Starting /dee2/code/volunteer_pipeline.sh SRR12897243 current disk space = 1543004266496 free memory = 1598508776 SRR12897243 SRAfilesize cc20bb267406bf77b45bbef5ec2e130c SRR12897243.sra SRR12897243.sra file validated SRR12897243 is single end SRR12897243 is conventional basespace SRR12897243 read1 length is 60-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12897243_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 60-101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.57825 37.0 37.0 37.0 37.0 37.0 2 36.6625 37.0 37.0 37.0 37.0 37.0 3 36.6945 37.0 37.0 37.0 37.0 37.0 4 36.713 37.0 37.0 37.0 37.0 37.0 5 36.744 37.0 37.0 37.0 37.0 37.0 6 36.7015 37.0 37.0 37.0 37.0 37.0 7 36.6675 37.0 37.0 37.0 37.0 37.0 8 36.6775 37.0 37.0 37.0 37.0 37.0 9 36.6665 37.0 37.0 37.0 37.0 37.0 10-11 36.70575 37.0 37.0 37.0 37.0 37.0 12-13 36.704499999999996 37.0 37.0 37.0 37.0 37.0 14-15 36.73325 37.0 37.0 37.0 37.0 37.0 16-17 36.71025 37.0 37.0 37.0 37.0 37.0 18-19 36.67525 37.0 37.0 37.0 37.0 37.0 20-21 36.704 37.0 37.0 37.0 37.0 37.0 22-23 36.701 37.0 37.0 37.0 37.0 37.0 24-25 36.73475 37.0 37.0 37.0 37.0 37.0 26-27 36.72375 37.0 37.0 37.0 37.0 37.0 28-29 36.727000000000004 37.0 37.0 37.0 37.0 37.0 30-31 36.65675 37.0 37.0 37.0 37.0 37.0 32-33 36.6685 37.0 37.0 37.0 37.0 37.0 34-35 36.662 37.0 37.0 37.0 37.0 37.0 36-37 36.635999999999996 37.0 37.0 37.0 37.0 37.0 38-39 36.60825 37.0 37.0 37.0 37.0 37.0 40-41 36.705 37.0 37.0 37.0 37.0 37.0 42-43 36.64 37.0 37.0 37.0 37.0 37.0 44-45 36.62775 37.0 37.0 37.0 37.0 37.0 46-47 36.647499999999994 37.0 37.0 37.0 37.0 37.0 48-49 36.617999999999995 37.0 37.0 37.0 37.0 37.0 50-51 36.64875 37.0 37.0 37.0 37.0 37.0 52-53 36.66075 37.0 37.0 37.0 37.0 37.0 54-55 36.6275 37.0 37.0 37.0 37.0 37.0 56-57 36.57075 37.0 37.0 37.0 37.0 37.0 58-59 36.61225 37.0 37.0 37.0 37.0 37.0 60-61 36.64195080020005 37.0 37.0 37.0 37.0 37.0 62-63 36.565282641320664 37.0 37.0 37.0 37.0 37.0 64-65 36.63406703351676 37.0 37.0 37.0 37.0 37.0 66-67 36.632724543407555 37.0 37.0 37.0 37.0 37.0 68-69 36.60330450642188 37.0 37.0 37.0 37.0 37.0 70-71 36.60200501253133 37.0 37.0 37.0 37.0 37.0 72-73 36.58240041065311 37.0 37.0 37.0 37.0 37.0 74-75 36.612705053680486 37.0 37.0 37.0 37.0 37.0 76-77 36.610846095907604 37.0 37.0 37.0 37.0 37.0 78-79 36.58136614766449 37.0 37.0 37.0 37.0 37.0 80-81 36.53052883705317 37.0 37.0 37.0 37.0 37.0 82-83 36.597176336948536 37.0 37.0 37.0 37.0 37.0 84-85 36.569051756863104 37.0 37.0 37.0 37.0 37.0 86-87 36.58061147368529 37.0 37.0 37.0 37.0 37.0 88-89 36.625610613154414 37.0 37.0 37.0 37.0 37.0 90-91 36.53381515699789 37.0 37.0 37.0 37.0 37.0 92-93 36.55667984973792 37.0 37.0 37.0 37.0 37.0 94-95 36.54385332940005 37.0 37.0 37.0 37.0 37.0 96-97 36.508634372253624 37.0 37.0 37.0 37.0 37.0 98-99 36.510163839548355 37.0 37.0 37.0 37.0 37.0 100-101 36.50315353679383 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 2.0 25 3.0 26 1.0 27 4.0 28 8.0 29 17.0 30 14.0 31 16.0 32 17.0 33 26.0 34 33.0 35 127.0 36 2054.0 37 1678.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.98449612403101 12.878219554888723 5.476369092273068 43.6609152288072 2 20.5 13.175 37.9 28.425 3 16.150000000000002 16.150000000000002 25.75 41.949999999999996 4 23.225 24.625 22.95 29.2 5 25.15 29.049999999999997 24.6 21.2 6 22.725 31.45 23.25 22.575 7 18.6 23.849999999999998 39.324999999999996 18.224999999999998 8 18.075 23.599999999999998 31.775 26.55 9 17.65 21.25 35.925000000000004 25.174999999999997 10-11 22.5125 30.0875 23.4875 23.9125 12-13 21.6625 24.7 26.987499999999997 26.650000000000002 14-15 22.2125 25.0125 27.224999999999998 25.55 16-17 22.3375 25.424999999999997 26.9125 25.324999999999996 18-19 22.1375 26.4625 25.362499999999997 26.0375 20-21 23.0125 25.7 26.224999999999998 25.0625 22-23 21.637500000000003 26.2625 27.250000000000004 24.85 24-25 22.45 25.525 25.575 26.450000000000003 26-27 22.375 25.7625 26.724999999999998 25.137500000000003 28-29 22.4875 27.0125 25.5125 24.9875 30-31 21.712500000000002 26.5375 25.275 26.474999999999998 32-33 21.925 26.787499999999998 25.650000000000002 25.637500000000003 34-35 22.787499999999998 25.887500000000003 25.85 25.474999999999998 36-37 21.7375 25.9625 25.837500000000002 26.4625 38-39 22.237499999999997 25.6 25.837500000000002 26.325 40-41 21.9375 26.7625 25.525 25.775 42-43 22.5625 25.8 25.8125 25.825 44-45 22.650000000000002 24.875 26.85 25.624999999999996 46-47 22.6875 26.8625 25.1 25.35 48-49 23.325000000000003 26.674999999999997 25.337500000000002 24.6625 50-51 22.025 25.4 26.687499999999996 25.887500000000003 52-53 22.787499999999998 25.825 25.525 25.8625 54-55 22.6875 24.85 26.474999999999998 25.9875 56-57 22.25 25.2 26.5875 25.9625 58-59 22.912499999999998 26.4125 25.837500000000002 24.837500000000002 60-61 23.090386298287285 25.328166020752597 26.128266033254157 25.453181647705964 62-63 21.710855427713856 26.000500250125064 26.87593796898449 25.41270635317659 64-65 23.24912456228114 26.038019009504755 25.237618809404704 25.475237618809405 66-67 22.304228171128347 25.969477107830873 25.869402051538653 25.856892669502123 68-69 22.637967713677888 25.941684394944314 26.179451883368788 25.240896008009013 70-71 23.182957393483708 26.17794486215539 26.21553884711779 24.423558897243108 72-73 22.308559969921042 26.50708108785562 26.19375861636797 24.990600325855368 74-75 22.162297754922864 25.761946569672645 26.552113382666498 25.523642292737993 76-77 22.056239015817223 27.14034647250816 25.320110469495354 25.48330404217926 78-79 22.112004018081365 25.51481667503767 26.707684580612757 25.665494726268207 80-81 21.42677719166039 25.119316754584275 26.80231097714142 26.651595076613916 82-83 23.02176374386715 26.707761982639326 25.198138130582464 25.072336142911055 84-85 23.29889112903226 26.978326612903224 25.11340725806452 24.609375 86-87 22.97877716018191 26.275896917635173 25.18948964123295 25.555836280949972 88-89 22.035185419567142 26.616883938741932 25.75623338817871 25.591697253512212 90-91 22.6113437381043 25.30135769572389 26.303768557289686 25.78353000888212 92-93 23.095541401273888 25.872611464968152 25.286624203821656 25.745222929936308 94-95 22.767343809888846 25.99974447425578 26.280822792896387 24.952088922958986 96-97 23.27132777421424 25.978191148171902 25.567671584348943 25.182809493264912 98-99 22.7533960292581 24.608150470219435 26.828631138975968 25.809822361546498 100-101 23.484103572599146 12.012454932808915 31.39954113405441 33.10390036053753 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 0.0 26 0.5 27 1.5 28 1.0 29 3.0 30 7.0 31 10.5 32 12.5 33 14.0 34 22.0 35 39.5 36 53.5 37 68.5 38 90.5 39 103.5 40 133.5 41 158.5 42 165.5 43 200.5 44 217.5 45 213.5 46 228.0 47 220.5 48 207.0 49 198.0 50 174.0 51 163.5 52 145.0 53 123.5 54 124.0 55 121.0 56 97.0 57 82.0 58 77.5 59 81.5 60 79.0 61 60.0 62 52.5 63 50.0 64 45.0 65 41.0 66 37.5 67 32.0 68 23.5 69 12.5 70 9.0 71 5.0 72 3.5 73 4.5 74 4.5 75 3.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 60 1.0 61 1.0 62 0.0 63 0.0 64 0.0 65 1.0 66 0.0 67 0.0 68 3.0 69 4.0 70 0.0 71 0.0 72 1.0 73 1.0 74 3.0 75 2.0 76 0.0 77 1.0 78 0.0 79 0.0 80 2.0 81 3.0 82 5.0 83 3.0 84 2.0 85 7.0 86 4.0 87 3.0 88 5.0 89 5.0 90 5.0 91 10.0 92 6.0 93 4.0 94 9.0 95 4.0 96 15.0 97 24.0 98 76.0 99 263.0 100 952.0 101 2575.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.825 #Duplication Level Percentage of deduplicated Percentage of total 1 94.96440812022145 90.05 2 4.640126548905879 8.799999999999999 3 0.3691009754811495 1.05 4 0.02636435539151068 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1005622 READS because READLEN < 1 Read 1005622 spots for SRR12897243.sra Written 1005622 spots for SRR12897243.sra Rejected 1005622 READS because READLEN < 1 Read 1005622 spots for SRR12897243.sra Written 1005622 spots for SRR12897243.sra Rejected 1005622 READS because READLEN < 1 Read 1005622 spots for SRR12897243.sra Written 1005622 spots for SRR12897243.sra Rejected 1005622 READS because READLEN < 1 Read 1005622 spots for SRR12897243.sra Written 1005622 spots for SRR12897243.sra Rejected 1005622 READS because READLEN < 1 Read 1005622 spots for SRR12897243.sra Written 1005622 spots for SRR12897243.sra Rejected 1005622 READS because READLEN < 1 Read 1005622 spots for SRR12897243.sra Written 1005622 spots for SRR12897243.sra Rejected 1005622 READS because READLEN < 1 Read 1005622 spots for SRR12897243.sra Written 1005622 spots for SRR12897243.sra Rejected 1005622 READS because READLEN < 1 Read 1005622 spots for SRR12897243.sra Written 1005622 spots for SRR12897243.sra Rejected 1005622 READS because READLEN < 1 Read 1005622 spots for SRR12897243.sra Written 1005622 spots for SRR12897243.sra Rejected 1005633 READS because READLEN < 1 Read 1005633 spots for SRR12897243.sra Written 1005633 spots for SRR12897243.sra Rejected 1005622 READS because READLEN < 1 Read 1005622 spots for SRR12897243.sra Written 1005622 spots for SRR12897243.sra Rejected 1005622 READS because READLEN < 1 Read 1005622 spots for SRR12897243.sra Written 1005622 spots for SRR12897243.sra Rejected 1005622 READS because READLEN < 1 Read 1005622 spots for SRR12897243.sra Written 1005622 spots for SRR12897243.sra Rejected 1005622 READS because READLEN < 1 Read 1005622 spots for SRR12897243.sra Written 1005622 spots for SRR12897243.sra Rejected 1005622 READS because READLEN < 1 Read 1005622 spots for SRR12897243.sra Written 1005622 spots for SRR12897243.sra Rejected 1005622 READS because READLEN < 1 Read 1005622 spots for SRR12897243.sra Written 1005622 spots for SRR12897243.sra Rejected 1005622 READS because READLEN < 1 Read 1005622 spots for SRR12897243.sra Written 1005622 spots for SRR12897243.sra Rejected 1005622 READS because READLEN < 1 Read 1005622 spots for SRR12897243.sra Written 1005622 spots for SRR12897243.sra Rejected 1005622 READS because READLEN < 1 Read 1005622 spots for SRR12897243.sra Written 1005622 spots for SRR12897243.sra Rejected 1005622 READS because READLEN < 1 Read 1005622 spots for SRR12897243.sra Written 1005622 spots for SRR12897243.sra SRR ids: ['SRR12897243.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ytiapo2t SRR12897243.sra spots: 20112451 blocks: [[1, 1005622], [1005623, 2011244], [2011245, 3016866], [3016867, 4022488], [4022489, 5028110], [5028111, 6033732], [6033733, 7039354], [7039355, 8044976], [8044977, 9050598], [9050599, 10056220], [10056221, 11061842], [11061843, 12067464], [12067465, 13073086], [13073087, 14078708], [14078709, 15084330], [15084331, 16089952], [16089953, 17095574], [17095575, 18101196], [18101197, 19106818], [19106819, 20112451]] SRR12897243 file size 4814281 SRR12897243 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12897243 SRR12897243_1.fastq Input file: SRR12897243_1.fastq trimmed: SRR12897243-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 11:59:25 2024 >> started Sat Dec 7 11:59:38 2024 >> done (12.987s) 20112451 reads processed; of these: 6 ( 0.00%) short reads filtered out after trimming by size control 1985 ( 0.01%) empty reads filtered out after trimming by size control 20110460 (99.99%) reads available; of these: 386 ( 0.00%) trimmed reads available after processing 20110074 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 0 0.00% 21 1 0.00% 22 1 0.00% 23 1 0.00% 24 0 0.00% 25 1 0.00% 26 0 0.00% 27 0 0.00% 28 1 0.00% 29 1 0.00% 30 1 0.00% 31 1 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 35 0.00% 36 36 0.00% 37 57 0.00% 38 56 0.00% 39 81 0.00% 40 85 0.00% 41 97 0.00% 42 112 0.00% 43 111 0.00% 44 111 0.00% 45 119 0.00% 46 165 0.00% 47 168 0.00% 48 226 0.00% 49 271 0.00% 50 314 0.00% 51 392 0.00% 52 379 0.00% 53 429 0.00% 54 418 0.00% 55 520 0.00% 56 562 0.00% 57 671 0.00% 58 805 0.00% 59 887 0.00% 60 1081 0.01% 61 1185 0.01% 62 1395 0.01% 63 1516 0.01% 64 1638 0.01% 65 1698 0.01% 66 1898 0.01% 67 2156 0.01% 68 2430 0.01% 69 2901 0.01% 70 3271 0.02% 71 3691 0.02% 72 4222 0.02% 73 4788 0.02% 74 5440 0.03% 75 5891 0.03% 76 6618 0.03% 77 7213 0.04% 78 8229 0.04% 79 9231 0.05% 80 9957 0.05% 81 11376 0.06% 82 13090 0.07% 83 14592 0.07% 84 16105 0.08% 85 18124 0.09% 86 19592 0.10% 87 21772 0.11% 88 23454 0.12% 89 25330 0.13% 90 28280 0.14% 91 31250 0.16% 92 32028 0.16% 93 35317 0.18% 94 40202 0.20% 95 46077 0.23% 96 70788 0.35% 97 143829 0.72% 98 420300 2.09% 99 1373590 6.83% 100 4752451 23.63% 101 12879348 64.04% 20110460 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=29 prefix-density=0.50 prefix-fanout=2.0 sequence=GTGCAGTTTGAGCC criterion=fanout-score sequence-density=0.06 sequence-density-rank=22 fanout-score=40.29 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=12.4 sequence=TCCTCTTCTTCCTCCT Started job on | Dec 07 11:59:51 Started mapping on | Dec 07 11:59:52 Finished on | Dec 07 12:00:12 Mapping speed, Million of reads per hour | 3619.88 Number of input reads | 20110460 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 19389081 Uniquely mapped reads % | 96.41% Average mapped length | 99.94 Number of splices: Total | 6490819 Number of splices: Annotated (sjdb) | 6137266 Number of splices: GT/AG | 6388418 Number of splices: GC/AG | 89270 Number of splices: AT/AC | 3729 Number of splices: Non-canonical | 9402 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 2.33 Insertion rate per base | 0.01% Insertion average length | 1.71 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 296747 % of reads mapped to multiple loci | 1.48% Number of reads mapped to too many loci | 158109 % of reads mapped to too many loci | 0.79% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.29% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 424632 424632 424632 N_multimapping 296747 296747 296747 N_noFeature 910256 18873157 1051116 N_ambiguous 404219 1370 29847 UnstrandedReadsAssigned:18074606 PositiveStrandReadsAssigned:514554 NegativeStrandReadsAssigned:18308118 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR12897243 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR12897243-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,110,460 reads, 18,462,286 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,169 rounds 52973 SRR12897243.ke.tsv 35125 SRR12897243.se.tsv 88098 total ==> SRR12897243.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 157.003 17.3857 PNS24247 1044 945 92.2057 9.04351 PNS24249 1928 1829 45.2105 2.29106 PNS24246 1044 945 92.2057 9.04351 PNS24248 1044 945 92.2057 9.04351 PNS24244 1471 1372 179.17 12.1038 PNS24243 293 194 1 0.477759 KQK14069 1603 1504 16588.8 1022.3 KQK14071 474 375 724.789 179.14 ==> SRR12897243.se.tsv <== BRADI_1g14170v3 19167 BRADI_1g53295v3 62 BRADI_1g59795v3 535 BRADI_1g07683v3 0 BRADI_1g00485v3 18 BRADI_1g20270v3 298 BRADI_1g74790v3 151 BRADI_1g09890v3 0 BRADI_1g77505v3 228 BRADI_1g48960v3 0 SRR12897243 completed mapping pipeline successfully