.0 37.0 37.0 37.0 37.0 7 36.6975 37.0 37.0 37.0 37.0 37.0 8 36.7095 37.0 37.0 37.0 37.0 37.0 9 36.6725 37.0 37.0 37.0 37.0 37.0 10-11 36.704499999999996 37.0 37.0 37.0 37.0 37.0 12-13 36.74625 37.0 37.0 37.0 37.0 37.0 14-15 36.71825 37.0 37.0 37.0 37.0 37.0 16-17 36.716 37.0 37.0 37.0 37.0 37.0 18-19 36.7285 37.0 37.0 37.0 37.0 37.0 20-21 36.6625 37.0 37.0 37.0 37.0 37.0 22-23 36.70625 37.0 37.0 37.0 37.0 37.0 24-25 36.70925 37.0 37.0 37.0 37.0 37.0 26-27 36.704750000000004 37.0 37.0 37.0 37.0 37.0 28-29 36.68425 37.0 37.0 37.0 37.0 37.0 30-31 36.704750000000004 37.0 37.0 37.0 37.0 37.0 32-33 36.681250000000006 37.0 37.0 37.0 37.0 37.0 34-35 36.612 37.0 37.0 37.0 37.0 37.0 36-37 36.651250000000005 37.0 37.0 37.0 37.0 37.0 38-39 36.622749999999996 37.0 37.0 37.0 37.0 37.0 40-41 36.65875 37.0 37.0 37.0 37.0 37.0 42-43 36.65566391597899 37.0 37.0 37.0 37.0 37.0 44-45 36.67966991747937 37.0 37.0 37.0 37.0 37.0 46-47 36.64641160290073 37.0 37.0 37.0 37.0 37.0 48-49 36.65941485371343 37.0 37.0 37.0 37.0 37.0 50-51 36.65991497874468 37.0 37.0 37.0 37.0 37.0 52-53 36.62065516379095 37.0 37.0 37.0 37.0 37.0 54-55 36.61040260065016 37.0 37.0 37.0 37.0 37.0 56-57 36.619404851212806 37.0 37.0 37.0 37.0 37.0 58-59 36.621405351337835 37.0 37.0 37.0 37.0 37.0 60-61 36.602400600150034 37.0 37.0 37.0 37.0 37.0 62-63 36.570142535633906 37.0 37.0 37.0 37.0 37.0 64-65 36.61360681591108 37.0 37.0 37.0 37.0 37.0 66-67 36.62775883813811 37.0 37.0 37.0 37.0 37.0 68-69 36.593093093093096 37.0 37.0 37.0 37.0 37.0 70-71 36.589625586954895 37.0 37.0 37.0 37.0 37.0 72-73 36.59844479781487 37.0 37.0 37.0 37.0 37.0 74-75 36.61232592035924 37.0 37.0 37.0 37.0 37.0 76-77 36.59522735563866 37.0 37.0 37.0 37.0 37.0 78-79 36.60245233486512 37.0 37.0 37.0 37.0 37.0 80-81 36.548785896262 37.0 37.0 37.0 37.0 37.0 82-83 36.60730214699473 37.0 37.0 37.0 37.0 37.0 84-85 36.58452970898778 37.0 37.0 37.0 37.0 37.0 86-87 36.62306555716747 37.0 37.0 37.0 37.0 37.0 88-89 36.596256370646856 37.0 37.0 37.0 37.0 37.0 90-91 36.594938484454104 37.0 37.0 37.0 37.0 37.0 92-93 36.54857405411762 37.0 37.0 37.0 37.0 37.0 94-95 36.57760375814263 37.0 37.0 37.0 37.0 37.0 96-97 36.56665209035778 37.0 37.0 37.0 37.0 37.0 98-99 36.59356983687897 37.0 37.0 37.0 37.0 37.0 100-101 36.513851158906206 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 3.0 25 2.0 26 2.0 27 7.0 28 6.0 29 13.0 30 6.0 31 19.0 32 17.0 33 28.0 34 54.0 35 104.0 36 2068.0 37 1671.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.11845730027548 12.221387427998998 4.232406711745554 44.42774855997996 2 19.325 12.775 38.15 29.75 3 17.25 16.150000000000002 27.500000000000004 39.1 4 25.2 23.724999999999998 22.775000000000002 28.299999999999997 5 26.05 29.25 23.05 21.65 6 22.5 31.95 23.0 22.55 7 17.625 24.175 39.125 19.075 8 18.575 24.075 31.7 25.650000000000002 9 17.8 22.375 36.075 23.75 10-11 22.400000000000002 30.55 24.224999999999998 22.825 12-13 21.7375 24.2875 27.0125 26.9625 14-15 22.162499999999998 25.424999999999997 27.6 24.8125 16-17 22.6375 25.8125 25.825 25.724999999999998 18-19 21.512500000000003 26.1 26.9125 25.474999999999998 20-21 22.85 25.825 25.162499999999998 26.1625 22-23 22.225 26.4625 25.7875 25.525 24-25 22.15 25.887500000000003 25.5625 26.400000000000002 26-27 21.349999999999998 26.1125 26.775 25.7625 28-29 22.675 26.924999999999997 25.174999999999997 25.224999999999998 30-31 22.15 26.3625 25.5 25.9875 32-33 22.0 26.7125 25.1 26.187500000000004 34-35 22.475 26.5625 25.2625 25.7 36-37 22.75 25.6 25.224999999999998 26.424999999999997 38-39 22.8 26.6 25.1875 25.412499999999998 40-41 22.412499999999998 26.1625 26.375 25.05 42-43 21.580395098774694 26.38159539884971 26.994248562140534 25.04376094023506 44-45 22.55563890972743 25.431357839459867 26.84421105276319 25.168792198049513 46-47 21.980495123780948 26.281570392598148 27.231807951987996 24.50612653163291 48-49 22.455613903475868 26.30657664416104 25.968992248062015 25.268817204301076 50-51 22.43060765191298 26.65666416604151 26.03150787696924 24.88122030507627 52-53 22.768192048012004 25.64391097774444 26.51912978244561 25.068767191797946 54-55 22.455613903475868 25.78144536134033 26.6816704176044 25.081270317579396 56-57 21.655413853463365 26.431607901975497 25.6064016004001 26.30657664416104 58-59 22.73068267066767 26.16904226056514 25.381345336334082 25.71892973243311 60-61 21.642910727681922 26.76919229807452 25.243810952738183 26.344086021505376 62-63 22.06801700425106 26.556639159789945 25.618904726181547 25.756439109777446 64-65 22.683506314868076 26.20982868575716 26.109791171689384 24.99687382768538 66-67 22.451532207629768 26.67917448405253 26.091307066916826 24.777986241400875 68-69 22.22222222222222 26.33883883883884 25.93843843843844 25.5005005005005 70-71 22.533800701051575 25.450676014021035 27.01552328492739 25.0 72-73 21.8687374749499 25.93937875751503 26.828657314629258 25.363226452905813 74-75 22.592778335005015 26.504513540621865 25.388665997993982 25.514042126379138 76-77 22.310106716886377 26.202134337727557 27.106089139987443 24.38166980539862 78-79 23.01796708129162 26.071114461615778 25.757004648825227 25.15391380826737 80-81 22.346579476861166 26.10663983903421 26.597082494969822 24.949698189134807 82-83 23.44870988042794 26.028949024543742 26.393958464443045 24.128382630585275 84-85 23.385469223007064 25.88294651866801 24.697275479313824 26.034308779011102 86-87 21.24889394513968 27.468082416887878 26.20401971937808 25.07900391859436 88-89 22.907433202481954 25.32607319235153 26.80764847410409 24.95884513106243 90-91 22.909783989834818 26.04828462515883 26.04828462515883 24.993646759847522 92-93 22.02244325427187 26.68961999489926 25.61846467737822 25.66947207345065 94-95 22.385767310892103 26.007935492128503 26.135927300652757 25.470369896326634 96-97 22.476533367622476 26.616947409026615 25.51112254082551 25.395396682525394 98-99 21.568884232582505 25.353588266107913 26.96437925615506 26.113148245154534 100-101 23.40602630264691 12.135841518228734 32.46212751789579 31.996004661228568 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 1.0 27 2.0 28 4.5 29 5.5 30 9.0 31 12.5 32 14.0 33 24.5 34 33.0 35 28.0 36 46.0 37 72.5 38 82.5 39 105.5 40 136.5 41 153.5 42 165.0 43 189.5 44 214.5 45 233.5 46 240.5 47 226.5 48 203.0 49 200.5 50 180.5 51 153.5 52 155.0 53 148.0 54 134.0 55 110.5 56 84.0 57 76.0 58 71.5 59 64.0 60 65.5 61 65.0 62 53.5 63 42.0 64 41.0 65 44.5 66 39.0 67 26.0 68 20.5 69 16.5 70 8.5 71 5.0 72 4.5 73 2.5 74 1.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 40-41 1.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 1.0 66-67 2.0 68-69 1.0 70-71 2.0 72-73 4.0 74-75 6.0 76-77 2.0 78-79 4.0 80-81 4.0 82-83 7.0 84-85 9.0 86-87 6.0 88-89 13.0 90-91 12.0 92-93 16.0 94-95 19.0 96-97 35.0 98-99 396.0 100-101 3460.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.75 #Duplication Level Percentage of deduplicated Percentage of total 1 94.13333333333334 88.25 2 5.253333333333334 9.85 3 0.5066666666666666 1.425 4 0.05333333333333334 0.2 5 0.02666666666666667 0.125 6 0.02666666666666667 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTGAACTTACAGGTGGATACATGTTTCCAGGGGAAGGTGCTTGAGGATA 6 0.15 No Hit GGTACATCTTCCCGCAAGTGCAGTTTGAGCCACAGTTGCAGCTTGATCCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 934972 READS because READLEN < 1 Read 934972 spots for SRR12897242.sra Written 934972 spots for SRR12897242.sra Rejected 934972 READS because READLEN < 1 Read 934972 spots for SRR12897242.sra Written 934972 spots for SRR12897242.sra Rejected 934972 READS because READLEN < 1 Read 934972 spots for SRR12897242.sra Written 934972 spots for SRR12897242.sra Rejected 934972 READS because READLEN < 1 Read 934972 spots for SRR12897242.sra Written 934972 spots for SRR12897242.sra Rejected 934972 READS because READLEN < 1 Read 934972 spots for SRR12897242.sra Written 934972 spots for SRR12897242.sra Rejected 934972 READS because READLEN < 1 Read 934972 spots for SRR12897242.sra Written 934972 spots for SRR12897242.sra Rejected 934972 READS because READLEN < 1 Read 934972 spots for SRR12897242.sra Written 934972 spots for SRR12897242.sra Rejected 934986 READS because READLEN < 1 Read 934986 spots for SRR12897242.sra Written 934986 spots for SRR12897242.sra Rejected 934972 READS because READLEN < 1 Read 934972 spots for SRR12897242.sra Written 934972 spots for SRR12897242.sra Rejected 934972 READS because READLEN < 1 Read 934972 spots for SRR12897242.sra Written 934972 spots for SRR12897242.sra Rejected 934972 READS because READLEN < 1 Read 934972 spots for SRR12897242.sra Written 934972 spots for SRR12897242.sra Rejected 934972 READS because READLEN < 1 Read 934972 spots for SRR12897242.sra Written 934972 spots for SRR12897242.sra Rejected 934972 READS because READLEN < 1 Read 934972 spots for SRR12897242.sra Written 934972 spots for SRR12897242.sra Rejected 934972 READS because READLEN < 1 Read 934972 spots for SRR12897242.sra Written 934972 spots for SRR12897242.sra Rejected 934972 READS because READLEN < 1 Read 934972 spots for SRR12897242.sra Written 934972 spots for SRR12897242.sra Rejected 934972 READS because READLEN < 1 Read 934972 spots for SRR12897242.sra Written 934972 spots for SRR12897242.sra Rejected 934972 READS because READLEN < 1 Read 934972 spots for SRR12897242.sra Written 934972 spots for SRR12897242.sra Rejected 934972 READS because READLEN < 1 Read 934972 spots for SRR12897242.sra Written 934972 spots for SRR12897242.sra Rejected 934972 READS because READLEN < 1 Read 934972 spots for SRR12897242.sra Written 934972 spots for SRR12897242.sra Rejected 934972 READS because READLEN < 1 Read 934972 spots for SRR12897242.sra Written 934972 spots for SRR12897242.sra SRR ids: ['SRR12897242.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_sk6le15a SRR12897242.sra spots: 18699454 blocks: [[1, 934972], [934973, 1869944], [1869945, 2804916], [2804917, 3739888], [3739889, 4674860], [4674861, 5609832], [5609833, 6544804], [6544805, 7479776], [7479777, 8414748], [8414749, 9349720], [9349721, 10284692], [10284693, 11219664], [11219665, 12154636], [12154637, 13089608], [13089609, 14024580], [14024581, 14959552], [14959553, 15894524], [15894525, 16829496], [16829497, 17764468], [17764469, 18699454]] SRR12897242 file size 4472848 SRR12897242 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12897242 SRR12897242_1.fastq Input file: SRR12897242_1.fastq trimmed: SRR12897242-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:00:40 2024 >> started Sat Dec 7 12:01:37 2024 >> done (57.251s) 18699454 reads processed; of these: 8 ( 0.00%) short reads filtered out after trimming by size control 2220 ( 0.01%) empty reads filtered out after trimming by size control 18697226 (99.99%) reads available; of these: 433 ( 0.00%) trimmed reads available after processing 18696793 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 21 1 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 2 0.00% 26 2 0.00% 27 0 0.00% 28 2 0.00% 29 0 0.00% 30 0 0.00% 31 1 0.00% 32 2 0.00% 33 1 0.00% 34 0 0.00% 35 30 0.00% 36 49 0.00% 37 43 0.00% 38 55 0.00% 39 77 0.00% 40 95 0.00% 41 119 0.00% 42 118 0.00% 43 104 0.00% 44 114 0.00% 45 95 0.00% 46 181 0.00% 47 190 0.00% 48 243 0.00% 49 280 0.00% 50 336 0.00% 51 365 0.00% 52 412 0.00% 53 390 0.00% 54 492 0.00% 55 481 0.00% 56 570 0.00% 57 700 0.00% 58 836 0.00% 59 987 0.01% 60 1159 0.01% 61 1371 0.01% 62 1511 0.01% 63 1575 0.01% 64 1767 0.01% 65 1895 0.01% 66 2098 0.01% 67 2382 0.01% 68 2760 0.01% 69 2999 0.02% 70 3544 0.02% 71 3827 0.02% 72 4423 0.02% 73 5127 0.03% 74 5738 0.03% 75 6238 0.03% 76 6983 0.04% 77 7439 0.04% 78 8436 0.05% 79 9358 0.05% 80 10538 0.06% 81 11928 0.06% 82 13549 0.07% 83 15110 0.08% 84 16745 0.09% 85 18783 0.10% 86 20289 0.11% 87 21976 0.12% 88 24275 0.13% 89 25881 0.14% 90 28633 0.15% 91 31648 0.17% 92 32632 0.17% 93 36399 0.19% 94 40361 0.22% 95 45857 0.25% 96 69453 0.37% 97 138450 0.74% 98 397338 2.13% 99 1278438 6.84% 100 4453957 23.82% 101 11876983 63.52% 18697226 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=30 prefix-density=0.47 prefix-fanout=2.0 sequence=GTGCAGTTTGAGCC criterion=fanout-score sequence-density=0.05 sequence-density-rank=20 fanout-score=44.42 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=12.8 sequence=TCCTCTTCTTCCTCCT Started job on | Dec 07 12:03:59 Started mapping on | Dec 07 12:04:00 Finished on | Dec 07 12:06:37 Mapping speed, Million of reads per hour | 428.73 Number of input reads | 18697226 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 18065974 Uniquely mapped reads % | 96.62% Average mapped length | 99.90 Number of splices: Total | 6047574 Number of splices: Annotated (sjdb) | 5721626 Number of splices: GT/AG | 5953892 Number of splices: GC/AG | 81564 Number of splices: AT/AC | 3607 Number of splices: Non-canonical | 8511 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 2.39 Insertion rate per base | 0.01% Insertion average length | 1.70 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 278952 % of reads mapped to multiple loci | 1.49% Number of reads mapped to too many loci | 143282 % of reads mapped to too many loci | 0.77% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.09% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 352300 352300 352300 N_multimapping 278952 278952 278952 N_noFeature 885960 17570774 1021515 N_ambiguous 387397 1317 28473 UnstrandedReadsAssigned:16792617 PositiveStrandReadsAssigned:493883 NegativeStrandReadsAssigned:17015986 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR12897242 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR12897242-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,697,226 reads, 17,157,275 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,187 rounds 52973 SRR12897242.ke.tsv 35125 SRR12897242.se.tsv 88098 total ==> SRR12897242.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 106.72 12.9319 PNS24247 1044 945 109.704 11.7742 PNS24249 1928 1829 29.8266 1.65399 PNS24246 1044 945 109.704 11.7742 PNS24248 1044 945 109.704 11.7742 PNS24244 1471 1372 231.343 17.1019 PNS24243 293 194 1 0.522806 KQK14069 1603 1504 12641.4 852.489 KQK14071 474 375 443.622 119.984 ==> SRR12897242.se.tsv <== BRADI_1g14170v3 14522 BRADI_1g53295v3 83 BRADI_1g59795v3 613 BRADI_1g07683v3 0 BRADI_1g00485v3 16 BRADI_1g20270v3 274 BRADI_1g74790v3 152 BRADI_1g09890v3 0 BRADI_1g77505v3 205 BRADI_1g48960v3 0 SRR12897242 completed mapping pipeline successfully