Starting /dee2/code/volunteer_pipeline.sh SRR12897246 current disk space = 1543104077824 free memory = 1604957908 SRR12897246 SRAfilesize d09a38149538102288689eabf287ea3b SRR12897246.sra SRR12897246.sra file validated SRR12897246 is single end SRR12897246 is conventional basespace SRR12897246 read1 length is 43-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12897246_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 43-101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.76725 37.0 37.0 37.0 37.0 37.0 2 36.628 37.0 37.0 37.0 37.0 37.0 3 36.763 37.0 37.0 37.0 37.0 37.0 4 36.706 37.0 37.0 37.0 37.0 37.0 5 36.7895 37.0 37.0 37.0 37.0 37.0 6 36.7275 37.0 37.0 37.0 37.0 37.0 7 36.729 37.0 37.0 37.0 37.0 37.0 8 36.754 37.0 37.0 37.0 37.0 37.0 9 36.7195 37.0 37.0 37.0 37.0 37.0 10-11 36.7455 37.0 37.0 37.0 37.0 37.0 12-13 36.75075 37.0 37.0 37.0 37.0 37.0 14-15 36.7295 37.0 37.0 37.0 37.0 37.0 16-17 36.764250000000004 37.0 37.0 37.0 37.0 37.0 18-19 36.7425 37.0 37.0 37.0 37.0 37.0 20-21 36.688500000000005 37.0 37.0 37.0 37.0 37.0 22-23 36.72275 37.0 37.0 37.0 37.0 37.0 24-25 36.71775 37.0 37.0 37.0 37.0 37.0 26-27 36.751 37.0 37.0 37.0 37.0 37.0 28-29 36.68825 37.0 37.0 37.0 37.0 37.0 30-31 36.70225 37.0 37.0 37.0 37.0 37.0 32-33 36.667249999999996 37.0 37.0 37.0 37.0 37.0 34-35 36.653999999999996 37.0 37.0 37.0 37.0 37.0 36-37 36.692 37.0 37.0 37.0 37.0 37.0 38-39 36.683499999999995 37.0 37.0 37.0 37.0 37.0 40-41 36.696 37.0 37.0 37.0 37.0 37.0 42-43 36.722750000000005 37.0 37.0 37.0 37.0 37.0 44-45 36.726681670417605 37.0 37.0 37.0 37.0 37.0 46-47 36.64866216554138 37.0 37.0 37.0 37.0 37.0 48-49 36.68667166791698 37.0 37.0 37.0 37.0 37.0 50-51 36.6876719179795 37.0 37.0 37.0 37.0 37.0 52-53 36.71467866966742 37.0 37.0 37.0 37.0 37.0 54-55 36.65191297824456 37.0 37.0 37.0 37.0 37.0 56-57 36.68713063708648 37.0 37.0 37.0 37.0 37.0 58-59 36.643732799599704 37.0 37.0 37.0 37.0 37.0 60-61 36.64848636477358 37.0 37.0 37.0 37.0 37.0 62-63 36.59979767001043 37.0 37.0 37.0 37.0 37.0 64-65 36.66533166458073 37.0 37.0 37.0 37.0 37.0 66-67 36.680851063829785 37.0 37.0 37.0 37.0 37.0 68-69 36.59418837675351 37.0 37.0 37.0 37.0 37.0 70-71 36.63784251592908 37.0 37.0 37.0 37.0 37.0 72-73 36.664910960622024 37.0 37.0 37.0 37.0 37.0 74-75 36.622523200401304 37.0 37.0 37.0 37.0 37.0 76-77 36.67583014830451 37.0 37.0 37.0 37.0 37.0 78-79 36.5471365110766 37.0 37.0 37.0 37.0 37.0 80-81 36.63162432961728 37.0 37.0 37.0 37.0 37.0 82-83 36.62001858475676 37.0 37.0 37.0 37.0 37.0 84-85 36.581066880252635 37.0 37.0 37.0 37.0 37.0 86-87 36.590492612269635 37.0 37.0 37.0 37.0 37.0 88-89 36.56475501816067 37.0 37.0 37.0 37.0 37.0 90-91 36.6164626929683 37.0 37.0 37.0 37.0 37.0 92-93 36.61933615338487 37.0 37.0 37.0 37.0 37.0 94-95 36.567792621558425 37.0 37.0 37.0 37.0 37.0 96-97 36.57021103467643 37.0 37.0 37.0 37.0 37.0 98-99 36.573276753173516 37.0 37.0 37.0 37.0 37.0 100-101 36.53504861682177 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 2.0 26 3.0 27 3.0 28 4.0 29 13.0 30 10.0 31 11.0 32 24.0 33 18.0 34 50.0 35 96.0 36 2076.0 37 1690.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.38284571142786 10.352588147036759 4.576144036009002 53.68842210552638 2 19.7 11.575000000000001 40.150000000000006 28.575 3 18.224999999999998 15.1 25.85 40.825 4 24.875 23.549999999999997 21.725 29.849999999999998 5 25.025 29.7 24.099999999999998 21.175 6 22.3 30.349999999999998 23.525 23.825 7 18.15 24.525 38.85 18.475 8 19.075 22.0 32.225 26.700000000000003 9 19.075 20.25 35.949999999999996 24.725 10-11 22.125 30.337500000000002 23.45 24.087500000000002 12-13 21.825 24.8625 26.5875 26.724999999999998 14-15 20.7375 25.575 27.425 26.2625 16-17 22.675 25.0 26.5375 25.7875 18-19 22.375 24.6625 26.35 26.6125 20-21 22.787499999999998 24.925 26.900000000000002 25.387500000000003 22-23 21.775 25.6125 25.924999999999997 26.687499999999996 24-25 22.1875 25.6 25.674999999999997 26.5375 26-27 23.1125 25.174999999999997 25.637500000000003 26.075 28-29 22.8875 26.5625 25.174999999999997 25.374999999999996 30-31 22.912499999999998 25.074999999999996 25.25 26.7625 32-33 23.65 25.5375 25.724999999999998 25.087500000000002 34-35 22.662499999999998 24.925 27.05 25.362499999999997 36-37 23.0375 24.5125 26.4125 26.0375 38-39 22.650000000000002 26.187500000000004 24.8125 26.35 40-41 22.8875 25.8 25.900000000000002 25.412499999999998 42-43 22.5875 24.962500000000002 26.8125 25.637500000000003 44-45 22.968242060515127 26.344086021505376 25.618904726181547 25.068767191797946 46-47 22.66816704176044 25.381345336334082 26.556639159789945 25.393848462115532 48-49 23.15578894723681 24.943735933983497 25.76894223555889 26.131532883220803 50-51 21.867966991747938 25.943985996499126 25.806451612903224 26.38159539884971 52-53 22.43060765191298 26.419104776194047 25.593898474618655 25.55638909727432 54-55 23.305826456614152 25.056264066016503 25.918979744936234 25.71892973243311 56-57 23.67137676628736 25.38451919469801 25.75965987245217 25.184444166562457 58-59 21.828871653740308 25.906930197648236 26.157117838378785 26.10708031023267 60-61 22.61696272204153 24.993745308981737 26.019514635976982 26.36977733299975 62-63 22.45025653860593 25.47866349643349 26.329620823426353 25.74145914153423 64-65 23.35419274092616 25.819774718397998 25.669586983729666 25.15644555694618 66-67 22.891113892365457 24.76846057571965 26.25782227784731 26.082603254067582 68-69 22.48246492985972 26.302605210420843 25.93937875751503 25.275551102204407 70-71 23.170426065162907 25.789473684210527 25.513784461152884 25.526315789473685 72-73 22.74893403561575 25.92174567343867 24.793077501881115 26.536242789064456 74-75 23.024830699774267 25.357411587659897 25.532982192124404 26.084775520441433 76-77 24.17513486388157 25.153682097603813 25.10350018818216 25.567682850332456 78-79 22.855707647871405 24.80221022227804 25.64360165766671 26.69848047218385 80-81 22.73070153381946 26.31380437515715 25.672617550917774 25.282876540105608 82-83 22.777637874590784 26.202467892218586 26.189876605389074 24.830017627801563 84-85 23.545741324921135 25.514195583596216 25.564668769716086 25.37539432176656 86-87 22.96511627906977 24.898887765419616 26.47876643073812 25.657229524772497 88-89 23.02823142169895 26.06659070768452 25.395619698696038 25.5095581719205 90-91 23.36590937936286 25.980454372382283 25.472775732961033 25.18086051529382 92-93 23.106301718650542 24.824952259707192 26.4035646085296 25.665181413112663 94-95 23.20858347170775 25.661003959637245 25.801507216758207 25.328905351896797 96-97 23.054199845877214 25.09632674030311 25.78987927048549 26.05959414333419 98-99 22.377897080005237 25.245515254681155 26.3716118894854 26.004975775828203 100-101 23.652060596188303 12.119237660856816 32.44828147906825 31.780420263886626 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.5 28 1.5 29 5.5 30 6.5 31 5.0 32 7.0 33 14.0 34 21.5 35 31.0 36 48.5 37 65.0 38 79.0 39 93.0 40 131.0 41 163.0 42 168.0 43 174.5 44 211.0 45 232.0 46 219.5 47 210.0 48 191.0 49 185.0 50 182.0 51 164.5 52 146.0 53 134.0 54 135.0 55 124.0 56 92.5 57 72.0 58 74.0 59 88.0 60 82.5 61 75.5 62 69.5 63 56.5 64 53.0 65 51.0 66 40.5 67 34.5 68 33.5 69 20.0 70 8.0 71 6.0 72 8.5 73 5.5 74 2.0 75 2.5 76 1.0 77 0.5 78 1.0 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 42-43 1.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 2.0 58-59 0.0 60-61 1.0 62-63 1.0 64-65 0.0 66-67 3.0 68-69 1.0 70-71 4.0 72-73 0.0 74-75 1.0 76-77 3.0 78-79 4.0 80-81 6.0 82-83 10.0 84-85 6.0 86-87 5.0 88-89 9.0 90-91 13.0 92-93 11.0 94-95 21.0 96-97 35.0 98-99 331.0 100-101 3532.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.975 #Duplication Level Percentage of deduplicated Percentage of total 1 94.06757116254323 88.4 2 5.506783719074222 10.35 3 0.37243947858473 1.05 4 0.053205639797818574 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 924493 READS because READLEN < 1 Read 924493 spots for SRR12897246.sra Written 924493 spots for SRR12897246.sra Rejected 924493 READS because READLEN < 1 Read 924493 spots for SRR12897246.sra Written 924493 spots for SRR12897246.sra Rejected 924493 READS because READLEN < 1 Read 924493 spots for SRR12897246.sra Written 924493 spots for SRR12897246.sra Rejected 924493 READS because READLEN < 1 Read 924493 spots for SRR12897246.sra Written 924493 spots for SRR12897246.sra Rejected 924493 READS because READLEN < 1 Read 924493 spots for SRR12897246.sra Written 924493 spots for SRR12897246.sra Rejected 924502 READS because READLEN < 1 Read 924502 spots for SRR12897246.sra Written 924502 spots for SRR12897246.sra Rejected 924493 READS because READLEN < 1 Read 924493 spots for SRR12897246.sra Written 924493 spots for SRR12897246.sra Rejected 924493 READS because READLEN < 1 Read 924493 spots for SRR12897246.sra Written 924493 spots for SRR12897246.sra Rejected 924493 READS because READLEN < 1 Read 924493 spots for SRR12897246.sra Written 924493 spots for SRR12897246.sra Rejected 924493 READS because READLEN < 1 Read 924493 spots for SRR12897246.sra Written 924493 spots for SRR12897246.sra Rejected 924493 READS because READLEN < 1 Read 924493 spots for SRR12897246.sra Written 924493 spots for SRR12897246.sra Rejected 924493 READS because READLEN < 1 Read 924493 spots for SRR12897246.sra Written 924493 spots for SRR12897246.sra Rejected 924493 READS because READLEN < 1 Read 924493 spots for SRR12897246.sra Written 924493 spots for SRR12897246.sra Rejected 924493 READS because READLEN < 1 Read 924493 spots for SRR12897246.sra Written 924493 spots for SRR12897246.sra Rejected 924493 READS because READLEN < 1 Read 924493 spots for SRR12897246.sra Written 924493 spots for SRR12897246.sra Rejected 924493 READS because READLEN < 1 Read 924493 spots for SRR12897246.sra Written 924493 spots for SRR12897246.sra Rejected 924493 READS because READLEN < 1 Read 924493 spots for SRR12897246.sra Written 924493 spots for SRR12897246.sra Rejected 924493 READS because READLEN < 1 Read 924493 spots for SRR12897246.sra Written 924493 spots for SRR12897246.sra Rejected 924493 READS because READLEN < 1 Read 924493 spots for SRR12897246.sra Written 924493 spots for SRR12897246.sra Rejected 924493 READS because READLEN < 1 Read 924493 spots for SRR12897246.sra Written 924493 spots for SRR12897246.sra SRR ids: ['SRR12897246.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_x2ez5fu7 SRR12897246.sra spots: 18489869 blocks: [[1, 924493], [924494, 1848986], [1848987, 2773479], [2773480, 3697972], [3697973, 4622465], [4622466, 5546958], [5546959, 6471451], [6471452, 7395944], [7395945, 8320437], [8320438, 9244930], [9244931, 10169423], [10169424, 11093916], [11093917, 12018409], [12018410, 12942902], [12942903, 13867395], [13867396, 14791888], [14791889, 15716381], [15716382, 16640874], [16640875, 17565367], [17565368, 18489869]] SRR12897246 file size 4422761 SRR12897246 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12897246 SRR12897246_1.fastq Input file: SRR12897246_1.fastq trimmed: SRR12897246-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:11:17 2024 >> started Sat Dec 7 12:11:25 2024 >> done (8.506s) 18489869 reads processed; of these: 4 ( 0.00%) short reads filtered out after trimming by size control 2167 ( 0.01%) empty reads filtered out after trimming by size control 18487698 (99.99%) reads available; of these: 364 ( 0.00%) trimmed reads available after processing 18487334 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 21 1 0.00% 22 0 0.00% 23 1 0.00% 24 1 0.00% 25 1 0.00% 26 0 0.00% 27 2 0.00% 28 2 0.00% 29 0 0.00% 30 4 0.00% 31 1 0.00% 32 1 0.00% 33 2 0.00% 34 1 0.00% 35 46 0.00% 36 46 0.00% 37 72 0.00% 38 92 0.00% 39 77 0.00% 40 119 0.00% 41 113 0.00% 42 113 0.00% 43 154 0.00% 44 135 0.00% 45 160 0.00% 46 181 0.00% 47 224 0.00% 48 277 0.00% 49 307 0.00% 50 352 0.00% 51 426 0.00% 52 439 0.00% 53 461 0.00% 54 482 0.00% 55 563 0.00% 56 638 0.00% 57 704 0.00% 58 860 0.00% 59 1020 0.01% 60 1188 0.01% 61 1313 0.01% 62 1448 0.01% 63 1658 0.01% 64 1772 0.01% 65 1869 0.01% 66 2206 0.01% 67 2431 0.01% 68 2734 0.01% 69 3069 0.02% 70 3527 0.02% 71 4019 0.02% 72 4652 0.03% 73 5336 0.03% 74 5893 0.03% 75 6552 0.04% 76 7222 0.04% 77 7939 0.04% 78 8479 0.05% 79 9582 0.05% 80 10492 0.06% 81 11720 0.06% 82 13466 0.07% 83 14871 0.08% 84 16783 0.09% 85 18581 0.10% 86 20187 0.11% 87 21740 0.12% 88 24032 0.13% 89 25183 0.14% 90 27429 0.15% 91 30384 0.16% 92 31368 0.17% 93 34304 0.19% 94 38698 0.21% 95 43320 0.23% 96 67132 0.36% 97 126984 0.69% 98 379630 2.05% 99 1249112 6.76% 100 4288131 23.19% 101 11903184 64.38% 18487698 reads passed initial QC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=3.11 fanout-score-rank=16 prefix-density=0.34 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.09 sequence-density-rank=22 fanout-score=277.59 fanout-score-rank=1 prefix-density=0.78 prefix-fanout=30.8 sequence=CTTCTTCTTGTCCACGTTCTCCACGCTCTTCTCCTGGAACGCAGACATGGCGGACTCCGCCACCAACTTGCCGCTCGACA Started job on | Dec 07 12:11:41 Started mapping on | Dec 07 12:11:41 Finished on | Dec 07 12:11:57 Mapping speed, Million of reads per hour | 4159.73 Number of input reads | 18487698 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 17983420 Uniquely mapped reads % | 97.27% Average mapped length | 99.93 Number of splices: Total | 6424859 Number of splices: Annotated (sjdb) | 6101677 Number of splices: GT/AG | 6335209 Number of splices: GC/AG | 77126 Number of splices: AT/AC | 3370 Number of splices: Non-canonical | 9154 Mismatch rate per base, % | 0.17% Deletion rate per base | 0.01% Deletion average length | 2.28 Insertion rate per base | 0.01% Insertion average length | 1.75 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 318137 % of reads mapped to multiple loci | 1.72% Number of reads mapped to too many loci | 90281 % of reads mapped to too many loci | 0.49% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.50% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 186141 186141 186141 N_multimapping 318137 318137 318137 N_noFeature 752478 17578888 872935 N_ambiguous 317313 1404 34290 UnstrandedReadsAssigned:16913629 PositiveStrandReadsAssigned:403128 NegativeStrandReadsAssigned:17076195 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR12897246 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR12897246-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,487,698 reads, 17,227,386 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,194 rounds 52973 SRR12897246.ke.tsv 35125 SRR12897246.se.tsv 88098 total ==> SRR12897246.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 89.45 10.6978 PNS24247 1044 945 33.1959 3.51636 PNS24249 1928 1829 22.2624 1.21842 PNS24246 1044 945 33.1959 3.51636 PNS24248 1044 945 33.1959 3.51636 PNS24244 1471 1372 152.7 11.141 PNS24243 293 194 1 0.515987 KQK14069 1603 1504 2156.43 143.525 KQK14071 474 375 155.92 41.6209 ==> SRR12897246.se.tsv <== BRADI_1g14170v3 2551 BRADI_1g53295v3 80 BRADI_1g59795v3 646 BRADI_1g07683v3 0 BRADI_1g00485v3 53 BRADI_1g20270v3 2517 BRADI_1g74790v3 105 BRADI_1g09890v3 7 BRADI_1g77505v3 311 BRADI_1g48960v3 0 SRR12897246 completed mapping pipeline successfully