Starting /dee2/code/volunteer_pipeline.sh SRR12897249 current disk space = 1543126175744 free memory = 1606527764 SRR12897249 SRAfilesize c341b43c78ee90ee77fe928429ccbf5a SRR12897249.sra SRR12897249.sra file validated SRR12897249 is single end SRR12897249 is conventional basespace SRR12897249 read1 length is 45-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12897249_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 45-101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.63275 37.0 37.0 37.0 37.0 37.0 2 36.635 37.0 37.0 37.0 37.0 37.0 3 36.745 37.0 37.0 37.0 37.0 37.0 4 36.76 37.0 37.0 37.0 37.0 37.0 5 36.729 37.0 37.0 37.0 37.0 37.0 6 36.787 37.0 37.0 37.0 37.0 37.0 7 36.6915 37.0 37.0 37.0 37.0 37.0 8 36.752 37.0 37.0 37.0 37.0 37.0 9 36.709 37.0 37.0 37.0 37.0 37.0 10-11 36.796 37.0 37.0 37.0 37.0 37.0 12-13 36.711 37.0 37.0 37.0 37.0 37.0 14-15 36.7475 37.0 37.0 37.0 37.0 37.0 16-17 36.76925 37.0 37.0 37.0 37.0 37.0 18-19 36.777 37.0 37.0 37.0 37.0 37.0 20-21 36.75175 37.0 37.0 37.0 37.0 37.0 22-23 36.727000000000004 37.0 37.0 37.0 37.0 37.0 24-25 36.7025 37.0 37.0 37.0 37.0 37.0 26-27 36.701750000000004 37.0 37.0 37.0 37.0 37.0 28-29 36.72125 37.0 37.0 37.0 37.0 37.0 30-31 36.68 37.0 37.0 37.0 37.0 37.0 32-33 36.697500000000005 37.0 37.0 37.0 37.0 37.0 34-35 36.703 37.0 37.0 37.0 37.0 37.0 36-37 36.6545 37.0 37.0 37.0 37.0 37.0 38-39 36.68675 37.0 37.0 37.0 37.0 37.0 40-41 36.724500000000006 37.0 37.0 37.0 37.0 37.0 42-43 36.73225 37.0 37.0 37.0 37.0 37.0 44-45 36.664 37.0 37.0 37.0 37.0 37.0 46-47 36.65991497874469 37.0 37.0 37.0 37.0 37.0 48-49 36.663415853963485 37.0 37.0 37.0 37.0 37.0 50-51 36.65416354088522 37.0 37.0 37.0 37.0 37.0 52-53 36.67466866716679 37.0 37.0 37.0 37.0 37.0 54-55 36.67891972993248 37.0 37.0 37.0 37.0 37.0 56-57 36.691422855713924 37.0 37.0 37.0 37.0 37.0 58-59 36.636409102275564 37.0 37.0 37.0 37.0 37.0 60-61 36.65691422855714 37.0 37.0 37.0 37.0 37.0 62-63 36.68267066766692 37.0 37.0 37.0 37.0 37.0 64-65 36.655413853463365 37.0 37.0 37.0 37.0 37.0 66-67 36.68283964911669 37.0 37.0 37.0 37.0 37.0 68-69 36.678759069301975 37.0 37.0 37.0 37.0 37.0 70-71 36.62512512512512 37.0 37.0 37.0 37.0 37.0 72-73 36.65381568348519 37.0 37.0 37.0 37.0 37.0 74-75 36.65354057158946 37.0 37.0 37.0 37.0 37.0 76-77 36.6468522698771 37.0 37.0 37.0 37.0 37.0 78-79 36.63654742190067 37.0 37.0 37.0 37.0 37.0 80-81 36.6449687283761 37.0 37.0 37.0 37.0 37.0 82-83 36.67689154029253 37.0 37.0 37.0 37.0 37.0 84-85 36.69221155735285 37.0 37.0 37.0 37.0 37.0 86-87 36.57212334413457 37.0 37.0 37.0 37.0 37.0 88-89 36.62158909029644 37.0 37.0 37.0 37.0 37.0 90-91 36.60392760757099 37.0 37.0 37.0 37.0 37.0 92-93 36.59950289866545 37.0 37.0 37.0 37.0 37.0 94-95 36.586708455752536 37.0 37.0 37.0 37.0 37.0 96-97 36.65422875829281 37.0 37.0 37.0 37.0 37.0 98-99 36.638628669846895 37.0 37.0 37.0 37.0 37.0 100-101 36.609516278257054 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 0.0 24 1.0 25 0.0 26 1.0 27 1.0 28 3.0 29 9.0 30 17.0 31 13.0 32 19.0 33 25.0 34 31.0 35 96.0 36 2119.0 37 1664.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.022516887665752 10.13259944958719 5.0287715786840135 54.81611208406305 2 18.15 12.4 42.15 27.3 3 17.525 15.35 26.625 40.5 4 23.9 23.3 21.05 31.75 5 25.6 28.9 24.275 21.224999999999998 6 21.15 31.85 24.2 22.8 7 18.775 24.224999999999998 38.224999999999994 18.775 8 18.85 22.575 32.75 25.825 9 18.575 20.575 34.8 26.05 10-11 22.5625 30.975 23.6625 22.8 12-13 21.8125 23.4375 27.5125 27.237499999999997 14-15 21.9375 24.5375 28.262500000000003 25.2625 16-17 21.675 25.937500000000004 26.375 26.0125 18-19 22.35 26.325 25.0625 26.2625 20-21 21.912499999999998 27.0875 26.1125 24.887500000000003 22-23 22.0125 25.9625 26.55 25.474999999999998 24-25 21.85 25.2625 26.625 26.2625 26-27 20.875 26.1625 27.525 25.4375 28-29 22.55 25.7125 25.85 25.887500000000003 30-31 22.287499999999998 26.6 25.074999999999996 26.0375 32-33 22.95 25.575 26.650000000000002 24.825 34-35 22.675 25.9625 25.9625 25.4 36-37 22.45 25.5625 26.2625 25.724999999999998 38-39 22.325 25.8125 26.625 25.2375 40-41 22.2625 26.0375 25.912499999999998 25.7875 42-43 21.5 25.687500000000004 26.450000000000003 26.3625 44-45 22.1875 25.874999999999996 26.337500000000002 25.6 46-47 22.718179544886222 27.644411102775695 25.431357839459867 24.20605151287822 48-49 22.2430607651913 25.30632658164541 26.51912978244561 25.93148287071768 50-51 21.980495123780948 24.76869217304326 26.39409852463116 26.85671417854464 52-53 22.53063265816454 25.618904726181547 25.618904726181547 26.231557889472366 54-55 23.005751437859466 25.331332833208304 26.456614153538382 25.206301575393848 56-57 22.88072018004501 26.581645411352838 25.918979744936234 24.618654663665918 58-59 22.43060765191298 26.269067266816705 25.98149537384346 25.318829707426854 60-61 23.80595148787197 25.168792198049513 25.10627656914228 25.918979744936234 62-63 22.468117029257314 25.656414103525883 25.70642660665166 26.16904226056514 64-65 23.3183295823956 26.19404851212803 24.90622655663916 25.581395348837212 66-67 22.59879939969985 25.68784392196098 25.26263131565783 26.450725362681343 68-69 22.61696272204153 25.156367275456592 26.482361771328495 25.74430823117338 70-71 23.285785785785787 26.05105105105105 25.0 25.663163163163162 72-73 23.14142678347935 25.632040050062578 24.868585732165208 26.357947434292868 74-75 22.236149410879918 26.096766106793684 26.560541489095012 25.106542993231386 76-77 22.72385252069225 26.749435665914223 25.84650112866817 24.680210684725356 78-79 22.439759036144576 25.727911646586342 26.242469879518072 25.589859437751006 80-81 23.05276381909548 25.42713567839196 26.118090452261306 25.402010050251256 82-83 22.68041237113402 25.86120191098818 25.86120191098818 25.597183806889618 84-85 23.153391216811375 25.846231282244876 25.51906379765949 25.481313703284258 86-87 23.0323636821559 25.12278050623347 25.815388490114593 26.029467321496035 88-89 22.79904004041935 26.272577996715928 25.426297840090946 25.502084122773777 90-91 22.71289383778312 26.179931671517142 26.01543717575604 25.09173731494369 92-93 22.915082382762993 25.39923954372624 26.400506970849175 25.285171102661597 94-95 22.645825390773926 26.0770110560427 25.670352014233067 25.606811538950314 96-97 22.713336739908023 25.421563617782322 25.868676545733265 25.996423096576393 98-99 23.14427600627287 24.59487715629901 26.476738107684266 25.78410872974386 100-101 23.70725260201553 12.027094002973731 32.59540723608128 31.670246158929455 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 0.5 28 2.0 29 2.5 30 1.5 31 6.5 32 13.5 33 20.0 34 26.5 35 37.5 36 50.5 37 63.0 38 76.5 39 94.0 40 125.5 41 150.5 42 177.0 43 199.0 44 206.0 45 212.5 46 226.5 47 228.5 48 207.0 49 185.0 50 184.0 51 182.0 52 149.5 53 136.5 54 130.0 55 113.5 56 103.0 57 101.0 58 92.0 59 81.0 60 77.5 61 67.5 62 50.0 63 44.5 64 53.0 65 44.0 66 33.5 67 24.5 68 16.5 69 12.5 70 5.5 71 4.0 72 4.0 73 1.0 74 0.5 75 0.5 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 44-45 1.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 2.0 68-69 1.0 70-71 0.0 72-73 6.0 74-75 3.0 76-77 2.0 78-79 4.0 80-81 3.0 82-83 4.0 84-85 2.0 86-87 12.0 88-89 5.0 90-91 9.0 92-93 8.0 94-95 14.0 96-97 51.0 98-99 365.0 100-101 3508.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.72500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 95.09105304829771 90.075 2 4.328318817629982 8.200000000000001 3 0.5014515703351808 1.425 4 0.0791765637371338 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 874644 READS because READLEN < 1 Read 874644 spots for SRR12897249.sra Written 874644 spots for SRR12897249.sra Rejected 874644 READS because READLEN < 1 Read 874644 spots for SRR12897249.sra Written 874644 spots for SRR12897249.sra Rejected 874644 READS because READLEN < 1 Read 874644 spots for SRR12897249.sra Written 874644 spots for SRR12897249.sra Rejected 874644 READS because READLEN < 1 Read 874644 spots for SRR12897249.sra Written 874644 spots for SRR12897249.sra Rejected 874644 READS because READLEN < 1 Read 874644 spots for SRR12897249.sra Written 874644 spots for SRR12897249.sra Rejected 874644 READS because READLEN < 1 Read 874644 spots for SRR12897249.sra Written 874644 spots for SRR12897249.sra Rejected 874644 READS because READLEN < 1 Read 874644 spots for SRR12897249.sra Written 874644 spots for SRR12897249.sra Rejected 874644 READS because READLEN < 1 Read 874644 spots for SRR12897249.sra Written 874644 spots for SRR12897249.sra Rejected 874644 READS because READLEN < 1 Read 874644 spots for SRR12897249.sra Written 874644 spots for SRR12897249.sra Rejected 874644 READS because READLEN < 1 Read 874644 spots for SRR12897249.sra Written 874644 spots for SRR12897249.sra Rejected 874644 READS because READLEN < 1 Read 874644 spots for SRR12897249.sra Written 874644 spots for SRR12897249.sra Rejected 874644 READS because READLEN < 1 Read 874644 spots for SRR12897249.sra Written 874644 spots for SRR12897249.sra Rejected 874644 READS because READLEN < 1 Read 874644 spots for SRR12897249.sra Written 874644 spots for SRR12897249.sra Rejected 874644 READS because READLEN < 1 Read 874644 spots for SRR12897249.sra Written 874644 spots for SRR12897249.sra Rejected 874644 READS because READLEN < 1 Read 874644 spots for SRR12897249.sra Written 874644 spots for SRR12897249.sra Rejected 874644 READS because READLEN < 1 Rejected 874644 READS because READLEN < 1 Read 874644 spots for SRR12897249.sra Written 874644 spots for SRR12897249.sra Read 874644 spots for SRR12897249.sra Written 874644 spots for SRR12897249.sra Rejected 874644 READS because READLEN < 1 Read 874644 spots for SRR12897249.sra Written 874644 spots for SRR12897249.sra Rejected 874658 READS because READLEN < 1 Read 874658 spots for SRR12897249.sra Written 874658 spots for SRR12897249.sra Rejected 874644 READS because READLEN < 1 Read 874644 spots for SRR12897249.sra Written 874644 spots for SRR12897249.sra SRR ids: ['SRR12897249.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_eeu3du6x SRR12897249.sra spots: 17492894 blocks: [[1, 874644], [874645, 1749288], [1749289, 2623932], [2623933, 3498576], [3498577, 4373220], [4373221, 5247864], [5247865, 6122508], [6122509, 6997152], [6997153, 7871796], [7871797, 8746440], [8746441, 9621084], [9621085, 10495728], [10495729, 11370372], [11370373, 12245016], [12245017, 13119660], [13119661, 13994304], [13994305, 14868948], [14868949, 15743592], [15743593, 16618236], [16618237, 17492894]] SRR12897249 file size 4184687 SRR12897249 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12897249 SRR12897249_1.fastq Input file: SRR12897249_1.fastq trimmed: SRR12897249-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:13:07 2024 >> started Sat Dec 7 12:13:16 2024 >> done (8.881s) 17492894 reads processed; of these: 7 ( 0.00%) short reads filtered out after trimming by size control 1619 ( 0.01%) empty reads filtered out after trimming by size control 17491268 (99.99%) reads available; of these: 393 ( 0.00%) trimmed reads available after processing 17490875 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 20 2 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 2 0.00% 26 2 0.00% 27 2 0.00% 28 2 0.00% 29 1 0.00% 30 1 0.00% 31 1 0.00% 32 3 0.00% 33 2 0.00% 34 2 0.00% 35 40 0.00% 36 57 0.00% 37 68 0.00% 38 66 0.00% 39 83 0.00% 40 92 0.00% 41 111 0.00% 42 114 0.00% 43 119 0.00% 44 135 0.00% 45 138 0.00% 46 159 0.00% 47 195 0.00% 48 258 0.00% 49 261 0.00% 50 323 0.00% 51 366 0.00% 52 380 0.00% 53 431 0.00% 54 422 0.00% 55 501 0.00% 56 540 0.00% 57 645 0.00% 58 718 0.00% 59 860 0.00% 60 922 0.01% 61 1212 0.01% 62 1375 0.01% 63 1389 0.01% 64 1627 0.01% 65 1647 0.01% 66 1882 0.01% 67 2076 0.01% 68 2377 0.01% 69 2584 0.01% 70 2899 0.02% 71 3265 0.02% 72 3683 0.02% 73 4385 0.03% 74 4790 0.03% 75 5372 0.03% 76 6061 0.03% 77 6541 0.04% 78 7323 0.04% 79 8272 0.05% 80 8907 0.05% 81 9786 0.06% 82 11148 0.06% 83 12299 0.07% 84 13715 0.08% 85 15500 0.09% 86 16655 0.10% 87 18165 0.10% 88 19835 0.11% 89 21124 0.12% 90 22960 0.13% 91 25596 0.15% 92 26367 0.15% 93 29068 0.17% 94 32857 0.19% 95 37007 0.21% 96 59692 0.34% 97 117683 0.67% 98 355837 2.03% 99 1176929 6.73% 100 4104924 23.47% 101 11278430 64.48% 17491268 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=3.00 fanout-score-rank=12 prefix-density=0.39 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=26 fanout-score=25.83 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=2.1 sequence=TGTTGTCGAAGTCGTACTTCCTTAGGCCCTGGCTGATGTACTCTTGGGAGCTGAGGACGGCCACGTGGGTACCGTCGCCCATGGGCGCCTGGAAGAGCGAGTCGACGATACCCTTCCCCCTGGTGATGTCCTGCTGGTCGTCGGAGATATCGTAGGCGAGGCCCTTCCACCTGTCCTGGTCAGTCTGCTTTGACTCGTCCACCTCCTTGGCCATGACTGTGAATCTGTTGGCCTTGGTGCTCTTGCCATGGTAGTTCACGGCCGAGGTCACCTGCTTCTTGAGCTTCTTCCCAAGGAAGCTGGTTGGCGTAGAAGCCGGAGCTCCGACGGTGGACGAGAAGGTAGCAGACATCTCTGCTCTGC Started job on | Dec 07 12:13:33 Started mapping on | Dec 07 12:13:34 Finished on | Dec 07 12:13:52 Mapping speed, Million of reads per hour | 3498.25 Number of input reads | 17491268 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 17009155 Uniquely mapped reads % | 97.24% Average mapped length | 99.98 Number of splices: Total | 6143271 Number of splices: Annotated (sjdb) | 5841744 Number of splices: GT/AG | 6057275 Number of splices: GC/AG | 74406 Number of splices: AT/AC | 3133 Number of splices: Non-canonical | 8457 Mismatch rate per base, % | 0.17% Deletion rate per base | 0.01% Deletion average length | 2.25 Insertion rate per base | 0.01% Insertion average length | 1.72 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 310801 % of reads mapped to multiple loci | 1.78% Number of reads mapped to too many loci | 85464 % of reads mapped to too many loci | 0.49% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.47% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 171312 171312 171312 N_multimapping 310801 310801 310801 N_noFeature 712077 16627346 819875 N_ambiguous 304580 1311 31652 UnstrandedReadsAssigned:15992498 PositiveStrandReadsAssigned:380498 NegativeStrandReadsAssigned:16157628 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR12897249 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR12897249-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,491,268 reads, 16,305,379 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,153 rounds 52973 SRR12897249.ke.tsv 35125 SRR12897249.se.tsv 88098 total ==> SRR12897249.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 137.679 17.585 PNS24247 1044 945 20.3163 2.29833 PNS24249 1928 1829 19.0745 1.11491 PNS24246 1044 945 20.3163 2.29833 PNS24248 1044 945 20.3163 2.29833 PNS24244 1471 1372 122.298 9.52938 PNS24243 293 194 0 0 KQK14069 1603 1504 1590.89 113.081 KQK14071 474 375 115.659 32.9723 ==> SRR12897249.se.tsv <== BRADI_1g14170v3 2065 BRADI_1g53295v3 74 BRADI_1g59795v3 615 BRADI_1g07683v3 0 BRADI_1g00485v3 39 BRADI_1g20270v3 2260 BRADI_1g74790v3 98 BRADI_1g09890v3 1 BRADI_1g77505v3 283 BRADI_1g48960v3 0 SRR12897249 completed mapping pipeline successfully