Starting /dee2/code/volunteer_pipeline.sh SRR12897253 current disk space = 1543153803264 free memory = 1602651780 SRR12897253 SRAfilesize ba8ffeddf2bb4264f03b80f42a56301a SRR12897253.sra SRR12897253.sra file validated SRR12897253 is single end SRR12897253 is conventional basespace SRR12897253 read1 length is 43-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12897253_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 43-101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.7025 37.0 37.0 37.0 37.0 37.0 2 36.643 37.0 37.0 37.0 37.0 37.0 3 36.6735 37.0 37.0 37.0 37.0 37.0 4 36.689 37.0 37.0 37.0 37.0 37.0 5 36.754 37.0 37.0 37.0 37.0 37.0 6 36.749 37.0 37.0 37.0 37.0 37.0 7 36.7575 37.0 37.0 37.0 37.0 37.0 8 36.727 37.0 37.0 37.0 37.0 37.0 9 36.765 37.0 37.0 37.0 37.0 37.0 10-11 36.752250000000004 37.0 37.0 37.0 37.0 37.0 12-13 36.7335 37.0 37.0 37.0 37.0 37.0 14-15 36.719750000000005 37.0 37.0 37.0 37.0 37.0 16-17 36.75375 37.0 37.0 37.0 37.0 37.0 18-19 36.73225 37.0 37.0 37.0 37.0 37.0 20-21 36.75575 37.0 37.0 37.0 37.0 37.0 22-23 36.75175 37.0 37.0 37.0 37.0 37.0 24-25 36.7155 37.0 37.0 37.0 37.0 37.0 26-27 36.679 37.0 37.0 37.0 37.0 37.0 28-29 36.70575 37.0 37.0 37.0 37.0 37.0 30-31 36.67975 37.0 37.0 37.0 37.0 37.0 32-33 36.678250000000006 37.0 37.0 37.0 37.0 37.0 34-35 36.732 37.0 37.0 37.0 37.0 37.0 36-37 36.689499999999995 37.0 37.0 37.0 37.0 37.0 38-39 36.69175 37.0 37.0 37.0 37.0 37.0 40-41 36.675 37.0 37.0 37.0 37.0 37.0 42-43 36.69675 37.0 37.0 37.0 37.0 37.0 44-45 36.66591647911978 37.0 37.0 37.0 37.0 37.0 46-47 36.653163290822704 37.0 37.0 37.0 37.0 37.0 48-49 36.665666416604154 37.0 37.0 37.0 37.0 37.0 50-51 36.64691172793198 37.0 37.0 37.0 37.0 37.0 52-53 36.6366591647912 37.0 37.0 37.0 37.0 37.0 54-55 36.68042010502626 37.0 37.0 37.0 37.0 37.0 56-57 36.63890972743186 37.0 37.0 37.0 37.0 37.0 58-59 36.60915228807202 37.0 37.0 37.0 37.0 37.0 60-61 36.6254063515879 37.0 37.0 37.0 37.0 37.0 62-63 36.64536444266144 37.0 37.0 37.0 37.0 37.0 64-65 36.650825412706354 37.0 37.0 37.0 37.0 37.0 66-67 36.60264505185696 37.0 37.0 37.0 37.0 37.0 68-69 36.64689689689689 37.0 37.0 37.0 37.0 37.0 70-71 36.62739588972741 37.0 37.0 37.0 37.0 37.0 72-73 36.628206111546575 37.0 37.0 37.0 37.0 37.0 74-75 36.626566416040106 37.0 37.0 37.0 37.0 37.0 76-77 36.62642389439564 37.0 37.0 37.0 37.0 37.0 78-79 36.566733567486196 37.0 37.0 37.0 37.0 37.0 80-81 36.575966950827265 37.0 37.0 37.0 37.0 37.0 82-83 36.61099473269964 37.0 37.0 37.0 37.0 37.0 84-85 36.5893491562082 37.0 37.0 37.0 37.0 37.0 86-87 36.61062240632276 37.0 37.0 37.0 37.0 37.0 88-89 36.58564801178767 37.0 37.0 37.0 37.0 37.0 90-91 36.62154701029456 37.0 37.0 37.0 37.0 37.0 92-93 36.56014149811522 37.0 37.0 37.0 37.0 37.0 94-95 36.63685267272568 37.0 37.0 37.0 37.0 37.0 96-97 36.57986865384841 37.0 37.0 37.0 37.0 37.0 98-99 36.59372414760017 37.0 37.0 37.0 37.0 37.0 100-101 36.568828428159634 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 0.0 24 0.0 25 0.0 26 1.0 27 2.0 28 5.0 29 11.0 30 10.0 31 22.0 32 20.0 33 29.0 34 42.0 35 103.0 36 2099.0 37 1654.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.755755755755754 10.535535535535535 5.005005005005005 53.70370370370371 2 18.8 12.925 42.6 25.674999999999997 3 17.150000000000002 14.6 26.625 41.625 4 23.375 23.575 21.875 31.175000000000004 5 26.25 28.575 24.8 20.375 6 22.625 31.45 23.3 22.625 7 17.974999999999998 24.65 40.225 17.150000000000002 8 18.625 23.275000000000002 31.1 27.0 9 17.95 21.25 35.199999999999996 25.6 10-11 21.987499999999997 31.4875 24.1375 22.3875 12-13 22.1 23.6125 28.025 26.2625 14-15 21.775 25.525 26.7625 25.937500000000004 16-17 22.825 24.5 26.924999999999997 25.75 18-19 22.325 25.087500000000002 27.175 25.412499999999998 20-21 22.35 26.087500000000002 26.787499999999998 24.775 22-23 22.275 25.4875 26.35 25.887500000000003 24-25 22.2625 25.775 25.912499999999998 26.05 26-27 21.725 25.324999999999996 27.825 25.124999999999996 28-29 23.2375 25.775 26.525 24.462500000000002 30-31 22.35 25.650000000000002 26.575 25.424999999999997 32-33 21.975 25.874999999999996 25.912499999999998 26.237500000000004 34-35 21.7875 26.825 25.6125 25.775 36-37 22.2 26.05 25.637500000000003 26.1125 38-39 21.712500000000002 25.8625 27.125 25.3 40-41 21.7 27.224999999999998 25.624999999999996 25.45 42-43 22.15 26.0375 25.662499999999998 26.150000000000002 44-45 22.093023255813954 25.531382845711427 26.431607901975497 25.943985996499126 46-47 23.018254563640912 26.6816704176044 25.85646411602901 24.44361090272568 48-49 22.380595148787197 25.10627656914228 26.356589147286826 26.156539134783696 50-51 22.968242060515127 25.78144536134033 25.943985996499126 25.30632658164541 52-53 22.58064516129032 26.9567391847962 25.03125781445361 25.431357839459867 54-55 21.817954488622153 25.84396099024756 26.131532883220803 26.206551637909474 56-57 21.405351337834457 25.76894223555889 26.86921730432608 25.95648912228057 58-59 23.15578894723681 26.76919229807452 24.868717179294826 25.206301575393848 60-61 23.193298324581146 25.85646411602901 25.6064016004001 25.343835958989747 62-63 22.5834688008003 25.89721145429536 25.82218331874453 25.697136426159812 64-65 23.12406203101551 26.088044022011005 25.550275137568786 25.237618809404704 66-67 22.744901789065434 25.935193294132365 25.935193294132365 25.384711622669837 68-69 22.134634634634633 26.651651651651655 27.289789789789793 23.923923923923923 70-71 22.77450857643671 26.580693627144107 26.480530862651808 24.164266933767372 72-73 23.086558937742705 25.491669798321432 25.403983464862833 26.017787799073027 74-75 22.45614035087719 25.93984962406015 25.526315789473685 26.07769423558897 76-77 23.25435627428858 26.16271781371443 26.501190923906233 24.081734988090762 78-79 22.39086803813347 25.815353738083292 25.200702458605118 26.593075765178124 80-81 22.481495420900764 25.24150043909171 26.370593401078914 25.906410738928614 82-83 22.576594676042188 26.268206931190356 25.389251632345555 25.765946760421897 84-85 23.047906450396077 24.933987174651076 25.71356720734314 26.304539167609708 86-87 22.744455645161292 26.5625 26.38608870967742 24.306955645161292 88-89 22.01742204267138 26.133064007069812 26.06994066405757 25.779573286201234 90-91 23.09638249430812 25.15810776625348 25.63875537566405 26.10675436377435 92-93 22.96954314720812 24.936548223350254 26.85279187817259 25.24111675126904 94-95 23.204068658614112 25.530832803560077 25.772409408773044 25.492689129052764 96-97 22.553897180762853 26.329889016456182 25.487944890929963 25.628268911851 98-99 22.882906429691584 24.72556194458965 26.960271824359644 25.431259801359126 100-101 23.56751370204285 12.140840391961468 32.98455406078725 31.307091845208433 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 2.0 26 2.5 27 2.5 28 3.5 29 4.0 30 5.0 31 7.5 32 8.0 33 11.0 34 20.5 35 38.5 36 52.5 37 70.5 38 103.5 39 133.5 40 150.5 41 158.5 42 166.5 43 187.0 44 197.5 45 208.0 46 229.5 47 219.0 48 202.0 49 198.0 50 178.0 51 142.0 52 137.0 53 130.5 54 110.0 55 101.0 56 104.0 57 104.0 58 78.5 59 72.5 60 79.0 61 64.5 62 58.0 63 59.5 64 49.0 65 42.0 66 37.0 67 29.5 68 20.5 69 13.5 70 7.0 71 6.0 72 5.5 73 2.0 74 1.0 75 1.0 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 42-43 1.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 1.0 64-65 1.0 66-67 1.0 68-69 2.0 70-71 2.0 72-73 2.0 74-75 1.0 76-77 3.0 78-79 0.0 80-81 2.0 82-83 6.0 84-85 8.0 86-87 6.0 88-89 9.0 90-91 14.0 92-93 6.0 94-95 11.0 96-97 50.0 98-99 369.0 100-101 3505.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.875 #Duplication Level Percentage of deduplicated Percentage of total 1 95.07246376811594 90.2 2 4.58498023715415 8.7 3 0.23715415019762848 0.675 4 0.07905138339920949 0.3 5 0.026350461133069828 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGAGAAATCTGGACGCCTTCGTTCCATGTACGCATTCTTCCCTTCTTTTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 849813 READS because READLEN < 1 Read 849813 spots for SRR12897253.sra Written 849813 spots for SRR12897253.sra Rejected 849813 READS because READLEN < 1 Read 849813 spots for SRR12897253.sra Written 849813 spots for SRR12897253.sra Rejected 849813 READS because READLEN < 1 Read 849813 spots for SRR12897253.sra Written 849813 spots for SRR12897253.sra Rejected 849813 READS because READLEN < 1 Read 849813 spots for SRR12897253.sra Written 849813 spots for SRR12897253.sra Rejected 849813 READS because READLEN < 1 Read 849813 spots for SRR12897253.sra Written 849813 spots for SRR12897253.sra Rejected 849813 READS because READLEN < 1 Read 849813 spots for SRR12897253.sra Written 849813 spots for SRR12897253.sra Rejected 849813 READS because READLEN < 1 Read 849813 spots for SRR12897253.sra Written 849813 spots for SRR12897253.sra Rejected 849813 READS because READLEN < 1 Read 849813 spots for SRR12897253.sra Written 849813 spots for SRR12897253.sra Rejected 849813 READS because READLEN < 1 Read 849813 spots for SRR12897253.sra Written 849813 spots for SRR12897253.sra Rejected 849813 READS because READLEN < 1 Read 849813 spots for SRR12897253.sra Written 849813 spots for SRR12897253.sra Rejected 849813 READS because READLEN < 1 Read 849813 spots for SRR12897253.sra Written 849813 spots for SRR12897253.sra Rejected 849820 READS because READLEN < 1 Read 849820 spots for SRR12897253.sra Written 849820 spots for SRR12897253.sra Rejected 849813 READS because READLEN < 1 Read 849813 spots for SRR12897253.sra Written 849813 spots for SRR12897253.sra Rejected 849813 READS because READLEN < 1 Read 849813 spots for SRR12897253.sra Written 849813 spots for SRR12897253.sra Rejected 849813 READS because READLEN < 1 Read 849813 spots for SRR12897253.sra Written 849813 spots for SRR12897253.sra Rejected 849813 READS because READLEN < 1 Read 849813 spots for SRR12897253.sra Written 849813 spots for SRR12897253.sra Rejected 849813 READS because READLEN < 1 Read 849813 spots for SRR12897253.sra Written 849813 spots for SRR12897253.sra Rejected 849813 READS because READLEN < 1 Read 849813 spots for SRR12897253.sra Written 849813 spots for SRR12897253.sra Rejected 849813 READS because READLEN < 1 Read 849813 spots for SRR12897253.sra Written 849813 spots for SRR12897253.sra Rejected 849813 READS because READLEN < 1 Read 849813 spots for SRR12897253.sra Written 849813 spots for SRR12897253.sra SRR ids: ['SRR12897253.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4q7qj_bh SRR12897253.sra spots: 16996267 blocks: [[1, 849813], [849814, 1699626], [1699627, 2549439], [2549440, 3399252], [3399253, 4249065], [4249066, 5098878], [5098879, 5948691], [5948692, 6798504], [6798505, 7648317], [7648318, 8498130], [8498131, 9347943], [9347944, 10197756], [10197757, 11047569], [11047570, 11897382], [11897383, 12747195], [12747196, 13597008], [13597009, 14446821], [14446822, 15296634], [15296635, 16146447], [16146448, 16996267]] SRR12897253 file size 4064418 SRR12897253 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12897253 SRR12897253_1.fastq Input file: SRR12897253_1.fastq trimmed: SRR12897253-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:16:48 2024 >> started Sat Dec 7 12:16:57 2024 >> done (8.784s) 16996267 reads processed; of these: 14 ( 0.00%) short reads filtered out after trimming by size control 1777 ( 0.01%) empty reads filtered out after trimming by size control 16994476 (99.99%) reads available; of these: 307 ( 0.00%) trimmed reads available after processing 16994169 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 1 0.00% 25 2 0.00% 26 0 0.00% 27 3 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 1 0.00% 32 2 0.00% 33 2 0.00% 34 1 0.00% 35 42 0.00% 36 59 0.00% 37 59 0.00% 38 61 0.00% 39 74 0.00% 40 84 0.00% 41 97 0.00% 42 102 0.00% 43 118 0.00% 44 126 0.00% 45 129 0.00% 46 152 0.00% 47 169 0.00% 48 231 0.00% 49 249 0.00% 50 314 0.00% 51 400 0.00% 52 360 0.00% 53 417 0.00% 54 478 0.00% 55 463 0.00% 56 529 0.00% 57 645 0.00% 58 712 0.00% 59 847 0.00% 60 978 0.01% 61 1107 0.01% 62 1223 0.01% 63 1412 0.01% 64 1563 0.01% 65 1646 0.01% 66 1886 0.01% 67 1990 0.01% 68 2179 0.01% 69 2621 0.02% 70 2892 0.02% 71 3408 0.02% 72 3962 0.02% 73 4395 0.03% 74 4909 0.03% 75 5539 0.03% 76 6188 0.04% 77 6624 0.04% 78 7417 0.04% 79 8153 0.05% 80 9065 0.05% 81 10232 0.06% 82 11403 0.07% 83 12798 0.08% 84 14390 0.08% 85 16218 0.10% 86 17385 0.10% 87 19136 0.11% 88 20759 0.12% 89 22248 0.13% 90 24338 0.14% 91 26947 0.16% 92 27643 0.16% 93 30542 0.18% 94 34243 0.20% 95 39002 0.23% 96 61054 0.36% 97 117661 0.69% 98 352641 2.08% 99 1152160 6.78% 100 3987879 23.47% 101 10909710 64.20% 16994476 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.90 fanout-score-rank=20 prefix-density=0.26 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=30 fanout-score=33.97 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=6.6 sequence=TTCTTGGCAGCCGCCTTGGTGACCTTGGCGCCGGTTGGGTCCTTCTTCTCC Started job on | Dec 07 12:17:11 Started mapping on | Dec 07 12:17:11 Finished on | Dec 07 12:17:28 Mapping speed, Million of reads per hour | 3598.83 Number of input reads | 16994476 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 16549186 Uniquely mapped reads % | 97.38% Average mapped length | 99.95 Number of splices: Total | 5981173 Number of splices: Annotated (sjdb) | 5684510 Number of splices: GT/AG | 5899177 Number of splices: GC/AG | 70551 Number of splices: AT/AC | 3285 Number of splices: Non-canonical | 8160 Mismatch rate per base, % | 0.17% Deletion rate per base | 0.01% Deletion average length | 2.29 Insertion rate per base | 0.01% Insertion average length | 1.74 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 281565 % of reads mapped to multiple loci | 1.66% Number of reads mapped to too many loci | 83142 % of reads mapped to too many loci | 0.49% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.46% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 163725 163725 163725 N_multimapping 281565 281565 281565 N_noFeature 655674 16177846 766302 N_ambiguous 290651 1353 30879 UnstrandedReadsAssigned:15602861 PositiveStrandReadsAssigned:369987 NegativeStrandReadsAssigned:15752005 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR12897253 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR12897253-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,994,476 reads, 15,892,003 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,143 rounds 52973 SRR12897253.ke.tsv 35125 SRR12897253.se.tsv 88098 total ==> SRR12897253.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 70.1217 9.2643 PNS24247 1044 945 38.129 4.46179 PNS24249 1928 1829 7.83353 0.47362 PNS24246 1044 945 38.129 4.46179 PNS24248 1044 945 38.129 4.46179 PNS24244 1471 1372 137.658 11.0951 PNS24243 293 194 0 0 KQK14069 1603 1504 1717.5 126.28 KQK14071 474 375 102.098 30.1072 ==> SRR12897253.se.tsv <== BRADI_1g14170v3 2160 BRADI_1g53295v3 44 BRADI_1g59795v3 412 BRADI_1g07683v3 0 BRADI_1g00485v3 52 BRADI_1g20270v3 2564 BRADI_1g74790v3 113 BRADI_1g09890v3 2 BRADI_1g77505v3 295 BRADI_1g48960v3 0 SRR12897253 completed mapping pipeline successfully