Starting /dee2/code/volunteer_pipeline.sh SRR12897251 current disk space = 1543139966976 free memory = 1601736696 SRR12897251 SRAfilesize 652e059fd6c9b220c46d22c96cf7625e SRR12897251.sra SRR12897251.sra file validated SRR12897251 is single end SRR12897251 is conventional basespace SRR12897251 read1 length is 67-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12897251_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 67-101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.7915 37.0 37.0 37.0 37.0 37.0 2 36.7215 37.0 37.0 37.0 37.0 37.0 3 36.7835 37.0 37.0 37.0 37.0 37.0 4 36.787 37.0 37.0 37.0 37.0 37.0 5 36.834 37.0 37.0 37.0 37.0 37.0 6 36.8055 37.0 37.0 37.0 37.0 37.0 7 36.734 37.0 37.0 37.0 37.0 37.0 8 36.762 37.0 37.0 37.0 37.0 37.0 9 36.7125 37.0 37.0 37.0 37.0 37.0 10-11 36.78175 37.0 37.0 37.0 37.0 37.0 12-13 36.7545 37.0 37.0 37.0 37.0 37.0 14-15 36.729749999999996 37.0 37.0 37.0 37.0 37.0 16-17 36.733999999999995 37.0 37.0 37.0 37.0 37.0 18-19 36.766999999999996 37.0 37.0 37.0 37.0 37.0 20-21 36.80975 37.0 37.0 37.0 37.0 37.0 22-23 36.716499999999996 37.0 37.0 37.0 37.0 37.0 24-25 36.732749999999996 37.0 37.0 37.0 37.0 37.0 26-27 36.7145 37.0 37.0 37.0 37.0 37.0 28-29 36.727000000000004 37.0 37.0 37.0 37.0 37.0 30-31 36.6875 37.0 37.0 37.0 37.0 37.0 32-33 36.687 37.0 37.0 37.0 37.0 37.0 34-35 36.74 37.0 37.0 37.0 37.0 37.0 36-37 36.69525 37.0 37.0 37.0 37.0 37.0 38-39 36.73925 37.0 37.0 37.0 37.0 37.0 40-41 36.686499999999995 37.0 37.0 37.0 37.0 37.0 42-43 36.698750000000004 37.0 37.0 37.0 37.0 37.0 44-45 36.70075 37.0 37.0 37.0 37.0 37.0 46-47 36.7025 37.0 37.0 37.0 37.0 37.0 48-49 36.68325 37.0 37.0 37.0 37.0 37.0 50-51 36.70975 37.0 37.0 37.0 37.0 37.0 52-53 36.6845 37.0 37.0 37.0 37.0 37.0 54-55 36.67175 37.0 37.0 37.0 37.0 37.0 56-57 36.679500000000004 37.0 37.0 37.0 37.0 37.0 58-59 36.68 37.0 37.0 37.0 37.0 37.0 60-61 36.68575 37.0 37.0 37.0 37.0 37.0 62-63 36.610749999999996 37.0 37.0 37.0 37.0 37.0 64-65 36.63875 37.0 37.0 37.0 37.0 37.0 66-67 36.676500000000004 37.0 37.0 37.0 37.0 37.0 68-69 36.643410852713174 37.0 37.0 37.0 37.0 37.0 70-71 36.65328511140734 37.0 37.0 37.0 37.0 37.0 72-73 36.708633395538754 37.0 37.0 37.0 37.0 37.0 74-75 36.67384114884586 37.0 37.0 37.0 37.0 37.0 76-77 36.653824603351524 37.0 37.0 37.0 37.0 37.0 78-79 36.65889139704038 37.0 37.0 37.0 37.0 37.0 80-81 36.616565987986064 37.0 37.0 37.0 37.0 37.0 82-83 36.69103162724724 37.0 37.0 37.0 37.0 37.0 84-85 36.632941331937275 37.0 37.0 37.0 37.0 37.0 86-87 36.67477700288064 37.0 37.0 37.0 37.0 37.0 88-89 36.6753673383404 37.0 37.0 37.0 37.0 37.0 90-91 36.59597759781526 37.0 37.0 37.0 37.0 37.0 92-93 36.60358506642657 37.0 37.0 37.0 37.0 37.0 94-95 36.58537393207955 37.0 37.0 37.0 37.0 37.0 96-97 36.587856952593455 37.0 37.0 37.0 37.0 37.0 98-99 36.62652693129135 37.0 37.0 37.0 37.0 37.0 100-101 36.59294165026633 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 1.0 25 1.0 26 1.0 27 2.0 28 6.0 29 7.0 30 9.0 31 16.0 32 15.0 33 25.0 34 35.0 35 94.0 36 2074.0 37 1713.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.5 10.299999999999999 5.675 54.525 2 17.9 12.625 41.05 28.425 3 16.650000000000002 14.7 27.025 41.625 4 22.7 23.575 22.6 31.125000000000004 5 26.200000000000003 27.474999999999998 25.025 21.3 6 20.825 32.175 22.8 24.2 7 17.0 24.175 40.5 18.325 8 18.7 24.2 29.849999999999998 27.250000000000004 9 17.875 20.775 35.875 25.474999999999998 10-11 22.2 31.0625 23.7 23.0375 12-13 21.9 23.7375 28.012500000000003 26.35 14-15 21.5375 25.5 27.3 25.662499999999998 16-17 22.4875 26.075 25.7375 25.7 18-19 22.1875 25.912499999999998 25.5125 26.387500000000003 20-21 22.8 26.1 26.3 24.8 22-23 21.099999999999998 26.424999999999997 26.875 25.6 24-25 21.875 25.337500000000002 26.900000000000002 25.887500000000003 26-27 21.712500000000002 25.900000000000002 27.462500000000002 24.925 28-29 22.9875 25.387500000000003 25.924999999999997 25.7 30-31 22.25 25.887500000000003 25.825 26.0375 32-33 21.3625 26.2625 26.5125 25.8625 34-35 22.025 26.75 26.025 25.2 36-37 22.1 26.125 26.0125 25.7625 38-39 22.412499999999998 26.5625 25.387500000000003 25.637500000000003 40-41 22.3625 27.3125 24.5 25.825 42-43 22.525000000000002 25.724999999999998 26.400000000000002 25.35 44-45 22.575 25.7875 25.912499999999998 25.724999999999998 46-47 22.0625 26.6625 25.687500000000004 25.587500000000002 48-49 22.3 25.55 25.387500000000003 26.7625 50-51 21.8875 27.1125 25.724999999999998 25.275 52-53 22.95 26.237500000000004 25.8125 25.0 54-55 21.45 26.775 26.5 25.275 56-57 21.45 26.2625 27.1 25.1875 58-59 22.175 26.8125 25.0375 25.974999999999998 60-61 22.0625 25.05 26.424999999999997 26.4625 62-63 22.175 25.650000000000002 26.7125 25.4625 64-65 22.55 27.275 25.5375 24.637500000000003 66-67 22.0625 25.874999999999996 25.724999999999998 26.337500000000002 68-69 22.005501375343837 26.881720430107524 26.30657664416104 24.8062015503876 70-71 22.451532207629768 26.20387742338962 25.428392745465917 25.916197623514698 72-73 23.041301627033793 25.381727158948685 26.44555694618273 25.131414267834796 74-75 22.357214428857716 26.064629258517037 26.152304609218437 25.425851703406817 76-77 23.098132598069935 25.29138989848352 26.51961398671513 25.09086351673142 78-79 21.908703285678456 26.285427639829447 25.833960371206423 25.971908703285678 80-81 22.107904642409036 25.859473023839396 26.637390213299874 25.395232120451695 82-83 21.451896508414972 26.26224566691786 26.45064054257724 25.83521728208993 84-85 22.61635220125786 25.207547169811324 25.49685534591195 26.679245283018865 86-87 22.91220556745182 25.242473863206953 26.262753495402443 25.582567073938783 88-89 22.499684701727833 26.32109976037331 25.690503216042377 25.488712321856475 90-91 23.220831753254963 25.20541018834534 25.736316521299457 25.837441537100243 92-93 23.482448358889872 24.952477506019516 26.751995944747183 24.81307819034343 94-95 23.398576512455517 25.965937976614136 25.546517539400103 25.088967971530252 96-97 23.24869210156948 24.881970141635833 25.519969376036748 26.349368380757944 98-99 23.502604166666664 25.442708333333336 26.197916666666664 24.856770833333332 100-101 23.790913531998044 11.871030776746458 32.37257775606579 31.965477935189707 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.5 23 2.0 24 1.5 25 1.0 26 0.0 27 1.0 28 2.0 29 3.5 30 6.0 31 11.0 32 16.5 33 19.5 34 20.5 35 31.5 36 50.0 37 74.5 38 96.0 39 110.0 40 123.0 41 146.0 42 165.5 43 191.0 44 226.5 45 219.5 46 231.0 47 230.5 48 187.0 49 177.5 50 180.5 51 183.5 52 169.5 53 142.0 54 125.0 55 100.5 56 89.0 57 83.0 58 75.0 59 77.0 60 70.5 61 65.0 62 54.5 63 44.0 64 43.5 65 33.0 66 32.0 67 34.5 68 25.5 69 17.0 70 9.5 71 7.0 72 4.0 73 2.0 74 2.0 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 67 1.0 68 0.0 69 1.0 70 1.0 71 1.0 72 2.0 73 1.0 74 2.0 75 0.0 76 3.0 77 1.0 78 0.0 79 1.0 80 2.0 81 2.0 82 2.0 83 4.0 84 2.0 85 4.0 86 1.0 87 2.0 88 5.0 89 4.0 90 5.0 91 5.0 92 5.0 93 5.0 94 8.0 95 8.0 96 7.0 97 27.0 98 96.0 99 257.0 100 929.0 101 2606.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.1 #Duplication Level Percentage of deduplicated Percentage of total 1 94.31455897980871 88.75 2 5.154091392136025 9.700000000000001 3 0.4782146652497344 1.35 4 0.053134962805526036 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.025 0.0 0.0 56-57 0.0 0.0 0.025 0.0 0.0 58-59 0.0 0.0 0.025 0.0 0.0 60-61 0.0 0.0 0.025 0.0 0.0 62-63 0.0 0.0 0.025 0.0 0.0 64-65 0.0 0.0 0.025 0.0 0.0 66-67 0.0 0.0 0.025 0.0 0.0 68-69 0.0 0.0 0.025 0.0 0.0 70-71 0.0 0.0 0.025 0.0 0.0 72-73 0.0 0.0 0.025 0.0 0.0 74-75 0.0 0.0 0.025 0.0 0.0 76-77 0.0 0.0 0.025 0.0 0.0 78-79 0.0 0.0 0.025 0.0 0.0 80-81 0.0 0.0 0.025 0.0 0.0 82-83 0.0 0.0 0.025 0.0 0.0 84-85 0.0 0.0 0.025 0.0 0.0 86-87 0.0 0.0 0.025 0.0 0.0 88-89 0.0 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 939825 READS because READLEN < 1 Read 939825 spots for SRR12897251.sra Written 939825 spots for SRR12897251.sra Rejected 939825 READS because READLEN < 1 Read 939825 spots for SRR12897251.sra Written 939825 spots for SRR12897251.sra Rejected 939825 READS because READLEN < 1 Read 939825 spots for SRR12897251.sra Written 939825 spots for SRR12897251.sra Rejected 939825 READS because READLEN < 1 Read 939825 spots for SRR12897251.sra Written 939825 spots for SRR12897251.sra Rejected 939825 READS because READLEN < 1 Read 939825 spots for SRR12897251.sra Written 939825 spots for SRR12897251.sra Rejected 939825 READS because READLEN < 1 Read 939825 spots for SRR12897251.sra Written 939825 spots for SRR12897251.sra Rejected 939825 READS because READLEN < 1 Read 939825 spots for SRR12897251.sra Written 939825 spots for SRR12897251.sra Rejected 939825 READS because READLEN < 1 Read 939825 spots for SRR12897251.sra Written 939825 spots for SRR12897251.sra Rejected 939825 READS because READLEN < 1 Read 939825 spots for SRR12897251.sra Written 939825 spots for SRR12897251.sra Rejected 939825 READS because READLEN < 1 Read 939825 spots for SRR12897251.sra Written 939825 spots for SRR12897251.sra Rejected 939825 READS because READLEN < 1 Read 939825 spots for SRR12897251.sra Written 939825 spots for SRR12897251.sra Rejected 939825 READS because READLEN < 1 Read 939825 spots for SRR12897251.sra Written 939825 spots for SRR12897251.sra Rejected 939831 READS because READLEN < 1 Read 939831 spots for SRR12897251.sra Written 939831 spots for SRR12897251.sra Rejected 939825 READS because READLEN < 1 Read 939825 spots for SRR12897251.sra Written 939825 spots for SRR12897251.sra Rejected 939825 READS because READLEN < 1 Read 939825 spots for SRR12897251.sra Written 939825 spots for SRR12897251.sra Rejected 939825 READS because READLEN < 1 Read 939825 spots for SRR12897251.sra Written 939825 spots for SRR12897251.sra Rejected 939825 READS because READLEN < 1 Read 939825 spots for SRR12897251.sra Written 939825 spots for SRR12897251.sra Rejected 939825 READS because READLEN < 1 Read 939825 spots for SRR12897251.sra Written 939825 spots for SRR12897251.sra Rejected 939825 READS because READLEN < 1 Read 939825 spots for SRR12897251.sra Written 939825 spots for SRR12897251.sra Rejected 939825 READS because READLEN < 1 Read 939825 spots for SRR12897251.sra Written 939825 spots for SRR12897251.sra SRR ids: ['SRR12897251.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qc4dr35_ SRR12897251.sra spots: 18796506 blocks: [[1, 939825], [939826, 1879650], [1879651, 2819475], [2819476, 3759300], [3759301, 4699125], [4699126, 5638950], [5638951, 6578775], [6578776, 7518600], [7518601, 8458425], [8458426, 9398250], [9398251, 10338075], [10338076, 11277900], [11277901, 12217725], [12217726, 13157550], [13157551, 14097375], [14097376, 15037200], [15037201, 15977025], [15977026, 16916850], [16916851, 17856675], [17856676, 18796506]] SRR12897251 file size 4498075 SRR12897251 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12897251 SRR12897251_1.fastq Input file: SRR12897251_1.fastq trimmed: SRR12897251-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:15:09 2024 >> started Sat Dec 7 12:15:18 2024 >> done (9.218s) 18796506 reads processed; of these: 6 ( 0.00%) short reads filtered out after trimming by size control 1383 ( 0.01%) empty reads filtered out after trimming by size control 18795117 (99.99%) reads available; of these: 331 ( 0.00%) trimmed reads available after processing 18794786 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 1 0.00% 22 0 0.00% 23 1 0.00% 24 1 0.00% 25 0 0.00% 26 1 0.00% 27 1 0.00% 28 0 0.00% 29 1 0.00% 30 2 0.00% 31 1 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 53 0.00% 36 44 0.00% 37 67 0.00% 38 65 0.00% 39 69 0.00% 40 83 0.00% 41 133 0.00% 42 118 0.00% 43 113 0.00% 44 134 0.00% 45 119 0.00% 46 151 0.00% 47 173 0.00% 48 210 0.00% 49 238 0.00% 50 298 0.00% 51 315 0.00% 52 358 0.00% 53 384 0.00% 54 426 0.00% 55 455 0.00% 56 505 0.00% 57 572 0.00% 58 683 0.00% 59 832 0.00% 60 924 0.00% 61 1031 0.01% 62 1200 0.01% 63 1375 0.01% 64 1538 0.01% 65 1689 0.01% 66 1837 0.01% 67 2073 0.01% 68 2216 0.01% 69 2515 0.01% 70 2972 0.02% 71 3409 0.02% 72 3881 0.02% 73 4492 0.02% 74 5080 0.03% 75 5534 0.03% 76 6233 0.03% 77 6769 0.04% 78 7507 0.04% 79 8333 0.04% 80 9360 0.05% 81 10430 0.06% 82 11904 0.06% 83 13453 0.07% 84 15094 0.08% 85 17104 0.09% 86 18482 0.10% 87 19752 0.11% 88 21894 0.12% 89 23835 0.13% 90 25793 0.14% 91 28396 0.15% 92 30364 0.16% 93 33339 0.18% 94 37532 0.20% 95 43397 0.23% 96 67681 0.36% 97 130340 0.69% 98 390191 2.08% 99 1273009 6.77% 100 4410134 23.46% 101 12086417 64.31% 18795117 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=3.15 fanout-score-rank=12 prefix-density=0.30 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.07 sequence-density-rank=21 fanout-score=320.49 fanout-score-rank=1 prefix-density=0.76 prefix-fanout=31.4 sequence=CTTCTTCTTGTC Started job on | Dec 07 12:15:39 Started mapping on | Dec 07 12:15:39 Finished on | Dec 07 12:15:56 Mapping speed, Million of reads per hour | 3980.14 Number of input reads | 18795117 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 18294431 Uniquely mapped reads % | 97.34% Average mapped length | 99.97 Number of splices: Total | 6605267 Number of splices: Annotated (sjdb) | 6271468 Number of splices: GT/AG | 6512770 Number of splices: GC/AG | 79523 Number of splices: AT/AC | 3695 Number of splices: Non-canonical | 9279 Mismatch rate per base, % | 0.17% Deletion rate per base | 0.01% Deletion average length | 2.31 Insertion rate per base | 0.01% Insertion average length | 1.73 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 314147 % of reads mapped to multiple loci | 1.67% Number of reads mapped to too many loci | 90204 % of reads mapped to too many loci | 0.48% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.50% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 186539 186539 186539 N_multimapping 314147 314147 314147 N_noFeature 791948 17874149 921728 N_ambiguous 324444 1474 35183 UnstrandedReadsAssigned:17178039 PositiveStrandReadsAssigned:418808 NegativeStrandReadsAssigned:17337520 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR12897251 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR12897251-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,795,117 reads, 17,491,061 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,212 rounds 52973 SRR12897251.ke.tsv 35125 SRR12897251.se.tsv 88098 total ==> SRR12897251.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 128.171 15.3585 PNS24247 1044 945 43.6422 4.63192 PNS24249 1928 1829 16.9492 0.929438 PNS24246 1044 945 43.6422 4.63192 PNS24248 1044 945 43.6422 4.63192 PNS24244 1471 1372 132.954 9.71925 PNS24243 293 194 0 0 KQK14069 1603 1504 1440.39 96.0549 KQK14071 474 375 167.212 44.7221 ==> SRR12897251.se.tsv <== BRADI_1g14170v3 2012 BRADI_1g53295v3 82 BRADI_1g59795v3 718 BRADI_1g07683v3 0 BRADI_1g00485v3 46 BRADI_1g20270v3 2617 BRADI_1g74790v3 94 BRADI_1g09890v3 3 BRADI_1g77505v3 302 BRADI_1g48960v3 0 SRR12897251 completed mapping pipeline successfully