Starting /dee2/code/volunteer_pipeline.sh SRR12897247 current disk space = 1543096639488 free memory = 1599013088 SRR12897247 SRAfilesize 4eb2f2c1751e8dbb4137d713adf7ef53 SRR12897247.sra SRR12897247.sra file validated SRR12897247 is single end SRR12897247 is conventional basespace SRR12897247 read1 length is 35-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12897247_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6325 37.0 37.0 37.0 37.0 37.0 2 36.60125 37.0 37.0 37.0 37.0 37.0 3 36.75475 37.0 37.0 37.0 37.0 37.0 4 36.65725 37.0 37.0 37.0 37.0 37.0 5 36.78225 37.0 37.0 37.0 37.0 37.0 6 36.74975 37.0 37.0 37.0 37.0 37.0 7 36.67875 37.0 37.0 37.0 37.0 37.0 8 36.79225 37.0 37.0 37.0 37.0 37.0 9 36.71025 37.0 37.0 37.0 37.0 37.0 10-11 36.72025 37.0 37.0 37.0 37.0 37.0 12-13 36.6905 37.0 37.0 37.0 37.0 37.0 14-15 36.704499999999996 37.0 37.0 37.0 37.0 37.0 16-17 36.73375 37.0 37.0 37.0 37.0 37.0 18-19 36.73475 37.0 37.0 37.0 37.0 37.0 20-21 36.72425 37.0 37.0 37.0 37.0 37.0 22-23 36.7465 37.0 37.0 37.0 37.0 37.0 24-25 36.71575 37.0 37.0 37.0 37.0 37.0 26-27 36.67075 37.0 37.0 37.0 37.0 37.0 28-29 36.69675 37.0 37.0 37.0 37.0 37.0 30-31 36.6545 37.0 37.0 37.0 37.0 37.0 32-33 36.66175 37.0 37.0 37.0 37.0 37.0 34-35 36.709500000000006 37.0 37.0 37.0 37.0 37.0 36-37 36.67541885471368 37.0 37.0 37.0 37.0 37.0 38-39 36.67616904226057 37.0 37.0 37.0 37.0 37.0 40-41 36.6781695423856 37.0 37.0 37.0 37.0 37.0 42-43 36.66766691672918 37.0 37.0 37.0 37.0 37.0 44-45 36.659164791197796 37.0 37.0 37.0 37.0 37.0 46-47 36.6686671667917 37.0 37.0 37.0 37.0 37.0 48-49 36.625156289072265 37.0 37.0 37.0 37.0 37.0 50-51 36.650412603150784 37.0 37.0 37.0 37.0 37.0 52-53 36.62765691422856 37.0 37.0 37.0 37.0 37.0 54-55 36.62111457078878 37.0 37.0 37.0 37.0 37.0 56-57 36.66233116558279 37.0 37.0 37.0 37.0 37.0 58-59 36.61105552776388 37.0 37.0 37.0 37.0 37.0 60-61 36.67258629314657 37.0 37.0 37.0 37.0 37.0 62-63 36.64907453726863 37.0 37.0 37.0 37.0 37.0 64-65 36.69334667333667 37.0 37.0 37.0 37.0 37.0 66-67 36.695097548774385 37.0 37.0 37.0 37.0 37.0 68-69 36.62931465732866 37.0 37.0 37.0 37.0 37.0 70-71 36.61115524341977 37.0 37.0 37.0 37.0 37.0 72-73 36.66766917293233 37.0 37.0 37.0 37.0 37.0 74-75 36.677394416625035 37.0 37.0 37.0 37.0 37.0 76-77 36.67703937413485 37.0 37.0 37.0 37.0 37.0 78-79 36.57520831777592 37.0 37.0 37.0 37.0 37.0 80-81 36.637379739510706 37.0 37.0 37.0 37.0 37.0 82-83 36.66205180508874 37.0 37.0 37.0 37.0 37.0 84-85 36.60413542657206 37.0 37.0 37.0 37.0 37.0 86-87 36.5730334746376 37.0 37.0 37.0 37.0 37.0 88-89 36.644019278716456 37.0 37.0 37.0 37.0 37.0 90-91 36.60700528238458 37.0 37.0 37.0 37.0 37.0 92-93 36.66308454353627 37.0 37.0 37.0 37.0 37.0 94-95 36.58606711405908 37.0 37.0 37.0 37.0 37.0 96-97 36.62581085565051 37.0 37.0 37.0 37.0 37.0 98-99 36.62894455918384 37.0 37.0 37.0 37.0 37.0 100-101 36.5743887163597 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 2.0 26 0.0 27 5.0 28 5.0 29 8.0 30 15.0 31 15.0 32 22.0 33 24.0 34 45.0 35 82.0 36 2127.0 37 1649.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.8018018018018 9.384384384384385 5.805805805805806 58.008008008008005 2 17.72943235808952 13.078269567391848 41.76044011002751 27.431857964491122 3 18.3295823955989 13.203300825206302 25.381345336334082 43.08577144286072 4 24.281070267566893 23.53088272068017 22.73068267066767 29.457364341085274 5 26.356589147286826 28.307076769192296 23.380845211302827 21.955488872218055 6 21.85546386596649 30.632658164541137 23.88097024256064 23.63090772693173 7 17.05426356589147 24.20605151287822 40.235058764691175 18.504626156539132 8 18.579644911227806 23.655913978494624 32.23305826456614 25.531382845711427 9 18.204551137784446 20.580145036259065 35.83395848962241 25.381345336334082 10-11 22.093023255813954 30.107526881720432 24.55613903475869 23.243310827706924 12-13 21.630407601900476 24.20605151287822 27.53188297074269 26.63165791447862 14-15 21.817954488622153 25.76894223555889 27.28182045511378 25.131282820705174 16-17 23.25581395348837 26.269067266816705 25.206301575393848 25.268817204301076 18-19 22.155538884721178 25.243810952738183 26.144036009002253 26.456614153538382 20-21 21.930482620655166 25.6064016004001 26.556639159789945 25.906476619154787 22-23 22.50562640660165 26.04401100275069 25.6064016004001 25.84396099024756 24-25 22.930732683170792 26.569142285571395 25.206301575393848 25.29382345586397 26-27 22.66816704176044 26.431607901975497 26.04401100275069 24.85621405351338 28-29 22.693173293323333 26.6816704176044 25.531382845711427 25.09377344336084 30-31 22.48062015503876 25.218804701175294 26.59414853713428 25.70642660665166 32-33 22.255563890972745 25.506376594148538 26.93173293323331 25.30632658164541 34-35 23.1807951987997 25.55638909727432 25.70642660665166 25.55638909727432 36-37 23.88097024256064 24.99374843710928 25.243810952738183 25.881470367591895 38-39 22.468117029257314 25.581395348837212 26.39409852463116 25.55638909727432 40-41 21.75543885971493 26.70667666916729 25.143785946486624 26.39409852463116 42-43 22.255563890972745 25.656414103525883 25.331332833208304 26.756689172293076 44-45 21.742935733933482 25.968992248062015 26.356589147286826 25.93148287071768 46-47 22.74318579644911 26.84421105276319 25.44386096524131 24.968742185546386 48-49 22.543135783945985 24.731182795698924 26.406601650412604 26.319079769942487 50-51 23.005751437859466 26.056514128532132 25.743935983995996 25.1937984496124 52-53 22.95573893473368 26.59414853713428 25.406351587896975 25.04376094023506 54-55 22.12079529823684 24.609228460672753 26.972614730523947 26.297361510566464 56-57 21.860930465232617 25.82541270635318 26.163081540770385 26.150575287643825 58-59 22.56128064032016 26.263131565782892 25.325162581290645 25.850425212606304 60-61 22.26113056528264 25.68784392196098 26.125562781390695 25.925462731365684 62-63 23.17408704352176 25.48774387193597 26.063031515757878 25.275137568784395 64-65 22.661330665332667 25.15007503751876 26.638319159579787 25.550275137568786 66-67 23.12406203101551 24.524762381190595 25.662831415707853 26.688344172086044 68-69 22.36118059029515 26.025512756378188 26.500750375187593 25.11255627813907 70-71 23.660490736104155 26.114171256885328 25.475713570355534 24.749624436654983 72-73 22.69423558897243 25.288220551378448 25.964912280701753 26.052631578947366 74-75 22.651448639157156 25.71177724821272 25.912454534052426 25.7243195785777 76-77 23.731793068809644 25.665494726268207 25.577599196383726 25.025113008538426 78-79 22.734699007163503 24.934020359431948 26.316450923714967 26.01482970968958 80-81 22.83415063498051 26.329686910599776 26.11593109518421 24.72023135923551 82-83 23.218332913623772 25.86250314782171 25.144799798539413 25.77436414001511 84-85 22.880181428751417 25.33702910419554 26.06778379740456 25.715005669648484 86-87 22.861468584405753 25.25864244259399 26.280595508453192 25.599293464547063 88-89 22.62025316455696 26.101265822784807 26.569620253164555 24.70886075949367 90-91 23.508504696623508 25.488702716425486 25.59025133282559 25.412541254125415 92-93 22.718026951436563 25.59115179252479 25.667429443173152 26.023391812865498 94-95 23.476930920214123 25.783838898801935 25.75834820290594 24.980881978078003 96-97 22.600460711543384 24.699257742513435 26.081392372664446 26.61888917327873 98-99 23.54926651953784 24.535895105802936 26.288459041931716 25.62637933272751 100-101 23.818897637795274 11.384514435695538 32.44750656167979 32.349081364829395 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 0.5 27 1.0 28 1.5 29 3.0 30 7.5 31 12.0 32 13.5 33 17.5 34 20.5 35 32.5 36 46.0 37 55.0 38 74.5 39 102.5 40 134.5 41 160.5 42 183.0 43 203.0 44 208.0 45 205.0 46 227.0 47 226.5 48 192.0 49 176.5 50 166.0 51 156.0 52 140.0 53 133.0 54 123.0 55 112.5 56 104.5 57 95.0 58 90.5 59 85.5 60 86.0 61 72.5 62 61.5 63 54.5 64 47.5 65 46.0 66 42.5 67 34.0 68 22.0 69 10.5 70 7.0 71 6.0 72 4.5 73 5.0 74 3.0 75 0.5 76 1.0 77 1.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.025 3 0.025 4 0.025 5 0.025 6 0.025 7 0.025 8 0.025 9 0.025 10-11 0.025 12-13 0.025 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.025 24-25 0.025 26-27 0.025 28-29 0.025 30-31 0.025 32-33 0.025 34-35 0.025 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 34-35 1.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 1.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 2.0 70-71 6.0 72-73 2.0 74-75 5.0 76-77 4.0 78-79 1.0 80-81 5.0 82-83 4.0 84-85 2.0 86-87 14.0 88-89 13.0 90-91 4.0 92-93 10.0 94-95 11.0 96-97 26.0 98-99 382.0 100-101 3507.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.95 #Duplication Level Percentage of deduplicated Percentage of total 1 95.05002632964718 90.25 2 4.581358609794629 8.7 3 0.3686150605581885 1.05 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 829576 READS because READLEN < 1 Read 829576 spots for SRR12897247.sra Written 829576 spots for SRR12897247.sra Rejected 829576 READS because READLEN < 1 Read 829576 spots for SRR12897247.sra Written 829576 spots for SRR12897247.sra Rejected 829576 READS because READLEN < 1 Read 829576 spots for SRR12897247.sra Written 829576 spots for SRR12897247.sra Rejected 829576 READS because READLEN < 1 Read 829576 spots for SRR12897247.sra Written 829576 spots for SRR12897247.sra Rejected 829576 READS because READLEN < 1 Read 829576 spots for SRR12897247.sra Written 829576 spots for SRR12897247.sra Rejected 829576 READS because READLEN < 1 Read 829576 spots for SRR12897247.sra Written 829576 spots for SRR12897247.sra Rejected 829576 READS because READLEN < 1 Read 829576 spots for SRR12897247.sra Written 829576 spots for SRR12897247.sra Rejected 829576 READS because READLEN < 1 Read 829576 spots for SRR12897247.sra Written 829576 spots for SRR12897247.sra Rejected 829576 READS because READLEN < 1 Read 829576 spots for SRR12897247.sra Written 829576 spots for SRR12897247.sra Rejected 829576 READS because READLEN < 1 Read 829576 spots for SRR12897247.sra Written 829576 spots for SRR12897247.sra Rejected 829576 READS because READLEN < 1 Read 829576 spots for SRR12897247.sra Written 829576 spots for SRR12897247.sra Rejected 829576 READS because READLEN < 1 Read 829576 spots for SRR12897247.sra Written 829576 spots for SRR12897247.sra Rejected 829576 READS because READLEN < 1 Read 829576 spots for SRR12897247.sra Written 829576 spots for SRR12897247.sra Rejected 829576 READS because READLEN < 1 Read 829576 spots for SRR12897247.sra Written 829576 spots for SRR12897247.sra Rejected 829576 READS because READLEN < 1 Read 829576 spots for SRR12897247.sra Written 829576 spots for SRR12897247.sra Rejected 829576 READS because READLEN < 1 Read 829576 spots for SRR12897247.sra Written 829576 spots for SRR12897247.sra Rejected 829576 READS because READLEN < 1 Read 829576 spots for SRR12897247.sra Written 829576 spots for SRR12897247.sra Rejected 829576 READS because READLEN < 1 Read 829576 spots for SRR12897247.sra Written 829576 spots for SRR12897247.sra Rejected 829576 READS because READLEN < 1 Read 829576 spots for SRR12897247.sra Written 829576 spots for SRR12897247.sra Rejected 829584 READS because READLEN < 1 Read 829584 spots for SRR12897247.sra Written 829584 spots for SRR12897247.sra SRR ids: ['SRR12897247.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kjqxhy8e SRR12897247.sra spots: 16591528 blocks: [[1, 829576], [829577, 1659152], [1659153, 2488728], [2488729, 3318304], [3318305, 4147880], [4147881, 4977456], [4977457, 5807032], [5807033, 6636608], [6636609, 7466184], [7466185, 8295760], [8295761, 9125336], [9125337, 9954912], [9954913, 10784488], [10784489, 11614064], [11614065, 12443640], [12443641, 13273216], [13273217, 14102792], [14102793, 14932368], [14932369, 15761944], [15761945, 16591528]] SRR12897247 file size 3970320 SRR12897247 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12897247 SRR12897247_1.fastq Input file: SRR12897247_1.fastq trimmed: SRR12897247-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:10:26 2024 >> started Sat Dec 7 12:10:34 2024 >> done (7.958s) 16591528 reads processed; of these: 8 ( 0.00%) short reads filtered out after trimming by size control 1266 ( 0.01%) empty reads filtered out after trimming by size control 16590254 (99.99%) reads available; of these: 258 ( 0.00%) trimmed reads available after processing 16589996 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 1 0.00% 23 0 0.00% 24 1 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 3 0.00% 31 0 0.00% 32 1 0.00% 33 0 0.00% 34 0 0.00% 35 34 0.00% 36 47 0.00% 37 63 0.00% 38 67 0.00% 39 71 0.00% 40 70 0.00% 41 88 0.00% 42 106 0.00% 43 112 0.00% 44 110 0.00% 45 147 0.00% 46 135 0.00% 47 146 0.00% 48 190 0.00% 49 226 0.00% 50 280 0.00% 51 274 0.00% 52 322 0.00% 53 346 0.00% 54 369 0.00% 55 371 0.00% 56 459 0.00% 57 485 0.00% 58 582 0.00% 59 624 0.00% 60 704 0.00% 61 832 0.01% 62 881 0.01% 63 1008 0.01% 64 1083 0.01% 65 1185 0.01% 66 1306 0.01% 67 1453 0.01% 68 1638 0.01% 69 1802 0.01% 70 2138 0.01% 71 2367 0.01% 72 2716 0.02% 73 3147 0.02% 74 3548 0.02% 75 3772 0.02% 76 4369 0.03% 77 4791 0.03% 78 5035 0.03% 79 5993 0.04% 80 6521 0.04% 81 7351 0.04% 82 8235 0.05% 83 9312 0.06% 84 10437 0.06% 85 11418 0.07% 86 12750 0.08% 87 13681 0.08% 88 15228 0.09% 89 16297 0.10% 90 17874 0.11% 91 20340 0.12% 92 21249 0.13% 93 23378 0.14% 94 26800 0.16% 95 30964 0.19% 96 52096 0.31% 97 107589 0.65% 98 336670 2.03% 99 1123961 6.77% 100 3895637 23.48% 101 10766967 64.90% 16590254 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=3.17 fanout-score-rank=18 prefix-density=0.29 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.09 sequence-density-rank=15 fanout-score=281.27 fanout-score-rank=1 prefix-density=0.82 prefix-fanout=32.2 sequence=CTTCTTCTTGTCCACGTTCTCCACGCTCTTCTCCTGGAACGCAGACATGGCGGACTCCGCCACCAACTTGCCGCTCGACATCAGGTCACCGGATGACTTCTTGAAATTCT Started job on | Dec 07 12:10:49 Started mapping on | Dec 07 12:10:50 Finished on | Dec 07 12:11:04 Mapping speed, Million of reads per hour | 4266.07 Number of input reads | 16590254 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 16135658 Uniquely mapped reads % | 97.26% Average mapped length | 100.05 Number of splices: Total | 5816333 Number of splices: Annotated (sjdb) | 5526530 Number of splices: GT/AG | 5734935 Number of splices: GC/AG | 70074 Number of splices: AT/AC | 3160 Number of splices: Non-canonical | 8164 Mismatch rate per base, % | 0.17% Deletion rate per base | 0.01% Deletion average length | 2.28 Insertion rate per base | 0.01% Insertion average length | 1.73 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 288654 % of reads mapped to multiple loci | 1.74% Number of reads mapped to too many loci | 82681 % of reads mapped to too many loci | 0.50% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.48% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 165942 165942 165942 N_multimapping 288654 288654 288654 N_noFeature 685709 15775656 790819 N_ambiguous 283379 1327 29381 UnstrandedReadsAssigned:15166570 PositiveStrandReadsAssigned:358675 NegativeStrandReadsAssigned:15315458 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR12897247 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR12897247-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,590,254 reads, 15,465,103 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,274 rounds 52973 SRR12897247.ke.tsv 35125 SRR12897247.se.tsv 88098 total ==> SRR12897247.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 102.72 13.8539 PNS24247 1044 945 40.2153 4.80401 PNS24249 1928 1829 11.6874 0.721356 PNS24246 1044 945 40.2153 4.80401 PNS24248 1044 945 40.2153 4.80401 PNS24244 1471 1372 109.947 9.04636 PNS24243 293 194 0 0 KQK14069 1603 1504 1559.46 117.05 KQK14071 474 375 116.416 35.045 ==> SRR12897247.se.tsv <== BRADI_1g14170v3 1892 BRADI_1g53295v3 71 BRADI_1g59795v3 546 BRADI_1g07683v3 0 BRADI_1g00485v3 62 BRADI_1g20270v3 2660 BRADI_1g74790v3 66 BRADI_1g09890v3 1 BRADI_1g77505v3 279 BRADI_1g48960v3 0 SRR12897247 completed mapping pipeline successfully