Starting /dee2/code/volunteer_pipeline.sh SRR12897252 current disk space = 1543142936576 free memory = 1606787892 SRR12897252 SRAfilesize d0ba0053007cdd7be5cc746cf4ddbc84 SRR12897252.sra SRR12897252.sra file validated SRR12897252 is single end SRR12897252 is conventional basespace SRR12897252 read1 length is 59-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12897252_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 59-101 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.62525 37.0 37.0 37.0 37.0 37.0 2 36.575 37.0 37.0 37.0 37.0 37.0 3 36.7985 37.0 37.0 37.0 37.0 37.0 4 36.717 37.0 37.0 37.0 37.0 37.0 5 36.7715 37.0 37.0 37.0 37.0 37.0 6 36.715 37.0 37.0 37.0 37.0 37.0 7 36.7045 37.0 37.0 37.0 37.0 37.0 8 36.746 37.0 37.0 37.0 37.0 37.0 9 36.7335 37.0 37.0 37.0 37.0 37.0 10-11 36.760000000000005 37.0 37.0 37.0 37.0 37.0 12-13 36.741 37.0 37.0 37.0 37.0 37.0 14-15 36.7025 37.0 37.0 37.0 37.0 37.0 16-17 36.7 37.0 37.0 37.0 37.0 37.0 18-19 36.7415 37.0 37.0 37.0 37.0 37.0 20-21 36.6915 37.0 37.0 37.0 37.0 37.0 22-23 36.716499999999996 37.0 37.0 37.0 37.0 37.0 24-25 36.6965 37.0 37.0 37.0 37.0 37.0 26-27 36.70925 37.0 37.0 37.0 37.0 37.0 28-29 36.66475 37.0 37.0 37.0 37.0 37.0 30-31 36.702 37.0 37.0 37.0 37.0 37.0 32-33 36.703 37.0 37.0 37.0 37.0 37.0 34-35 36.64475 37.0 37.0 37.0 37.0 37.0 36-37 36.71025 37.0 37.0 37.0 37.0 37.0 38-39 36.70325 37.0 37.0 37.0 37.0 37.0 40-41 36.61475 37.0 37.0 37.0 37.0 37.0 42-43 36.64775 37.0 37.0 37.0 37.0 37.0 44-45 36.654250000000005 37.0 37.0 37.0 37.0 37.0 46-47 36.643249999999995 37.0 37.0 37.0 37.0 37.0 48-49 36.67275 37.0 37.0 37.0 37.0 37.0 50-51 36.66125 37.0 37.0 37.0 37.0 37.0 52-53 36.65625 37.0 37.0 37.0 37.0 37.0 54-55 36.6265 37.0 37.0 37.0 37.0 37.0 56-57 36.617000000000004 37.0 37.0 37.0 37.0 37.0 58-59 36.62175 37.0 37.0 37.0 37.0 37.0 60-61 36.64682341170585 37.0 37.0 37.0 37.0 37.0 62-63 36.59074883951858 37.0 37.0 37.0 37.0 37.0 64-65 36.663210120302935 37.0 37.0 37.0 37.0 37.0 66-67 36.65647761990448 37.0 37.0 37.0 37.0 37.0 68-69 36.59594188376754 37.0 37.0 37.0 37.0 37.0 70-71 36.595844320219385 37.0 37.0 37.0 37.0 37.0 72-73 36.62787998070691 37.0 37.0 37.0 37.0 37.0 74-75 36.57605639526331 37.0 37.0 37.0 37.0 37.0 76-77 36.65536484532153 37.0 37.0 37.0 37.0 37.0 78-79 36.62216730872029 37.0 37.0 37.0 37.0 37.0 80-81 36.59897664781656 37.0 37.0 37.0 37.0 37.0 82-83 36.61112531338266 37.0 37.0 37.0 37.0 37.0 84-85 36.601705754399994 37.0 37.0 37.0 37.0 37.0 86-87 36.55272682840474 37.0 37.0 37.0 37.0 37.0 88-89 36.56041113154452 37.0 37.0 37.0 37.0 37.0 90-91 36.5923186839523 37.0 37.0 37.0 37.0 37.0 92-93 36.55185033379314 37.0 37.0 37.0 37.0 37.0 94-95 36.53781650759879 37.0 37.0 37.0 37.0 37.0 96-97 36.58025786394528 37.0 37.0 37.0 37.0 37.0 98-99 36.52089100494514 37.0 37.0 37.0 37.0 37.0 100-101 36.549888855972256 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 1.0 25 2.0 26 1.0 27 4.0 28 6.0 29 10.0 30 7.0 31 13.0 32 17.0 33 31.0 34 43.0 35 117.0 36 2156.0 37 1591.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.28232058014504 10.227556889222306 5.026256564141035 55.463865966491625 2 18.25 12.3 43.725 25.724999999999998 3 18.5 14.45 25.8 41.25 4 24.349999999999998 22.025 23.125 30.5 5 25.55 29.075 23.974999999999998 21.4 6 20.875 32.4 23.599999999999998 23.125 7 17.575 23.375 40.275 18.775 8 19.75 22.725 31.474999999999998 26.05 9 19.525000000000002 20.599999999999998 35.225 24.65 10-11 22.05 30.6375 24.125 23.1875 12-13 23.0125 23.5375 26.987499999999997 26.4625 14-15 22.15 23.95 28.15 25.75 16-17 23.1 25.0 26.55 25.35 18-19 23.175 25.35 25.924999999999997 25.55 20-21 22.2125 25.2375 26.6125 25.937500000000004 22-23 22.85 25.4 25.5 26.25 24-25 22.975 25.3 25.900000000000002 25.825 26-27 23.0625 24.85 27.3 24.7875 28-29 22.925 25.55 25.9625 25.5625 30-31 22.3375 25.224999999999998 26.25 26.187500000000004 32-33 21.8625 25.2 26.7625 26.174999999999997 34-35 22.5875 25.650000000000002 25.974999999999998 25.7875 36-37 22.425 25.45 25.887500000000003 26.237500000000004 38-39 22.825 24.8 26.237500000000004 26.137500000000003 40-41 22.3625 26.325 26.1625 25.15 42-43 23.0125 25.45 24.5 27.037499999999998 44-45 22.725 25.974999999999998 26.25 25.05 46-47 23.05 25.85 25.724999999999998 25.374999999999996 48-49 23.200000000000003 24.325 26.9625 25.5125 50-51 22.85 25.224999999999998 25.924999999999997 26.0 52-53 22.912499999999998 25.374999999999996 25.637500000000003 26.075 54-55 22.0875 25.85 25.674999999999997 26.387500000000003 56-57 23.1625 24.9375 25.9625 25.937500000000004 58-59 22.8875 25.0375 25.75 26.325 60-61 22.973986993496748 25.237618809404704 25.550275137568786 26.23811905952976 62-63 22.501563477173235 25.490931832395248 25.86616635397123 26.14133833646029 64-65 22.920055048167146 25.55986488177155 25.972726135368447 25.547353934692858 66-67 22.796695042563847 25.776164246369554 25.01251877816725 26.41462193289935 68-69 23.09619238476954 25.212925851703403 26.31513026052104 25.37575150300601 70-71 22.387872713605613 25.85818090704084 25.35705337008269 26.396893009270862 72-73 22.617853560682047 25.915245737211634 24.611334002006018 26.855566700100304 74-75 23.970883534136547 25.853413654618475 24.799196787148595 25.376506024096386 76-77 23.536799799045465 25.018839487565934 25.596583772921377 25.84777694046722 78-79 22.976370035193565 25.314228255404725 26.256913021618907 25.452488687782804 80-81 22.264150943396228 25.72327044025157 25.82389937106918 26.18867924528302 82-83 23.515319631824486 25.457067204640023 24.99054343714538 26.037069726390115 84-85 23.24788483394368 24.750599823210003 25.45775981815886 26.543755524687462 86-87 23.27466126377105 25.7059642902368 26.073192351525897 24.946182094466256 88-89 23.553299492385786 25.52030456852792 25.317258883248734 25.60913705583756 90-91 22.798322531452538 25.56868725378066 26.229508196721312 25.40348201804549 92-93 24.188001528467712 24.188001528467712 25.69099477773532 25.933002165329256 94-95 22.83997955010225 25.33231083844581 26.265337423312886 25.562372188139058 96-97 23.295235649158855 24.75921407473995 26.06908950815462 25.87646076794658 98-99 23.883139001703128 23.752128913926374 25.651775186689374 26.712956897681124 100-101 24.01985111662531 11.993382961124896 32.70471464019851 31.28205128205128 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.0 27 2.0 28 2.0 29 4.0 30 4.5 31 7.5 32 14.0 33 21.5 34 32.0 35 32.5 36 37.0 37 55.5 38 82.0 39 101.5 40 117.0 41 145.0 42 173.5 43 193.5 44 191.0 45 197.5 46 209.5 47 214.0 48 211.0 49 200.0 50 186.5 51 164.5 52 137.5 53 127.0 54 120.0 55 113.0 56 106.5 57 99.5 58 97.5 59 83.0 60 68.5 61 73.0 62 77.5 63 58.0 64 52.5 65 51.5 66 39.0 67 33.5 68 26.0 69 14.0 70 10.0 71 11.5 72 10.5 73 5.5 74 3.5 75 4.5 76 4.0 77 1.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 59 2.0 60 0.0 61 0.0 62 1.0 63 0.0 64 1.0 65 0.0 66 4.0 67 0.0 68 0.0 69 0.0 70 2.0 71 1.0 72 2.0 73 2.0 74 2.0 75 1.0 76 2.0 77 1.0 78 2.0 79 0.0 80 4.0 81 5.0 82 5.0 83 2.0 84 3.0 85 6.0 86 7.0 87 3.0 88 4.0 89 3.0 90 1.0 91 6.0 92 5.0 93 9.0 94 4.0 95 11.0 96 11.0 97 28.0 98 87.0 99 299.0 100 903.0 101 2571.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.05 #Duplication Level Percentage of deduplicated Percentage of total 1 95.10783798001053 90.4 2 4.576538663861126 8.7 3 0.31562335612835346 0.8999999999999999 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 930338 READS because READLEN < 1 Read 930338 spots for SRR12897252.sra Written 930338 spots for SRR12897252.sra Rejected 930338 READS because READLEN < 1 Read 930338 spots for SRR12897252.sra Written 930338 spots for SRR12897252.sra Rejected 930338 READS because READLEN < 1 Read 930338 spots for SRR12897252.sra Written 930338 spots for SRR12897252.sra Rejected 930338 READS because READLEN < 1 Read 930338 spots for SRR12897252.sra Written 930338 spots for SRR12897252.sra Rejected 930338 READS because READLEN < 1 Read 930338 spots for SRR12897252.sra Written 930338 spots for SRR12897252.sra Rejected 930338 READS because READLEN < 1 Read 930338 spots for SRR12897252.sra Written 930338 spots for SRR12897252.sra Rejected 930338 READS because READLEN < 1 Rejected 930338 READS because READLEN < 1 Read 930338 spots for SRR12897252.sra Written 930338 spots for SRR12897252.sra Read 930338 spots for SRR12897252.sra Written 930338 spots for SRR12897252.sra Rejected 930338 READS because READLEN < 1 Read 930338 spots for SRR12897252.sra Written 930338 spots for SRR12897252.sra Rejected 930338 READS because READLEN < 1 Rejected 930338 READS because READLEN < 1 Read 930338 spots for SRR12897252.sra Written 930338 spots for SRR12897252.sra Rejected 930338 READS because READLEN < 1 Read 930338 spots for SRR12897252.sra Written 930338 spots for SRR12897252.sra Rejected 930338 READS because READLEN < 1 Read 930338 spots for SRR12897252.sra Written 930338 spots for SRR12897252.sra Rejected 930338 READS because READLEN < 1 Read 930338 spots for SRR12897252.sra Written 930338 spots for SRR12897252.sra Read 930338 spots for SRR12897252.sra Written 930338 spots for SRR12897252.sra Rejected 930338 READS because READLEN < 1 Rejected 930338 READS because READLEN < 1 Read 930338 spots for SRR12897252.sra Written 930338 spots for SRR12897252.sra Rejected 930338 READS because READLEN < 1 Read 930338 spots for SRR12897252.sra Written 930338 spots for SRR12897252.sra Rejected 930352 READS because READLEN < 1 Read 930338 spots for SRR12897252.sra Written 930338 spots for SRR12897252.sra Read 930352 spots for SRR12897252.sra Written 930352 spots for SRR12897252.sra Rejected 930338 READS because READLEN < 1 Rejected 930338 READS because READLEN < 1 Read 930338 spots for SRR12897252.sra Read 930338 spots for SRR12897252.sra Written 930338 spots for SRR12897252.sra Written 930338 spots for SRR12897252.sra SRR ids: ['SRR12897252.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0zmkln_w SRR12897252.sra spots: 18606774 blocks: [[1, 930338], [930339, 1860676], [1860677, 2791014], [2791015, 3721352], [3721353, 4651690], [4651691, 5582028], [5582029, 6512366], [6512367, 7442704], [7442705, 8373042], [8373043, 9303380], [9303381, 10233718], [10233719, 11164056], [11164057, 12094394], [12094395, 13024732], [13024733, 13955070], [13955071, 14885408], [14885409, 15815746], [15815747, 16746084], [16746085, 17676422], [17676423, 18606774]] SRR12897252 file size 4451388 SRR12897252 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12897252 SRR12897252_1.fastq Input file: SRR12897252_1.fastq trimmed: SRR12897252-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:17:11 2024 >> started Sat Dec 7 12:17:20 2024 >> done (9.130s) 18606774 reads processed; of these: 6 ( 0.00%) short reads filtered out after trimming by size control 1553 ( 0.01%) empty reads filtered out after trimming by size control 18605215 (99.99%) reads available; of these: 368 ( 0.00%) trimmed reads available after processing 18604847 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 0 0.00% 22 1 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 1 0.00% 30 1 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 1 0.00% 35 37 0.00% 36 65 0.00% 37 62 0.00% 38 87 0.00% 39 88 0.00% 40 100 0.00% 41 108 0.00% 42 124 0.00% 43 122 0.00% 44 116 0.00% 45 148 0.00% 46 174 0.00% 47 204 0.00% 48 215 0.00% 49 336 0.00% 50 347 0.00% 51 416 0.00% 52 467 0.00% 53 504 0.00% 54 460 0.00% 55 534 0.00% 56 649 0.00% 57 633 0.00% 58 812 0.00% 59 968 0.01% 60 1168 0.01% 61 1260 0.01% 62 1487 0.01% 63 1592 0.01% 64 1882 0.01% 65 1986 0.01% 66 2233 0.01% 67 2506 0.01% 68 2732 0.01% 69 2986 0.02% 70 3473 0.02% 71 3938 0.02% 72 4437 0.02% 73 5202 0.03% 74 5760 0.03% 75 6442 0.03% 76 7035 0.04% 77 7686 0.04% 78 8579 0.05% 79 9412 0.05% 80 10274 0.06% 81 11541 0.06% 82 13263 0.07% 83 14731 0.08% 84 15949 0.09% 85 18266 0.10% 86 19551 0.11% 87 21441 0.12% 88 23185 0.12% 89 24738 0.13% 90 26433 0.14% 91 29628 0.16% 92 30159 0.16% 93 33230 0.18% 94 37421 0.20% 95 42636 0.23% 96 65899 0.35% 97 126526 0.68% 98 382042 2.05% 99 1252354 6.73% 100 4305286 23.14% 101 12011085 64.56% 18605215 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=3.12 fanout-score-rank=18 prefix-density=0.34 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.09 sequence-density-rank=22 fanout-score=271.98 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=30.1 sequence=CTTCTTCTTGTCCACGTTCTCCACGCTCTTCTCCTGGAACGCAGACATGGCGGACTCCGCCACCAACTTGCCGCTCGACA Started job on | Dec 07 12:17:34 Started mapping on | Dec 07 12:17:34 Finished on | Dec 07 12:17:52 Mapping speed, Million of reads per hour | 3721.04 Number of input reads | 18605215 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 18125007 Uniquely mapped reads % | 97.42% Average mapped length | 99.94 Number of splices: Total | 6464968 Number of splices: Annotated (sjdb) | 6133824 Number of splices: GT/AG | 6374335 Number of splices: GC/AG | 78048 Number of splices: AT/AC | 3428 Number of splices: Non-canonical | 9157 Mismatch rate per base, % | 0.17% Deletion rate per base | 0.01% Deletion average length | 2.31 Insertion rate per base | 0.01% Insertion average length | 1.74 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 303396 % of reads mapped to multiple loci | 1.63% Number of reads mapped to too many loci | 82756 % of reads mapped to too many loci | 0.44% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.49% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 176812 176812 176812 N_multimapping 303396 303396 303396 N_noFeature 778247 17707478 905744 N_ambiguous 324360 1414 35700 UnstrandedReadsAssigned:17022400 PositiveStrandReadsAssigned:416115 NegativeStrandReadsAssigned:17183563 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR12897252 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR12897252-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,605,215 reads, 17,327,575 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,154 rounds 52973 SRR12897252.ke.tsv 35125 SRR12897252.se.tsv 88098 total ==> SRR12897252.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 114.746 13.6477 PNS24247 1044 945 39.6235 4.17415 PNS24249 1928 1829 17.4148 0.947877 PNS24246 1044 945 39.6235 4.17415 PNS24248 1044 945 39.6235 4.17415 PNS24244 1471 1372 140.969 10.2286 PNS24243 293 194 1 0.513152 KQK14069 1603 1504 2092.27 138.49 KQK14071 474 375 185.148 49.1514 ==> SRR12897252.se.tsv <== BRADI_1g14170v3 2709 BRADI_1g53295v3 88 BRADI_1g59795v3 665 BRADI_1g07683v3 0 BRADI_1g00485v3 37 BRADI_1g20270v3 1962 BRADI_1g74790v3 122 BRADI_1g09890v3 0 BRADI_1g77505v3 317 BRADI_1g48960v3 0 SRR12897252 completed mapping pipeline successfully