Starting /dee2/code/volunteer_pipeline.sh SRR12897244 current disk space = 1543011864576 free memory = 1601864700 SRR12897244 SRAfilesize 3e13416bbb0023695c5b3824df7aeb61 SRR12897244.sra SRR12897244.sra file validated SRR12897244 is single end SRR12897244 is conventional basespace SRR12897244 read1 length is 50-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12897244_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50-101 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6685 37.0 37.0 37.0 37.0 37.0 2 36.613 37.0 37.0 37.0 37.0 37.0 3 36.709 37.0 37.0 37.0 37.0 37.0 4 36.696 37.0 37.0 37.0 37.0 37.0 5 36.767 37.0 37.0 37.0 37.0 37.0 6 36.712 37.0 37.0 37.0 37.0 37.0 7 36.676 37.0 37.0 37.0 37.0 37.0 8 36.693 37.0 37.0 37.0 37.0 37.0 9 36.7845 37.0 37.0 37.0 37.0 37.0 10-11 36.75725 37.0 37.0 37.0 37.0 37.0 12-13 36.77275 37.0 37.0 37.0 37.0 37.0 14-15 36.69525 37.0 37.0 37.0 37.0 37.0 16-17 36.69525 37.0 37.0 37.0 37.0 37.0 18-19 36.699 37.0 37.0 37.0 37.0 37.0 20-21 36.71525 37.0 37.0 37.0 37.0 37.0 22-23 36.6915 37.0 37.0 37.0 37.0 37.0 24-25 36.708 37.0 37.0 37.0 37.0 37.0 26-27 36.6905 37.0 37.0 37.0 37.0 37.0 28-29 36.72725 37.0 37.0 37.0 37.0 37.0 30-31 36.704750000000004 37.0 37.0 37.0 37.0 37.0 32-33 36.679500000000004 37.0 37.0 37.0 37.0 37.0 34-35 36.709999999999994 37.0 37.0 37.0 37.0 37.0 36-37 36.6695 37.0 37.0 37.0 37.0 37.0 38-39 36.6605 37.0 37.0 37.0 37.0 37.0 40-41 36.67425 37.0 37.0 37.0 37.0 37.0 42-43 36.6875 37.0 37.0 37.0 37.0 37.0 44-45 36.6015 37.0 37.0 37.0 37.0 37.0 46-47 36.653 37.0 37.0 37.0 37.0 37.0 48-49 36.66775 37.0 37.0 37.0 37.0 37.0 50-51 36.64720980245061 37.0 37.0 37.0 37.0 37.0 52-53 36.64366091522881 37.0 37.0 37.0 37.0 37.0 54-55 36.637659414853715 37.0 37.0 37.0 37.0 37.0 56-57 36.643160790197555 37.0 37.0 37.0 37.0 37.0 58-59 36.610652663165794 37.0 37.0 37.0 37.0 37.0 60-61 36.60735300133187 37.0 37.0 37.0 37.0 37.0 62-63 36.62231115557779 37.0 37.0 37.0 37.0 37.0 64-65 36.6887665749312 37.0 37.0 37.0 37.0 37.0 66-67 36.66466466466467 37.0 37.0 37.0 37.0 37.0 68-69 36.60725409936727 37.0 37.0 37.0 37.0 37.0 70-71 36.60986659051939 37.0 37.0 37.0 37.0 37.0 72-73 36.6530111714283 37.0 37.0 37.0 37.0 37.0 74-75 36.685041343021794 37.0 37.0 37.0 37.0 37.0 76-77 36.637656741391226 37.0 37.0 37.0 37.0 37.0 78-79 36.58754705775666 37.0 37.0 37.0 37.0 37.0 80-81 36.62269041924503 37.0 37.0 37.0 37.0 37.0 82-83 36.63239645120663 37.0 37.0 37.0 37.0 37.0 84-85 36.60117567325429 37.0 37.0 37.0 37.0 37.0 86-87 36.6129159760451 37.0 37.0 37.0 37.0 37.0 88-89 36.615024723813306 37.0 37.0 37.0 37.0 37.0 90-91 36.571025072120975 37.0 37.0 37.0 37.0 37.0 92-93 36.547206307002305 37.0 37.0 37.0 37.0 37.0 94-95 36.58765237494746 37.0 37.0 37.0 37.0 37.0 96-97 36.60431990524463 37.0 37.0 37.0 37.0 37.0 98-99 36.549979696631695 37.0 37.0 37.0 37.0 37.0 100-101 36.53392254976613 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 1.0 26 4.0 27 2.0 28 7.0 29 13.0 30 8.0 31 16.0 32 23.0 33 21.0 34 42.0 35 117.0 36 2118.0 37 1627.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.42814221331998 12.318477716574861 4.757135703555333 47.496244366549824 2 18.7 13.700000000000001 37.75 29.849999999999998 3 16.125 16.125 29.375 38.375 4 23.599999999999998 24.9 23.549999999999997 27.950000000000003 5 24.425 30.25 23.0 22.325 6 22.025 31.775 23.200000000000003 23.0 7 15.875 24.5 40.375 19.25 8 19.05 22.0 33.1 25.85 9 18.825 20.9 34.075 26.200000000000003 10-11 21.7375 30.7875 24.337500000000002 23.1375 12-13 22.05 24.337500000000002 28.025 25.587500000000002 14-15 21.7 25.324999999999996 27.500000000000004 25.474999999999998 16-17 22.15 24.962500000000002 27.700000000000003 25.1875 18-19 21.575 26.6125 26.075 25.7375 20-21 22.650000000000002 27.450000000000003 24.375 25.525 22-23 21.3875 27.3625 26.5125 24.7375 24-25 22.45 25.7375 25.224999999999998 26.5875 26-27 21.925 27.3 25.1875 25.587500000000002 28-29 21.9375 26.375 26.1125 25.575 30-31 22.15 27.6 25.412499999999998 24.837500000000002 32-33 22.375 26.7625 25.8125 25.05 34-35 21.762500000000003 26.3625 26.2875 25.587500000000002 36-37 21.575 25.912499999999998 26.224999999999998 26.2875 38-39 22.7 26.187500000000004 25.75 25.362499999999997 40-41 21.2875 26.4125 25.837500000000002 26.4625 42-43 21.925 26.5875 25.7125 25.775 44-45 21.7 26.8 26.424999999999997 25.074999999999996 46-47 21.987499999999997 26.3125 26.450000000000003 25.25 48-49 21.525 26.0625 25.7875 26.625 50-51 20.990123765470685 26.178272284035504 26.16577072134017 26.665833229153645 52-53 22.83070767691923 26.544136034008503 25.831457864466117 24.793698424606152 54-55 22.53063265816454 25.656414103525883 25.418854713678417 26.39409852463116 56-57 21.54288572143036 26.78169542385596 26.11902975743936 25.55638909727432 58-59 21.642910727681922 26.419104776194047 26.481620405101275 25.456364091022753 60-61 22.871076653745153 26.259847442791045 25.109416031011627 25.75965987245217 62-63 22.136068034017008 25.975487743871934 26.17558779389695 25.71285642821411 64-65 21.57868401300976 25.91943957968476 27.24543407555667 25.25644233174881 66-67 22.66016016016016 26.351351351351347 26.076076076076077 24.91241241241241 68-69 21.70212765957447 26.12015018773467 27.108886107634543 25.06883604505632 70-71 21.898084387129085 26.26768498810567 26.53061224489796 25.30361837986728 72-73 22.021796317173994 26.79443818113491 25.65451584617312 25.529249655517976 74-75 22.237534452518165 26.43447757454272 26.10874467551992 25.21924329741919 76-77 23.25727181544634 26.567201604814443 25.55165496489468 24.623871614844532 78-79 22.02836701393247 25.957072925819002 25.919417597590062 26.095142462658465 80-81 21.896616777763803 25.556533769337193 26.625581687838007 25.921267765061 82-83 22.95288485764676 26.832955404383974 25.762156714537664 24.452003023431594 84-85 22.163321973999746 25.823551684967818 26.214817619588537 25.798308721443895 86-87 22.379746835443036 25.696202531645568 26.772151898734176 25.151898734177212 88-89 22.80167491435097 26.72249714503236 25.821596244131456 24.65423169648522 90-91 22.111959287531807 26.043256997455472 25.725190839694655 26.119592875318066 92-93 22.31880352805829 26.11530103540841 26.128083855298478 25.437811581234822 94-95 23.359815479241412 26.524859046642746 25.179395181957968 24.935930292157867 96-97 22.7524115755627 26.19935691318328 25.337620578778136 25.710610932475888 98-99 21.93717277486911 24.68586387434555 27.146596858638745 26.230366492146594 100-101 21.69215425531915 12.5 33.14494680851064 32.662898936170215 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 2.5 27 3.0 28 1.5 29 1.5 30 5.0 31 9.0 32 13.5 33 21.0 34 29.5 35 41.0 36 52.0 37 72.0 38 94.0 39 109.5 40 141.5 41 171.0 42 185.5 43 212.0 44 216.0 45 219.0 46 231.5 47 217.5 48 210.5 49 204.5 50 175.5 51 139.0 52 128.0 53 135.5 54 133.0 55 117.0 56 91.5 57 79.5 58 80.0 59 71.5 60 65.0 61 63.0 62 54.5 63 46.5 64 43.5 65 33.5 66 24.5 67 24.0 68 22.0 69 12.0 70 4.5 71 4.5 72 4.0 73 3.5 74 2.0 75 0.0 76 0.5 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 50-51 1.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 1.0 62-63 1.0 64-65 1.0 66-67 0.0 68-69 2.0 70-71 2.0 72-73 1.0 74-75 2.0 76-77 3.0 78-79 10.0 80-81 6.0 82-83 6.0 84-85 11.0 86-87 12.0 88-89 7.0 90-91 19.0 92-93 11.0 94-95 9.0 96-97 40.0 98-99 375.0 100-101 3480.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.85 #Duplication Level Percentage of deduplicated Percentage of total 1 93.97975492807672 88.2 2 5.514118273841237 10.35 3 0.47948854555141185 1.35 4 0.02663825253063399 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 991678 READS because READLEN < 1 Read 991678 spots for SRR12897244.sra Written 991678 spots for SRR12897244.sra Rejected 991678 READS because READLEN < 1 Read 991678 spots for SRR12897244.sra Written 991678 spots for SRR12897244.sra Rejected 991678 READS because READLEN < 1 Read 991678 spots for SRR12897244.sra Written 991678 spots for SRR12897244.sra Rejected 991678 READS because READLEN < 1 Read 991678 spots for SRR12897244.sra Written 991678 spots for SRR12897244.sra Rejected 991678 READS because READLEN < 1 Read 991678 spots for SRR12897244.sra Written 991678 spots for SRR12897244.sra Rejected 991678 READS because READLEN < 1 Read 991678 spots for SRR12897244.sra Written 991678 spots for SRR12897244.sra Rejected 991678 READS because READLEN < 1 Read 991678 spots for SRR12897244.sra Written 991678 spots for SRR12897244.sra Rejected 991678 READS because READLEN < 1 Read 991678 spots for SRR12897244.sra Written 991678 spots for SRR12897244.sra Rejected 991678 READS because READLEN < 1 Read 991678 spots for SRR12897244.sra Written 991678 spots for SRR12897244.sra Rejected 991678 READS because READLEN < 1 Read 991678 spots for SRR12897244.sra Written 991678 spots for SRR12897244.sra Rejected 991678 READS because READLEN < 1 Read 991678 spots for SRR12897244.sra Written 991678 spots for SRR12897244.sra Rejected 991678 READS because READLEN < 1 Read 991678 spots for SRR12897244.sra Written 991678 spots for SRR12897244.sra Rejected 991678 READS because READLEN < 1 Read 991678 spots for SRR12897244.sra Written 991678 spots for SRR12897244.sra Rejected 991678 READS because READLEN < 1 Read 991678 spots for SRR12897244.sra Written 991678 spots for SRR12897244.sra Rejected 991678 READS because READLEN < 1 Read 991678 spots for SRR12897244.sra Written 991678 spots for SRR12897244.sra Rejected 991678 READS because READLEN < 1 Read 991678 spots for SRR12897244.sra Written 991678 spots for SRR12897244.sra Rejected 991678 READS because READLEN < 1 Read 991678 spots for SRR12897244.sra Written 991678 spots for SRR12897244.sra Rejected 991678 READS because READLEN < 1 Read 991678 spots for SRR12897244.sra Written 991678 spots for SRR12897244.sra Rejected 991678 READS because READLEN < 1 Read 991678 spots for SRR12897244.sra Written 991678 spots for SRR12897244.sra Rejected 991685 READS because READLEN < 1 Read 991685 spots for SRR12897244.sra Written 991685 spots for SRR12897244.sra SRR ids: ['SRR12897244.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__hjiqojn SRR12897244.sra spots: 19833567 blocks: [[1, 991678], [991679, 1983356], [1983357, 2975034], [2975035, 3966712], [3966713, 4958390], [4958391, 5950068], [5950069, 6941746], [6941747, 7933424], [7933425, 8925102], [8925103, 9916780], [9916781, 10908458], [10908459, 11900136], [11900137, 12891814], [12891815, 13883492], [13883493, 14875170], [14875171, 15866848], [15866849, 16858526], [16858527, 17850204], [17850205, 18841882], [18841883, 19833567]] SRR12897244 file size 4743689 SRR12897244 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12897244 SRR12897244_1.fastq Input file: SRR12897244_1.fastq trimmed: SRR12897244-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:02:36 2024 >> started Sat Dec 7 12:02:48 2024 >> done (11.224s) 19833567 reads processed; of these: 4 ( 0.00%) short reads filtered out after trimming by size control 1557 ( 0.01%) empty reads filtered out after trimming by size control 19832006 (99.99%) reads available; of these: 403 ( 0.00%) trimmed reads available after processing 19831603 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 1 0.00% 24 1 0.00% 25 1 0.00% 26 0 0.00% 27 1 0.00% 28 1 0.00% 29 1 0.00% 30 2 0.00% 31 1 0.00% 32 1 0.00% 33 4 0.00% 34 1 0.00% 35 38 0.00% 36 47 0.00% 37 56 0.00% 38 62 0.00% 39 94 0.00% 40 111 0.00% 41 96 0.00% 42 131 0.00% 43 138 0.00% 44 129 0.00% 45 165 0.00% 46 173 0.00% 47 162 0.00% 48 265 0.00% 49 310 0.00% 50 397 0.00% 51 423 0.00% 52 472 0.00% 53 518 0.00% 54 506 0.00% 55 568 0.00% 56 632 0.00% 57 777 0.00% 58 1026 0.01% 59 1123 0.01% 60 1360 0.01% 61 1577 0.01% 62 1691 0.01% 63 1884 0.01% 64 1989 0.01% 65 2090 0.01% 66 2480 0.01% 67 2718 0.01% 68 3177 0.02% 69 3569 0.02% 70 4089 0.02% 71 4688 0.02% 72 5363 0.03% 73 6110 0.03% 74 6755 0.03% 75 7397 0.04% 76 8401 0.04% 77 8918 0.04% 78 10252 0.05% 79 11323 0.06% 80 12612 0.06% 81 14232 0.07% 82 16110 0.08% 83 17963 0.09% 84 19957 0.10% 85 22483 0.11% 86 24100 0.12% 87 25909 0.13% 88 28543 0.14% 89 30277 0.15% 90 33425 0.17% 91 37081 0.19% 92 38079 0.19% 93 41762 0.21% 94 46697 0.24% 95 52782 0.27% 96 77600 0.39% 97 149959 0.76% 98 424107 2.14% 99 1357661 6.85% 100 4701115 23.70% 101 12555285 63.31% 19832006 reads passed initial QC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=34 prefix-density=0.45 prefix-fanout=2.0 sequence=GTGCAGTTTGAGCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=48.83 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.0 sequence=TGCATCCTTTATTCACGGATTTGTTTGTTTATTCATGGATCGATTATATCATCACAGATGCAGACACTATTTGCATCTAGCTAAAAAACTAGATGCAAATAGCTGACTGACACGACACACGCACGCACGGCCTTCGAACAGACAGAAGATAACAAACTCAGAGTAACGCAGATAAGATGAACCAGAGATCGATGTCCTGGCAGCAAGCAGGCCACCTTTGATTGAATTAGTCCTCAACTCATGCATGGTGGCTTCCGTCGGCGTTGATGGTGAGGACGCTGGACAGCCCGTGCTTGACGACGCTGTGCATGCGGTAGAACTCGTCGTACGTGACGGCGCGGTACCGCGCCGGTTTCTCCTTGCTGAGGAACTCCTTGGCCGGCCCGATGAGGCAATCCGGCGCCGGCGTGATGAACAACCCCACGGACCTTCGGGCATGCGTCCGGTTCGTCACCA Started job on | Dec 07 12:03:17 Started mapping on | Dec 07 12:03:18 Finished on | Dec 07 12:03:39 Mapping speed, Million of reads per hour | 3399.77 Number of input reads | 19832006 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 19129515 Uniquely mapped reads % | 96.46% Average mapped length | 99.85 Number of splices: Total | 6395642 Number of splices: Annotated (sjdb) | 6050719 Number of splices: GT/AG | 6297584 Number of splices: GC/AG | 85068 Number of splices: AT/AC | 3957 Number of splices: Non-canonical | 9033 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 2.36 Insertion rate per base | 0.01% Insertion average length | 1.71 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 299674 % of reads mapped to multiple loci | 1.51% Number of reads mapped to too many loci | 157790 % of reads mapped to too many loci | 0.80% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.20% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 402817 402817 402817 N_multimapping 299674 299674 299674 N_noFeature 967345 18611474 1111766 N_ambiguous 403207 1433 30277 UnstrandedReadsAssigned:17758963 PositiveStrandReadsAssigned:516608 NegativeStrandReadsAssigned:17987472 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR12897244 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR12897244-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,832,006 reads, 18,140,358 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,241 rounds 52973 SRR12897244.ke.tsv 35125 SRR12897244.se.tsv 88098 total ==> SRR12897244.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 109.756 12.6299 PNS24247 1044 945 90.3848 9.21213 PNS24249 1928 1829 38.4119 2.02278 PNS24246 1044 945 90.3848 9.21213 PNS24248 1044 945 90.3848 9.21213 PNS24244 1471 1372 287.677 20.1952 PNS24243 293 194 0 0 KQK14069 1603 1504 13727.5 879.101 KQK14071 474 375 625.733 160.714 ==> SRR12897244.se.tsv <== BRADI_1g14170v3 16242 BRADI_1g53295v3 67 BRADI_1g59795v3 642 BRADI_1g07683v3 0 BRADI_1g00485v3 22 BRADI_1g20270v3 345 BRADI_1g74790v3 131 BRADI_1g09890v3 0 BRADI_1g77505v3 229 BRADI_1g48960v3 0 SRR12897244 completed mapping pipeline successfully