Starting /dee2/code/volunteer_pipeline.sh SRR12897250 current disk space = 1543126835200 free memory = 1603046300 SRR12897250 SRAfilesize 392cbd2355bcab0c0b4a973a7a665131 SRR12897250.sra SRR12897250.sra file validated SRR12897250 is single end SRR12897250 is conventional basespace SRR12897250 read1 length is 55-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12897250_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 55-101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.71625 37.0 37.0 37.0 37.0 37.0 2 36.7245 37.0 37.0 37.0 37.0 37.0 3 36.784 37.0 37.0 37.0 37.0 37.0 4 36.7985 37.0 37.0 37.0 37.0 37.0 5 36.7895 37.0 37.0 37.0 37.0 37.0 6 36.723 37.0 37.0 37.0 37.0 37.0 7 36.685 37.0 37.0 37.0 37.0 37.0 8 36.73 37.0 37.0 37.0 37.0 37.0 9 36.735 37.0 37.0 37.0 37.0 37.0 10-11 36.7535 37.0 37.0 37.0 37.0 37.0 12-13 36.7485 37.0 37.0 37.0 37.0 37.0 14-15 36.7435 37.0 37.0 37.0 37.0 37.0 16-17 36.7075 37.0 37.0 37.0 37.0 37.0 18-19 36.7975 37.0 37.0 37.0 37.0 37.0 20-21 36.744249999999994 37.0 37.0 37.0 37.0 37.0 22-23 36.7275 37.0 37.0 37.0 37.0 37.0 24-25 36.69675 37.0 37.0 37.0 37.0 37.0 26-27 36.6465 37.0 37.0 37.0 37.0 37.0 28-29 36.737 37.0 37.0 37.0 37.0 37.0 30-31 36.707 37.0 37.0 37.0 37.0 37.0 32-33 36.6995 37.0 37.0 37.0 37.0 37.0 34-35 36.679500000000004 37.0 37.0 37.0 37.0 37.0 36-37 36.69 37.0 37.0 37.0 37.0 37.0 38-39 36.646249999999995 37.0 37.0 37.0 37.0 37.0 40-41 36.676 37.0 37.0 37.0 37.0 37.0 42-43 36.670500000000004 37.0 37.0 37.0 37.0 37.0 44-45 36.681 37.0 37.0 37.0 37.0 37.0 46-47 36.637249999999995 37.0 37.0 37.0 37.0 37.0 48-49 36.65 37.0 37.0 37.0 37.0 37.0 50-51 36.65925 37.0 37.0 37.0 37.0 37.0 52-53 36.65475 37.0 37.0 37.0 37.0 37.0 54-55 36.618 37.0 37.0 37.0 37.0 37.0 56-57 36.66012826368173 37.0 37.0 37.0 37.0 37.0 58-59 36.61130565282642 37.0 37.0 37.0 37.0 37.0 60-61 36.65732866433217 37.0 37.0 37.0 37.0 37.0 62-63 36.6617463097323 37.0 37.0 37.0 37.0 37.0 64-65 36.665209930971756 37.0 37.0 37.0 37.0 37.0 66-67 36.643554443053816 37.0 37.0 37.0 37.0 37.0 68-69 36.626240737827644 37.0 37.0 37.0 37.0 37.0 70-71 36.66341096919609 37.0 37.0 37.0 37.0 37.0 72-73 36.6510497605337 37.0 37.0 37.0 37.0 37.0 74-75 36.64390097016533 37.0 37.0 37.0 37.0 37.0 76-77 36.59097744360902 37.0 37.0 37.0 37.0 37.0 78-79 36.61913681872099 37.0 37.0 37.0 37.0 37.0 80-81 36.620626836336214 37.0 37.0 37.0 37.0 37.0 82-83 36.6285140562249 37.0 37.0 37.0 37.0 37.0 84-85 36.63951909823577 37.0 37.0 37.0 37.0 37.0 86-87 36.574410298270095 37.0 37.0 37.0 37.0 37.0 88-89 36.62049861495845 37.0 37.0 37.0 37.0 37.0 90-91 36.58482715873905 37.0 37.0 37.0 37.0 37.0 92-93 36.60323390607073 37.0 37.0 37.0 37.0 37.0 94-95 36.63470795983817 37.0 37.0 37.0 37.0 37.0 96-97 36.64156760824426 37.0 37.0 37.0 37.0 37.0 98-99 36.60661081645773 37.0 37.0 37.0 37.0 37.0 100-101 36.54344688705442 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 2.0 25 1.0 26 0.0 27 1.0 28 2.0 29 7.0 30 14.0 31 17.0 32 15.0 33 39.0 34 37.0 35 102.0 36 2156.0 37 1607.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.646484863647736 9.532149111833874 5.253940455341506 56.56742556917689 2 17.7 11.75 40.575 29.975 3 17.849999999999998 14.899999999999999 25.624999999999996 41.625 4 23.075000000000003 23.3 21.8 31.825 5 24.975 28.999999999999996 25.074999999999996 20.95 6 23.35 31.374999999999996 23.175 22.1 7 18.425 23.775 40.075 17.724999999999998 8 19.3 22.575 32.275 25.85 9 19.400000000000002 20.225 34.775 25.6 10-11 22.95 29.95 23.549999999999997 23.549999999999997 12-13 22.0125 24.0375 26.775 27.175 14-15 21.1875 24.9875 27.575 26.25 16-17 23.1125 24.075 26.125 26.687499999999996 18-19 23.2375 25.424999999999997 24.9 26.437500000000004 20-21 21.4 26.650000000000002 26.075 25.874999999999996 22-23 22.075 26.1625 26.0 25.7625 24-25 22.825 25.5375 25.775 25.8625 26-27 22.4625 24.637500000000003 26.85 26.05 28-29 21.9625 25.637500000000003 26.775 25.624999999999996 30-31 22.5125 25.4875 26.1625 25.837500000000002 32-33 22.425 26.275 25.637500000000003 25.662499999999998 34-35 23.0875 26.1125 25.45 25.35 36-37 22.175 25.575 25.387500000000003 26.8625 38-39 23.35 24.95 26.5625 25.137500000000003 40-41 22.662499999999998 25.0 26.325 26.0125 42-43 22.8125 25.5375 26.0 25.650000000000002 44-45 21.825 25.575 26.337500000000002 26.2625 46-47 22.650000000000002 25.275 25.924999999999997 26.150000000000002 48-49 22.9625 25.4 25.5375 26.1 50-51 23.275000000000002 25.162499999999998 25.7625 25.8 52-53 23.1 25.374999999999996 26.487500000000004 25.0375 54-55 23.0 25.837500000000002 25.687500000000004 25.474999999999998 56-57 22.10829060897837 25.221958234337876 25.809678629486054 26.860072527197698 58-59 22.973986993496748 25.625312656328163 25.52526263131566 25.87543771885943 60-61 21.635817908954476 25.72536268134067 26.525762881440716 26.113056528264135 62-63 22.629472104078058 25.081310983237426 26.53239929947461 25.756817613209908 64-65 23.52058050794445 24.94682847491555 25.94770424121106 25.58488677592894 66-67 22.728410513141426 25.882352941176475 25.744680851063826 25.64455569461827 68-69 23.18187507823257 25.309800976342473 26.073350857428967 25.434973087995992 70-71 22.852491860756324 26.158276984723265 26.22088655146506 24.768344603055347 72-73 22.58266533066132 25.90180360721443 25.58867735470942 25.926853707414832 74-75 23.30535020674101 24.545796266132065 26.187194587144468 25.961658939982456 76-77 23.370927318295738 26.516290726817044 25.13784461152882 24.9749373433584 78-79 22.602482136141404 25.74902845681334 25.786636580167983 25.861852826877275 80-81 22.519131852967007 26.094592899259816 25.85622882950696 25.530046418266217 82-83 23.36847389558233 25.790662650602407 25.43925702811245 25.40160642570281 84-85 23.53458014309025 25.128655704782226 25.078448600476968 26.258315551650558 86-87 23.906485671191554 25.351935646053292 25.578179989944694 25.163398692810457 88-89 23.230924200453288 25.47217325610677 26.177285318559555 25.11961722488038 90-91 23.8239374448228 25.36259301299029 25.400428805650144 25.413040736536765 92-93 22.84559009350518 25.5117513267627 26.990144048521607 24.652514531210514 94-95 23.761874604179862 24.838505383153894 26.789107029765674 24.61051298290057 96-97 22.936245872491746 24.47294894589789 26.31445262890526 26.276352552705106 98-99 22.240910855220598 24.00051753137534 27.791434855738128 25.967136757665934 100-101 24.519153062873766 10.780669144981413 31.857119767253923 32.8430580248909 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 2.0 26 2.0 27 0.5 28 2.0 29 5.0 30 9.0 31 11.0 32 14.0 33 20.5 34 26.5 35 36.0 36 44.5 37 62.5 38 89.5 39 105.5 40 124.5 41 146.5 42 161.5 43 184.5 44 203.5 45 206.5 46 209.5 47 208.0 48 200.5 49 180.5 50 165.0 51 163.5 52 155.0 53 137.0 54 110.5 55 108.0 56 103.5 57 92.0 58 92.0 59 85.0 60 76.0 61 75.0 62 69.5 63 55.5 64 61.5 65 53.5 66 40.0 67 30.0 68 23.0 69 22.0 70 16.5 71 12.5 72 7.5 73 5.5 74 1.5 75 1.0 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 55 1.0 56 1.0 57 0.0 58 0.0 59 0.0 60 0.0 61 1.0 62 0.0 63 0.0 64 1.0 65 1.0 66 0.0 67 0.0 68 1.0 69 1.0 70 0.0 71 0.0 72 2.0 73 0.0 74 1.0 75 0.0 76 0.0 77 0.0 78 3.0 79 1.0 80 1.0 81 1.0 82 0.0 83 0.0 84 1.0 85 4.0 86 2.0 87 6.0 88 0.0 89 4.0 90 5.0 91 3.0 92 4.0 93 6.0 94 3.0 95 4.0 96 10.0 97 28.0 98 79.0 99 284.0 100 895.0 101 2646.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.675 #Duplication Level Percentage of deduplicated Percentage of total 1 94.74518088196461 89.7 2 4.911539477158701 9.3 3 0.31687351465540003 0.8999999999999999 4 0.026406126221283337 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 888091 READS because READLEN < 1 Read 888091 spots for SRR12897250.sra Written 888091 spots for SRR12897250.sra Rejected 888091 READS because READLEN < 1 Read 888091 spots for SRR12897250.sra Written 888091 spots for SRR12897250.sra Rejected 888091 READS because READLEN < 1 Read 888091 spots for SRR12897250.sra Written 888091 spots for SRR12897250.sra Rejected 888092 READS because READLEN < 1 Read 888092 spots for SRR12897250.sra Written 888092 spots for SRR12897250.sra Rejected 888091 READS because READLEN < 1 Read 888091 spots for SRR12897250.sra Written 888091 spots for SRR12897250.sra Rejected 888091 READS because READLEN < 1 Read 888091 spots for SRR12897250.sra Written 888091 spots for SRR12897250.sra Rejected 888091 READS because READLEN < 1 Read 888091 spots for SRR12897250.sra Written 888091 spots for SRR12897250.sra Rejected 888091 READS because READLEN < 1 Read 888091 spots for SRR12897250.sra Written 888091 spots for SRR12897250.sra Rejected 888091 READS because READLEN < 1 Read 888091 spots for SRR12897250.sra Written 888091 spots for SRR12897250.sra Rejected 888091 READS because READLEN < 1 Read 888091 spots for SRR12897250.sra Written 888091 spots for SRR12897250.sra Rejected 888091 READS because READLEN < 1 Read 888091 spots for SRR12897250.sra Written 888091 spots for SRR12897250.sra Rejected 888091 READS because READLEN < 1 Read 888091 spots for SRR12897250.sra Written 888091 spots for SRR12897250.sra Rejected 888091 READS because READLEN < 1 Read 888091 spots for SRR12897250.sra Written 888091 spots for SRR12897250.sra Rejected 888091 READS because READLEN < 1 Read 888091 spots for SRR12897250.sra Written 888091 spots for SRR12897250.sra Rejected 888091 READS because READLEN < 1 Read 888091 spots for SRR12897250.sra Written 888091 spots for SRR12897250.sra Rejected 888091 READS because READLEN < 1 Read 888091 spots for SRR12897250.sra Written 888091 spots for SRR12897250.sra Rejected 888091 READS because READLEN < 1 Read 888091 spots for SRR12897250.sra Written 888091 spots for SRR12897250.sra Rejected 888091 READS because READLEN < 1 Read 888091 spots for SRR12897250.sra Written 888091 spots for SRR12897250.sra Rejected 888091 READS because READLEN < 1 Read 888091 spots for SRR12897250.sra Written 888091 spots for SRR12897250.sra Rejected 888091 READS because READLEN < 1 Read 888091 spots for SRR12897250.sra Written 888091 spots for SRR12897250.sra SRR ids: ['SRR12897250.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wflcxeu5 SRR12897250.sra spots: 17761821 blocks: [[1, 888091], [888092, 1776182], [1776183, 2664273], [2664274, 3552364], [3552365, 4440455], [4440456, 5328546], [5328547, 6216637], [6216638, 7104728], [7104729, 7992819], [7992820, 8880910], [8880911, 9769001], [9769002, 10657092], [10657093, 11545183], [11545184, 12433274], [12433275, 13321365], [13321366, 14209456], [14209457, 15097547], [15097548, 15985638], [15985639, 16873729], [16873730, 17761821]] SRR12897250 file size 4253111 SRR12897250 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12897250 SRR12897250_1.fastq Input file: SRR12897250_1.fastq trimmed: SRR12897250-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:13:27 2024 >> started Sat Dec 7 12:13:40 2024 >> done (13.814s) 17761821 reads processed; of these: 7 ( 0.00%) short reads filtered out after trimming by size control 1084 ( 0.01%) empty reads filtered out after trimming by size control 17760730 (99.99%) reads available; of these: 248 ( 0.00%) trimmed reads available after processing 17760482 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 22 1 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 1 0.00% 27 1 0.00% 28 1 0.00% 29 1 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 2 0.00% 34 0 0.00% 35 33 0.00% 36 40 0.00% 37 40 0.00% 38 50 0.00% 39 52 0.00% 40 71 0.00% 41 85 0.00% 42 75 0.00% 43 75 0.00% 44 107 0.00% 45 86 0.00% 46 100 0.00% 47 145 0.00% 48 176 0.00% 49 206 0.00% 50 217 0.00% 51 248 0.00% 52 307 0.00% 53 320 0.00% 54 297 0.00% 55 376 0.00% 56 374 0.00% 57 455 0.00% 58 503 0.00% 59 553 0.00% 60 670 0.00% 61 781 0.00% 62 842 0.00% 63 1049 0.01% 64 1109 0.01% 65 1139 0.01% 66 1212 0.01% 67 1410 0.01% 68 1524 0.01% 69 1815 0.01% 70 1985 0.01% 71 2373 0.01% 72 2601 0.01% 73 2996 0.02% 74 3308 0.02% 75 3617 0.02% 76 4291 0.02% 77 4637 0.03% 78 5233 0.03% 79 5865 0.03% 80 6397 0.04% 81 6993 0.04% 82 8059 0.05% 83 8879 0.05% 84 9938 0.06% 85 11690 0.07% 86 12455 0.07% 87 13876 0.08% 88 15037 0.08% 89 15977 0.09% 90 17602 0.10% 91 20068 0.11% 92 20934 0.12% 93 23534 0.13% 94 26109 0.15% 95 30569 0.17% 96 52896 0.30% 97 110850 0.62% 98 350328 1.97% 99 1186335 6.68% 100 4148814 23.36% 101 11609935 65.37% 17760730 reads passed initial QC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=3.14 fanout-score-rank=16 prefix-density=0.39 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=104.12 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=4.8 sequence=CGGCGGTGGCGACGACGAGGAGGCTGGAGGTCTGGACCTCGGCTTCAGGGTACATGTTGCAGCCGTTGCAGCCGCTGCCGCACTTGCAGGATGACCCGCAGTTGCAGTTTCCTCCGCAGCAAGACATCTTCGGTCGAGTGCTCGAACTTGCTTAG Started job on | Dec 07 12:13:54 Started mapping on | Dec 07 12:13:55 Finished on | Dec 07 12:14:17 Mapping speed, Million of reads per hour | 2906.30 Number of input reads | 17760730 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 16914889 Uniquely mapped reads % | 95.24% Average mapped length | 100.08 Number of splices: Total | 6064642 Number of splices: Annotated (sjdb) | 5759908 Number of splices: GT/AG | 5979522 Number of splices: GC/AG | 73533 Number of splices: AT/AC | 3168 Number of splices: Non-canonical | 8419 Mismatch rate per base, % | 0.17% Deletion rate per base | 0.01% Deletion average length | 2.32 Insertion rate per base | 0.01% Insertion average length | 1.73 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 450566 % of reads mapped to multiple loci | 2.54% Number of reads mapped to too many loci | 303527 % of reads mapped to too many loci | 1.71% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.46% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 395275 395275 395275 N_multimapping 450566 450566 450566 N_noFeature 743025 16523858 859799 N_ambiguous 306025 1332 33108 UnstrandedReadsAssigned:15865839 PositiveStrandReadsAssigned:389699 NegativeStrandReadsAssigned:16021982 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR12897250 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR12897250-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,760,730 reads, 16,172,028 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,213 rounds 52973 SRR12897250.ke.tsv 35125 SRR12897250.se.tsv 88098 total ==> SRR12897250.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 140.404 17.951 PNS24247 1044 945 21.2903 2.41093 PNS24249 1928 1829 21.5523 1.26099 PNS24246 1044 945 21.2903 2.41093 PNS24248 1044 945 21.2903 2.41093 PNS24244 1471 1372 105.172 8.20317 PNS24243 293 194 0 0 KQK14069 1603 1504 1424.84 101.38 KQK14071 474 375 179.274 51.1589 ==> SRR12897250.se.tsv <== BRADI_1g14170v3 1992 BRADI_1g53295v3 69 BRADI_1g59795v3 655 BRADI_1g07683v3 0 BRADI_1g00485v3 24 BRADI_1g20270v3 2084 BRADI_1g74790v3 138 BRADI_1g09890v3 1 BRADI_1g77505v3 279 BRADI_1g48960v3 0 SRR12897250 completed mapping pipeline successfully