Starting /dee2/code/volunteer_pipeline.sh SRR12897245 current disk space = 1543086874624 free memory = 1601920380 SRR12897245 SRAfilesize 30d07e8af8191c15c3118e38e747fec1 SRR12897245.sra SRR12897245.sra file validated SRR12897245 is single end SRR12897245 is conventional basespace SRR12897245 read1 length is 54-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12897245_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 54-101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.65675 37.0 37.0 37.0 37.0 37.0 2 36.575 37.0 37.0 37.0 37.0 37.0 3 36.682 37.0 37.0 37.0 37.0 37.0 4 36.7415 37.0 37.0 37.0 37.0 37.0 5 36.805 37.0 37.0 37.0 37.0 37.0 6 36.6915 37.0 37.0 37.0 37.0 37.0 7 36.6705 37.0 37.0 37.0 37.0 37.0 8 36.755 37.0 37.0 37.0 37.0 37.0 9 36.717 37.0 37.0 37.0 37.0 37.0 10-11 36.76175 37.0 37.0 37.0 37.0 37.0 12-13 36.687 37.0 37.0 37.0 37.0 37.0 14-15 36.768 37.0 37.0 37.0 37.0 37.0 16-17 36.763 37.0 37.0 37.0 37.0 37.0 18-19 36.73025 37.0 37.0 37.0 37.0 37.0 20-21 36.783 37.0 37.0 37.0 37.0 37.0 22-23 36.692750000000004 37.0 37.0 37.0 37.0 37.0 24-25 36.71875 37.0 37.0 37.0 37.0 37.0 26-27 36.68175 37.0 37.0 37.0 37.0 37.0 28-29 36.687749999999994 37.0 37.0 37.0 37.0 37.0 30-31 36.7255 37.0 37.0 37.0 37.0 37.0 32-33 36.6295 37.0 37.0 37.0 37.0 37.0 34-35 36.66175 37.0 37.0 37.0 37.0 37.0 36-37 36.6725 37.0 37.0 37.0 37.0 37.0 38-39 36.65375 37.0 37.0 37.0 37.0 37.0 40-41 36.629 37.0 37.0 37.0 37.0 37.0 42-43 36.663 37.0 37.0 37.0 37.0 37.0 44-45 36.655 37.0 37.0 37.0 37.0 37.0 46-47 36.709500000000006 37.0 37.0 37.0 37.0 37.0 48-49 36.634249999999994 37.0 37.0 37.0 37.0 37.0 50-51 36.67725 37.0 37.0 37.0 37.0 37.0 52-53 36.61425 37.0 37.0 37.0 37.0 37.0 54-55 36.638707114278574 37.0 37.0 37.0 37.0 37.0 56-57 36.66591647911978 37.0 37.0 37.0 37.0 37.0 58-59 36.6366591647912 37.0 37.0 37.0 37.0 37.0 60-61 36.662415603900975 37.0 37.0 37.0 37.0 37.0 62-63 36.595398849712424 37.0 37.0 37.0 37.0 37.0 64-65 36.67187469703844 37.0 37.0 37.0 37.0 37.0 66-67 36.62581290645323 37.0 37.0 37.0 37.0 37.0 68-69 36.65557778889445 37.0 37.0 37.0 37.0 37.0 70-71 36.6480740370185 37.0 37.0 37.0 37.0 37.0 72-73 36.64057028514257 37.0 37.0 37.0 37.0 37.0 74-75 36.63456728364182 37.0 37.0 37.0 37.0 37.0 76-77 36.6124067665873 37.0 37.0 37.0 37.0 37.0 78-79 36.57561583835542 37.0 37.0 37.0 37.0 37.0 80-81 36.545340681362724 37.0 37.0 37.0 37.0 37.0 82-83 36.571305691128345 37.0 37.0 37.0 37.0 37.0 84-85 36.61023825540556 37.0 37.0 37.0 37.0 37.0 86-87 36.59422270919615 37.0 37.0 37.0 37.0 37.0 88-89 36.581587058803294 37.0 37.0 37.0 37.0 37.0 90-91 36.59709155767548 37.0 37.0 37.0 37.0 37.0 92-93 36.601560926100184 37.0 37.0 37.0 37.0 37.0 94-95 36.580716577192675 37.0 37.0 37.0 37.0 37.0 96-97 36.55646043798848 37.0 37.0 37.0 37.0 37.0 98-99 36.59244113013115 37.0 37.0 37.0 37.0 37.0 100-101 36.55133336730447 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 0.0 25 1.0 26 4.0 27 5.0 28 3.0 29 7.0 30 14.0 31 19.0 32 20.0 33 26.0 34 45.0 35 112.0 36 2088.0 37 1655.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.353765323992995 12.334250688016011 4.253189892419314 45.05879409557168 2 18.775 12.525 39.475 29.225 3 17.775 16.975 28.025 37.225 4 23.375 25.324999999999996 24.099999999999998 27.200000000000003 5 24.9 29.725 23.45 21.925 6 22.75 31.225 23.025000000000002 23.0 7 17.299999999999997 23.65 40.975 18.075 8 18.025 23.65 32.300000000000004 26.025 9 20.225 21.975 32.95 24.85 10-11 21.6625 31.412499999999998 24.075 22.85 12-13 22.8625 24.6125 26.3125 26.2125 14-15 21.5 26.5125 26.474999999999998 25.5125 16-17 21.762500000000003 26.237500000000004 26.6625 25.337500000000002 18-19 22.05 26.275 25.924999999999997 25.75 20-21 21.462500000000002 26.1 27.1125 25.324999999999996 22-23 22.35 26.85 26.025 24.775 24-25 22.0875 26.150000000000002 25.6 26.1625 26-27 22.662499999999998 26.05 25.7 25.587500000000002 28-29 22.1 26.9625 25.3125 25.624999999999996 30-31 22.2625 26.400000000000002 26.437500000000004 24.9 32-33 21.512500000000003 25.6 26.724999999999998 26.1625 34-35 21.9625 26.4125 26.275 25.35 36-37 21.875 26.825 25.6 25.7 38-39 22.675 26.525 25.5 25.3 40-41 21.75 27.187499999999996 25.887500000000003 25.174999999999997 42-43 22.6375 25.912499999999998 26.8 24.65 44-45 22.225 26.237500000000004 26.150000000000002 25.387500000000003 46-47 23.2125 26.224999999999998 25.650000000000002 24.9125 48-49 23.1375 25.7125 25.650000000000002 25.5 50-51 22.4875 26.200000000000003 26.025 25.2875 52-53 22.425 25.724999999999998 25.874999999999996 25.974999999999998 54-55 23.31541442680335 26.715839479934996 25.19064883110389 24.778097262157768 56-57 22.36809202300575 25.76894223555889 26.231557889472366 25.63140785196299 58-59 22.73068267066767 26.131532883220803 25.881470367591895 25.256314078519633 60-61 22.66816704176044 25.76894223555889 25.868967241810452 25.693923480870218 62-63 22.643160790197552 26.006501625406354 25.256314078519633 26.094023505876468 64-65 22.671001625609605 26.5474552957359 25.672127047642867 25.109416031011627 66-67 23.04902451225613 26.463231615807903 24.73736868434217 25.7503751875938 68-69 22.273636818409205 26.413206603301653 26.80090045022511 24.512256128064035 70-71 22.686343171585793 26.275637818909452 25.737868934467233 25.30015007503752 72-73 22.498749374687343 26.25062531265633 26.32566283141571 24.92496248124062 74-75 22.648824412206103 25.07503751875938 26.225612806403202 26.050525262631314 76-77 22.469660953334166 26.11034655323408 25.209558363568124 26.21043412986363 78-79 22.270906359539307 26.589884827240862 25.07511266900351 26.064096144216325 80-81 21.8061122244489 26.603206412825653 25.738977955911825 25.851703406813627 82-83 22.75006267234896 26.34745550263224 25.119077463023316 25.783404361995487 84-85 21.771865980675116 26.126239176810138 26.628184213828586 25.47371062868616 86-87 22.900188323917135 26.03892027620841 25.185185185185183 25.875706214689266 88-89 23.33417148604476 26.527533316570278 24.9057078199648 25.232587377420167 90-91 23.35895174499181 26.281970517827897 26.49615723825123 23.862920498929068 92-93 23.065269536674663 25.287211210705717 26.423431384926143 25.224087867693473 94-95 22.94853963838665 27.12100139082058 25.085345808572512 24.845113162220255 96-97 22.137598375222137 25.983752221375983 26.796141152576798 25.082508250825082 98-99 22.86561774567965 25.05803456280629 26.270312096982202 25.806035594531856 100-101 23.348372542700613 12.004511762810184 32.307444408636805 32.339671285852404 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 0.5 27 1.5 28 3.0 29 7.5 30 11.5 31 10.0 32 15.0 33 20.0 34 21.0 35 33.5 36 55.5 37 67.0 38 81.5 39 112.0 40 142.0 41 159.0 42 172.0 43 192.5 44 202.0 45 223.5 46 229.0 47 215.5 48 206.5 49 199.5 50 191.0 51 168.5 52 156.5 53 147.0 54 131.0 55 109.0 56 87.0 57 72.0 58 64.5 59 70.5 60 77.5 61 63.5 62 46.5 63 51.0 64 49.0 65 36.0 66 29.0 67 26.0 68 22.5 69 17.0 70 10.5 71 4.0 72 3.0 73 1.0 74 1.0 75 1.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 54 1.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 1.0 65 0.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 3.0 77 0.0 78 2.0 79 1.0 80 0.0 81 1.0 82 4.0 83 2.0 84 1.0 85 1.0 86 1.0 87 4.0 88 2.0 89 4.0 90 7.0 91 4.0 92 1.0 93 3.0 94 5.0 95 9.0 96 8.0 97 21.0 98 74.0 99 280.0 100 914.0 101 2646.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.325 #Duplication Level Percentage of deduplicated Percentage of total 1 94.27511264245958 88.925 2 5.459846276172807 10.299999999999999 3 0.23853697323085077 0.675 4 0.026504108136761195 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 851079 READS because READLEN < 1 Read 851079 spots for SRR12897245.sra Written 851079 spots for SRR12897245.sra Rejected 851079 READS because READLEN < 1 Read 851079 spots for SRR12897245.sra Written 851079 spots for SRR12897245.sra Rejected 851079 READS because READLEN < 1 Read 851079 spots for SRR12897245.sra Written 851079 spots for SRR12897245.sra Rejected 851079 READS because READLEN < 1 Read 851079 spots for SRR12897245.sra Written 851079 spots for SRR12897245.sra Rejected 851079 READS because READLEN < 1 Read 851079 spots for SRR12897245.sra Written 851079 spots for SRR12897245.sra Rejected 851079 READS because READLEN < 1 Read 851079 spots for SRR12897245.sra Written 851079 spots for SRR12897245.sra Rejected 851079 READS because READLEN < 1 Read 851079 spots for SRR12897245.sra Written 851079 spots for SRR12897245.sra Rejected 851079 READS because READLEN < 1 Read 851079 spots for SRR12897245.sra Written 851079 spots for SRR12897245.sra Rejected 851079 READS because READLEN < 1 Read 851079 spots for SRR12897245.sra Written 851079 spots for SRR12897245.sra Rejected 851079 READS because READLEN < 1 Read 851079 spots for SRR12897245.sra Written 851079 spots for SRR12897245.sra Rejected 851079 READS because READLEN < 1 Read 851079 spots for SRR12897245.sra Written 851079 spots for SRR12897245.sra Rejected 851079 READS because READLEN < 1 Read 851079 spots for SRR12897245.sra Written 851079 spots for SRR12897245.sra Rejected 851079 READS because READLEN < 1 Read 851079 spots for SRR12897245.sra Written 851079 spots for SRR12897245.sra Rejected 851081 READS because READLEN < 1 Read 851081 spots for SRR12897245.sra Written 851081 spots for SRR12897245.sra Rejected 851079 READS because READLEN < 1 Read 851079 spots for SRR12897245.sra Written 851079 spots for SRR12897245.sra Rejected 851079 READS because READLEN < 1 Read 851079 spots for SRR12897245.sra Written 851079 spots for SRR12897245.sra Rejected 851079 READS because READLEN < 1 Read 851079 spots for SRR12897245.sra Written 851079 spots for SRR12897245.sra Rejected 851079 READS because READLEN < 1 Read 851079 spots for SRR12897245.sra Written 851079 spots for SRR12897245.sra Rejected 851079 READS because READLEN < 1 Read 851079 spots for SRR12897245.sra Written 851079 spots for SRR12897245.sra Rejected 851079 READS because READLEN < 1 Read 851079 spots for SRR12897245.sra Written 851079 spots for SRR12897245.sra SRR ids: ['SRR12897245.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__sildg5w SRR12897245.sra spots: 17021582 blocks: [[1, 851079], [851080, 1702158], [1702159, 2553237], [2553238, 3404316], [3404317, 4255395], [4255396, 5106474], [5106475, 5957553], [5957554, 6808632], [6808633, 7659711], [7659712, 8510790], [8510791, 9361869], [9361870, 10212948], [10212949, 11064027], [11064028, 11915106], [11915107, 12766185], [12766186, 13617264], [13617265, 14468343], [14468344, 15319422], [15319423, 16170501], [16170502, 17021582]] SRR12897245 file size 4074325 SRR12897245 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12897245 SRR12897245_1.fastq Input file: SRR12897245_1.fastq trimmed: SRR12897245-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:07:11 2024 >> started Sat Dec 7 12:07:20 2024 >> done (8.752s) 17021582 reads processed; of these: 6 ( 0.00%) short reads filtered out after trimming by size control 1494 ( 0.01%) empty reads filtered out after trimming by size control 17020082 (99.99%) reads available; of these: 230 ( 0.00%) trimmed reads available after processing 17019852 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 21 1 0.00% 22 0 0.00% 23 3 0.00% 24 1 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 1 0.00% 30 1 0.00% 31 1 0.00% 32 1 0.00% 33 2 0.00% 34 2 0.00% 35 34 0.00% 36 31 0.00% 37 47 0.00% 38 62 0.00% 39 55 0.00% 40 64 0.00% 41 60 0.00% 42 68 0.00% 43 87 0.00% 44 66 0.00% 45 71 0.00% 46 89 0.00% 47 118 0.00% 48 161 0.00% 49 196 0.00% 50 182 0.00% 51 253 0.00% 52 239 0.00% 53 231 0.00% 54 279 0.00% 55 305 0.00% 56 349 0.00% 57 388 0.00% 58 464 0.00% 59 575 0.00% 60 674 0.00% 61 743 0.00% 62 822 0.00% 63 947 0.01% 64 1002 0.01% 65 1124 0.01% 66 1244 0.01% 67 1390 0.01% 68 1484 0.01% 69 1821 0.01% 70 1986 0.01% 71 2309 0.01% 72 2678 0.02% 73 3027 0.02% 74 3242 0.02% 75 3734 0.02% 76 3950 0.02% 77 4426 0.03% 78 5002 0.03% 79 5631 0.03% 80 6297 0.04% 81 7135 0.04% 82 8192 0.05% 83 8908 0.05% 84 10069 0.06% 85 11229 0.07% 86 12230 0.07% 87 13678 0.08% 88 14865 0.09% 89 16132 0.09% 90 17937 0.11% 91 20074 0.12% 92 20119 0.12% 93 22605 0.13% 94 25555 0.15% 95 29125 0.17% 96 51636 0.30% 97 111394 0.65% 98 347410 2.04% 99 1166773 6.86% 100 4043521 23.76% 101 11003475 64.65% 17020082 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=35 prefix-density=0.16 prefix-fanout=2.2 sequence=CCGTGATCTTCTGGAC criterion=fanout-score sequence-density=0.09 sequence-density-rank=8 fanout-score=108.93 fanout-score-rank=1 prefix-density=0.56 prefix-fanout=16.8 sequence=TTCTTCTTCTTCC Started job on | Dec 07 12:07:40 Started mapping on | Dec 07 12:07:40 Finished on | Dec 07 12:08:02 Mapping speed, Million of reads per hour | 2785.10 Number of input reads | 17020082 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 16308762 Uniquely mapped reads % | 95.82% Average mapped length | 100.04 Number of splices: Total | 5676650 Number of splices: Annotated (sjdb) | 5413402 Number of splices: GT/AG | 5592057 Number of splices: GC/AG | 73609 Number of splices: AT/AC | 3306 Number of splices: Non-canonical | 7678 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.01% Deletion average length | 2.40 Insertion rate per base | 0.01% Insertion average length | 1.74 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 233962 % of reads mapped to multiple loci | 1.37% Number of reads mapped to too many loci | 67957 % of reads mapped to too many loci | 0.40% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.39% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 477358 477358 477358 N_multimapping 233962 233962 233962 N_noFeature 640131 15892657 747295 N_ambiguous 330793 1263 23419 UnstrandedReadsAssigned:15337838 PositiveStrandReadsAssigned:414842 NegativeStrandReadsAssigned:15538048 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR12897245 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR12897245-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,020,082 reads, 15,660,555 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,178 rounds 52973 SRR12897245.ke.tsv 35125 SRR12897245.se.tsv 88098 total ==> SRR12897245.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 94.5159 12.5554 PNS24247 1044 945 43.75 5.1475 PNS24249 1928 1829 24.1936 1.47074 PNS24246 1044 945 43.75 5.1475 PNS24248 1044 945 43.75 5.1475 PNS24244 1471 1372 133.04 10.7815 PNS24243 293 194 0 0 KQK14069 1603 1504 4201.66 310.615 KQK14071 474 375 101.648 30.1383 ==> SRR12897245.se.tsv <== BRADI_1g14170v3 4518 BRADI_1g53295v3 30 BRADI_1g59795v3 296 BRADI_1g07683v3 0 BRADI_1g00485v3 30 BRADI_1g20270v3 683 BRADI_1g74790v3 89 BRADI_1g09890v3 0 BRADI_1g77505v3 150 BRADI_1g48960v3 0 SRR12897245 completed mapping pipeline successfully