Starting /dee2/code/volunteer_pipeline.sh SRR12897248 current disk space = 1543113961472 free memory = 1603428732 SRR12897248 SRAfilesize 6b89315f9d07042d58fa71d664793dc8 SRR12897248.sra SRR12897248.sra file validated SRR12897248 is single end SRR12897248 is conventional basespace SRR12897248 read1 length is 49-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12897248_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 49-101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.74625 37.0 37.0 37.0 37.0 37.0 2 36.605 37.0 37.0 37.0 37.0 37.0 3 36.7435 37.0 37.0 37.0 37.0 37.0 4 36.6545 37.0 37.0 37.0 37.0 37.0 5 36.7425 37.0 37.0 37.0 37.0 37.0 6 36.728 37.0 37.0 37.0 37.0 37.0 7 36.6905 37.0 37.0 37.0 37.0 37.0 8 36.729 37.0 37.0 37.0 37.0 37.0 9 36.666 37.0 37.0 37.0 37.0 37.0 10-11 36.7145 37.0 37.0 37.0 37.0 37.0 12-13 36.713 37.0 37.0 37.0 37.0 37.0 14-15 36.7395 37.0 37.0 37.0 37.0 37.0 16-17 36.72125 37.0 37.0 37.0 37.0 37.0 18-19 36.7535 37.0 37.0 37.0 37.0 37.0 20-21 36.6905 37.0 37.0 37.0 37.0 37.0 22-23 36.72625 37.0 37.0 37.0 37.0 37.0 24-25 36.6555 37.0 37.0 37.0 37.0 37.0 26-27 36.671 37.0 37.0 37.0 37.0 37.0 28-29 36.70099999999999 37.0 37.0 37.0 37.0 37.0 30-31 36.675250000000005 37.0 37.0 37.0 37.0 37.0 32-33 36.626000000000005 37.0 37.0 37.0 37.0 37.0 34-35 36.633750000000006 37.0 37.0 37.0 37.0 37.0 36-37 36.66175 37.0 37.0 37.0 37.0 37.0 38-39 36.664 37.0 37.0 37.0 37.0 37.0 40-41 36.62825 37.0 37.0 37.0 37.0 37.0 42-43 36.64725 37.0 37.0 37.0 37.0 37.0 44-45 36.6385 37.0 37.0 37.0 37.0 37.0 46-47 36.625 37.0 37.0 37.0 37.0 37.0 48-49 36.698499999999996 37.0 37.0 37.0 37.0 37.0 50-51 36.66808404202101 37.0 37.0 37.0 37.0 37.0 52-53 36.618059029514754 37.0 37.0 37.0 37.0 37.0 54-55 36.62231115557779 37.0 37.0 37.0 37.0 37.0 56-57 36.59754877438719 37.0 37.0 37.0 37.0 37.0 58-59 36.63081540770385 37.0 37.0 37.0 37.0 37.0 60-61 36.64607303651826 37.0 37.0 37.0 37.0 37.0 62-63 36.59144358268701 37.0 37.0 37.0 37.0 37.0 64-65 36.63838838838839 37.0 37.0 37.0 37.0 37.0 66-67 36.61511511511512 37.0 37.0 37.0 37.0 37.0 68-69 36.61706656594016 37.0 37.0 37.0 37.0 37.0 70-71 36.583881429548015 37.0 37.0 37.0 37.0 37.0 72-73 36.604610373340016 37.0 37.0 37.0 37.0 37.0 74-75 36.642516921534224 37.0 37.0 37.0 37.0 37.0 76-77 36.60486592643309 37.0 37.0 37.0 37.0 37.0 78-79 36.56270356701941 37.0 37.0 37.0 37.0 37.0 80-81 36.63111668757842 37.0 37.0 37.0 37.0 37.0 82-83 36.63736796726835 37.0 37.0 37.0 37.0 37.0 84-85 36.6003560647354 37.0 37.0 37.0 37.0 37.0 86-87 36.54662298387097 37.0 37.0 37.0 37.0 37.0 88-89 36.5893529788271 37.0 37.0 37.0 37.0 37.0 90-91 36.55221382979619 37.0 37.0 37.0 37.0 37.0 92-93 36.58010158908043 37.0 37.0 37.0 37.0 37.0 94-95 36.57962326207398 37.0 37.0 37.0 37.0 37.0 96-97 36.57090424395486 37.0 37.0 37.0 37.0 37.0 98-99 36.52916858341226 37.0 37.0 37.0 37.0 37.0 100-101 36.49629891774384 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 2.0 25 0.0 26 4.0 27 2.0 28 9.0 29 17.0 30 6.0 31 17.0 32 30.0 33 31.0 34 45.0 35 86.0 36 2056.0 37 1695.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.81045261315329 12.153038259564891 3.5758939734933737 42.460615153788446 2 20.549999999999997 12.725 38.85 27.875 3 18.075 15.825 27.825 38.275 4 23.775 24.675 22.525000000000002 29.025000000000002 5 24.45 31.525 23.474999999999998 20.549999999999997 6 23.125 31.4 22.575 22.900000000000002 7 17.4 25.025 39.550000000000004 18.025 8 18.15 22.975 32.525 26.35 9 18.825 20.7 34.925 25.55 10-11 22.412499999999998 29.9875 24.0625 23.5375 12-13 22.037499999999998 24.625 26.2875 27.05 14-15 21.1375 24.9375 27.987499999999997 25.937500000000004 16-17 22.35 25.7625 25.7625 26.125 18-19 22.625 26.6 24.587500000000002 26.187500000000004 20-21 23.25 26.125 25.9875 24.637500000000003 22-23 22.55 25.7375 26.0 25.7125 24-25 22.4875 25.337500000000002 26.087500000000002 26.087500000000002 26-27 22.525000000000002 25.8625 25.924999999999997 25.687500000000004 28-29 22.275 26.137500000000003 26.375 25.2125 30-31 22.8625 25.85 26.025 25.2625 32-33 21.575 26.5375 25.9875 25.900000000000002 34-35 22.3875 26.424999999999997 25.637500000000003 25.55 36-37 22.287499999999998 25.3125 26.2875 26.1125 38-39 22.662499999999998 25.912499999999998 25.7125 25.7125 40-41 23.1 26.6625 25.7 24.5375 42-43 22.4875 26.075 26.150000000000002 25.2875 44-45 23.474999999999998 25.724999999999998 26.3125 24.4875 46-47 22.95 26.0125 25.412499999999998 25.624999999999996 48-49 22.6875 26.1625 25.374999999999996 25.775 50-51 22.748874437218607 25.78789394697349 26.450725362681343 25.012506253126567 52-53 22.723861930965484 27.01350675337669 25.062531265632813 25.200100050025014 54-55 21.935967983991997 26.513256628314156 26.17558779389695 25.3751875937969 56-57 22.623811905952977 26.075537768884445 25.625312656328163 25.67533766883442 58-59 23.36168084042021 26.3631815907954 25.250125062531264 25.025012506253123 60-61 22.736368184092047 25.68784392196098 25.275137568784395 26.300650325162582 62-63 21.80385288966725 25.869402051538653 26.98273705278959 25.344008006004504 64-65 23.073073073073072 25.93843843843844 26.33883883883884 24.64964964964965 66-67 22.51001001001001 25.7007007007007 25.913413413413412 25.875875875875877 68-69 22.45025653860593 25.79151545488675 26.842698035289704 24.91552997121762 70-71 22.108162243365047 25.625938908362546 26.965448172258387 25.30045067601402 72-73 23.289902280130292 25.995990979704338 26.00851916812829 24.705587572037082 74-75 23.013286537979443 25.871145650538985 26.10930057658561 25.00626723489596 76-77 22.48965776607747 26.32568634825122 25.824244703522623 25.360411182148678 78-79 22.892624184646262 26.517812343201204 26.06623181133969 24.523331660812843 80-81 22.622333751568384 25.7465495608532 26.28607277289837 25.345043914680048 82-83 22.452569418268627 25.480588013569545 26.661640909662015 25.40520165849981 84-85 23.87064300994086 24.952812382030956 26.374732603498174 24.80181200453001 86-87 21.73639112903226 26.335685483870968 26.423891129032256 25.50403225806452 88-89 22.878042628326398 26.283263967713456 25.917517972001512 24.921175431958634 90-91 22.401818411415583 25.30622553352696 26.139664099002403 26.152291956055056 92-93 22.932759275674304 25.300747119159173 27.073572242623783 24.692921362542737 94-95 23.64513263104455 25.142784617337227 26.61505267165884 24.597030079959385 96-97 22.283163265306122 26.84948979591837 24.642857142857146 26.224489795918366 98-99 23.029908972691807 24.48634590377113 26.86605981794538 25.617685305591674 100-101 23.782894736842106 12.746710526315788 32.4671052631579 31.00328947368421 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 0.0 23 1.0 24 1.5 25 1.5 26 1.5 27 0.5 28 1.5 29 6.0 30 7.5 31 11.5 32 15.0 33 16.5 34 27.5 35 36.5 36 46.5 37 67.0 38 86.0 39 110.0 40 127.0 41 125.0 42 156.0 43 202.0 44 225.5 45 216.5 46 198.5 47 215.5 48 222.5 49 210.0 50 201.0 51 180.5 52 161.5 53 156.5 54 124.0 55 96.5 56 95.0 57 86.0 58 76.0 59 62.5 60 60.5 61 64.5 62 60.0 63 54.0 64 41.5 65 36.5 66 33.5 67 28.0 68 25.5 69 18.5 70 13.5 71 7.5 72 3.0 73 1.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 48-49 2.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 1.0 62-63 1.0 64-65 0.0 66-67 0.0 68-69 1.0 70-71 4.0 72-73 2.0 74-75 0.0 76-77 2.0 78-79 2.0 80-81 3.0 82-83 8.0 84-85 6.0 86-87 3.0 88-89 2.0 90-91 14.0 92-93 6.0 94-95 16.0 96-97 37.0 98-99 367.0 100-101 3523.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.5 #Duplication Level Percentage of deduplicated Percentage of total 1 95.0 89.775 2 4.285714285714286 8.1 3 0.6349206349206349 1.7999999999999998 4 0.052910052910052914 0.2 5 0.026455026455026457 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTGTTTCTTCTCCGGCGCCATGCCGAGAACCACCACCTGGGCCTGGGTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 837909 READS because READLEN < 1 Read 837909 spots for SRR12897248.sra Written 837909 spots for SRR12897248.sra Rejected 837909 READS because READLEN < 1 Read 837909 spots for SRR12897248.sra Written 837909 spots for SRR12897248.sra Rejected 837909 READS because READLEN < 1 Read 837909 spots for SRR12897248.sra Written 837909 spots for SRR12897248.sra Rejected 837909 READS because READLEN < 1 Read 837909 spots for SRR12897248.sra Written 837909 spots for SRR12897248.sra Rejected 837909 READS because READLEN < 1 Read 837909 spots for SRR12897248.sra Written 837909 spots for SRR12897248.sra Rejected 837909 READS because READLEN < 1 Read 837909 spots for SRR12897248.sra Written 837909 spots for SRR12897248.sra Rejected 837909 READS because READLEN < 1 Read 837909 spots for SRR12897248.sra Written 837909 spots for SRR12897248.sra Rejected 837909 READS because READLEN < 1 Read 837909 spots for SRR12897248.sra Written 837909 spots for SRR12897248.sra Rejected 837909 READS because READLEN < 1 Read 837909 spots for SRR12897248.sra Written 837909 spots for SRR12897248.sra Rejected 837917 READS because READLEN < 1 Read 837917 spots for SRR12897248.sra Written 837917 spots for SRR12897248.sra Rejected 837909 READS because READLEN < 1 Read 837909 spots for SRR12897248.sra Written 837909 spots for SRR12897248.sra Rejected 837909 READS because READLEN < 1 Read 837909 spots for SRR12897248.sra Written 837909 spots for SRR12897248.sra Rejected 837909 READS because READLEN < 1 Read 837909 spots for SRR12897248.sra Written 837909 spots for SRR12897248.sra Rejected 837909 READS because READLEN < 1 Read 837909 spots for SRR12897248.sra Written 837909 spots for SRR12897248.sra Rejected 837909 READS because READLEN < 1 Read 837909 spots for SRR12897248.sra Written 837909 spots for SRR12897248.sra Rejected 837909 READS because READLEN < 1 Read 837909 spots for SRR12897248.sra Written 837909 spots for SRR12897248.sra Rejected 837909 READS because READLEN < 1 Read 837909 spots for SRR12897248.sra Written 837909 spots for SRR12897248.sra Rejected 837909 READS because READLEN < 1 Read 837909 spots for SRR12897248.sra Written 837909 spots for SRR12897248.sra Rejected 837909 READS because READLEN < 1 Read 837909 spots for SRR12897248.sra Written 837909 spots for SRR12897248.sra Rejected 837909 READS because READLEN < 1 Read 837909 spots for SRR12897248.sra Written 837909 spots for SRR12897248.sra SRR ids: ['SRR12897248.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jjwbkg7w SRR12897248.sra spots: 16758188 blocks: [[1, 837909], [837910, 1675818], [1675819, 2513727], [2513728, 3351636], [3351637, 4189545], [4189546, 5027454], [5027455, 5865363], [5865364, 6703272], [6703273, 7541181], [7541182, 8379090], [8379091, 9216999], [9217000, 10054908], [10054909, 10892817], [10892818, 11730726], [11730727, 12568635], [12568636, 13406544], [13406545, 14244453], [14244454, 15082362], [15082363, 15920271], [15920272, 16758188]] SRR12897248 file size 4009012 SRR12897248 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12897248 SRR12897248_1.fastq Input file: SRR12897248_1.fastq trimmed: SRR12897248-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:11:18 2024 >> started Sat Dec 7 12:11:28 2024 >> done (9.522s) 16758188 reads processed; of these: 3 ( 0.00%) short reads filtered out after trimming by size control 1653 ( 0.01%) empty reads filtered out after trimming by size control 16756532 (99.99%) reads available; of these: 256 ( 0.00%) trimmed reads available after processing 16756276 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 2 0.00% 26 0 0.00% 27 2 0.00% 28 0 0.00% 29 0 0.00% 30 1 0.00% 31 0 0.00% 32 0 0.00% 33 3 0.00% 34 2 0.00% 35 27 0.00% 36 40 0.00% 37 37 0.00% 38 66 0.00% 39 73 0.00% 40 87 0.00% 41 83 0.00% 42 92 0.00% 43 92 0.00% 44 101 0.00% 45 100 0.00% 46 129 0.00% 47 137 0.00% 48 168 0.00% 49 246 0.00% 50 241 0.00% 51 285 0.00% 52 316 0.00% 53 315 0.00% 54 353 0.00% 55 398 0.00% 56 438 0.00% 57 514 0.00% 58 649 0.00% 59 654 0.00% 60 801 0.00% 61 888 0.01% 62 1007 0.01% 63 1125 0.01% 64 1226 0.01% 65 1367 0.01% 66 1468 0.01% 67 1659 0.01% 68 1920 0.01% 69 2133 0.01% 70 2419 0.01% 71 2834 0.02% 72 3106 0.02% 73 3666 0.02% 74 4044 0.02% 75 4593 0.03% 76 5019 0.03% 77 5326 0.03% 78 6004 0.04% 79 6728 0.04% 80 7531 0.04% 81 8430 0.05% 82 9722 0.06% 83 10817 0.06% 84 12089 0.07% 85 13532 0.08% 86 14807 0.09% 87 15971 0.10% 88 17411 0.10% 89 18722 0.11% 90 20629 0.12% 91 23015 0.14% 92 23235 0.14% 93 25900 0.15% 94 29379 0.18% 95 33873 0.20% 96 55287 0.33% 97 114202 0.68% 98 347921 2.08% 99 1146519 6.84% 100 3981260 23.76% 101 10763295 64.23% 16756532 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=36 prefix-density=0.16 prefix-fanout=2.2 sequence=CCGTGATCTTCTGGACCAGCGCTGCCACCTCCTGGTTCTGGGCCTCCATTTGATCAGCGAACTTGGAGTTACCGAATGCACGCGCTCTGAATTATGGAGAAGATGGTTCAGGAGTTGCTAGCTAG criterion=fanout-score sequence-density=0.09 sequence-density-rank=5 fanout-score=95.24 fanout-score-rank=1 prefix-density=0.58 prefix-fanout=15.5 sequence=TTCTTCTTCTTCC Started job on | Dec 07 12:11:43 Started mapping on | Dec 07 12:11:43 Finished on | Dec 07 12:12:08 Mapping speed, Million of reads per hour | 2412.94 Number of input reads | 16756532 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 15970091 Uniquely mapped reads % | 95.31% Average mapped length | 99.98 Number of splices: Total | 5522964 Number of splices: Annotated (sjdb) | 5257119 Number of splices: GT/AG | 5440120 Number of splices: GC/AG | 72028 Number of splices: AT/AC | 3243 Number of splices: Non-canonical | 7573 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.01% Deletion average length | 2.37 Insertion rate per base | 0.01% Insertion average length | 1.75 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 229417 % of reads mapped to multiple loci | 1.37% Number of reads mapped to too many loci | 72996 % of reads mapped to too many loci | 0.44% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.87% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 557024 557024 557024 N_multimapping 229417 229417 229417 N_noFeature 646930 15545871 756899 N_ambiguous 336626 1269 23714 UnstrandedReadsAssigned:14986535 PositiveStrandReadsAssigned:422951 NegativeStrandReadsAssigned:15189478 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR12897248 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR12897248-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,756,532 reads, 15,309,182 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,243 rounds 52973 SRR12897248.ke.tsv 35125 SRR12897248.se.tsv 88098 total ==> SRR12897248.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 47.4271 6.4317 PNS24247 1044 945 68.7975 8.26353 PNS24249 1928 1829 14.5751 0.904528 PNS24246 1044 945 68.7975 8.26353 PNS24248 1044 945 68.7975 8.26353 PNS24244 1471 1372 152.605 12.6252 PNS24243 293 194 0 0 KQK14069 1603 1504 5267.95 397.574 KQK14071 474 375 162.734 49.2575 ==> SRR12897248.se.tsv <== BRADI_1g14170v3 5750 BRADI_1g53295v3 41 BRADI_1g59795v3 306 BRADI_1g07683v3 0 BRADI_1g00485v3 39 BRADI_1g20270v3 663 BRADI_1g74790v3 92 BRADI_1g09890v3 0 BRADI_1g77505v3 144 BRADI_1g48960v3 0 SRR12897248 completed mapping pipeline successfully