Starting /dee2/code/volunteer_pipeline.sh SRR12897254 current disk space = 1543138570240 free memory = 1601729824 SRR12897254 SRAfilesize b91418ce18f1e74935a59c1295fb41a0 SRR12897254.sra SRR12897254.sra file validated SRR12897254 is single end SRR12897254 is conventional basespace SRR12897254 read1 length is 54-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12897254_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 54-101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.66275 37.0 37.0 37.0 37.0 37.0 2 36.649 37.0 37.0 37.0 37.0 37.0 3 36.741 37.0 37.0 37.0 37.0 37.0 4 36.8 37.0 37.0 37.0 37.0 37.0 5 36.77 37.0 37.0 37.0 37.0 37.0 6 36.733 37.0 37.0 37.0 37.0 37.0 7 36.68 37.0 37.0 37.0 37.0 37.0 8 36.736 37.0 37.0 37.0 37.0 37.0 9 36.7485 37.0 37.0 37.0 37.0 37.0 10-11 36.725750000000005 37.0 37.0 37.0 37.0 37.0 12-13 36.7625 37.0 37.0 37.0 37.0 37.0 14-15 36.77275 37.0 37.0 37.0 37.0 37.0 16-17 36.72325 37.0 37.0 37.0 37.0 37.0 18-19 36.77475 37.0 37.0 37.0 37.0 37.0 20-21 36.73825 37.0 37.0 37.0 37.0 37.0 22-23 36.7405 37.0 37.0 37.0 37.0 37.0 24-25 36.7715 37.0 37.0 37.0 37.0 37.0 26-27 36.77175 37.0 37.0 37.0 37.0 37.0 28-29 36.707750000000004 37.0 37.0 37.0 37.0 37.0 30-31 36.72125 37.0 37.0 37.0 37.0 37.0 32-33 36.69575 37.0 37.0 37.0 37.0 37.0 34-35 36.70075 37.0 37.0 37.0 37.0 37.0 36-37 36.73675 37.0 37.0 37.0 37.0 37.0 38-39 36.701499999999996 37.0 37.0 37.0 37.0 37.0 40-41 36.71525 37.0 37.0 37.0 37.0 37.0 42-43 36.69725 37.0 37.0 37.0 37.0 37.0 44-45 36.691 37.0 37.0 37.0 37.0 37.0 46-47 36.703 37.0 37.0 37.0 37.0 37.0 48-49 36.701750000000004 37.0 37.0 37.0 37.0 37.0 50-51 36.6905 37.0 37.0 37.0 37.0 37.0 52-53 36.68475 37.0 37.0 37.0 37.0 37.0 54-55 36.62644979994999 37.0 37.0 37.0 37.0 37.0 56-57 36.70442610652663 37.0 37.0 37.0 37.0 37.0 58-59 36.69367341835459 37.0 37.0 37.0 37.0 37.0 60-61 36.6626656664166 37.0 37.0 37.0 37.0 37.0 62-63 36.63365841460365 37.0 37.0 37.0 37.0 37.0 64-65 36.6895947973987 37.0 37.0 37.0 37.0 37.0 66-67 36.5929447085314 37.0 37.0 37.0 37.0 37.0 68-69 36.61041032275708 37.0 37.0 37.0 37.0 37.0 70-71 36.63500112496655 37.0 37.0 37.0 37.0 37.0 72-73 36.65364441953511 37.0 37.0 37.0 37.0 37.0 74-75 36.666446769196455 37.0 37.0 37.0 37.0 37.0 76-77 36.63455444104517 37.0 37.0 37.0 37.0 37.0 78-79 36.65323293929296 37.0 37.0 37.0 37.0 37.0 80-81 36.6570351758794 37.0 37.0 37.0 37.0 37.0 82-83 36.621466459781935 37.0 37.0 37.0 37.0 37.0 84-85 36.64821323809931 37.0 37.0 37.0 37.0 37.0 86-87 36.64092241586001 37.0 37.0 37.0 37.0 37.0 88-89 36.66805893701279 37.0 37.0 37.0 37.0 37.0 90-91 36.613783416580205 37.0 37.0 37.0 37.0 37.0 92-93 36.593533950669546 37.0 37.0 37.0 37.0 37.0 94-95 36.59489948932501 37.0 37.0 37.0 37.0 37.0 96-97 36.62776466604926 37.0 37.0 37.0 37.0 37.0 98-99 36.57004515410278 37.0 37.0 37.0 37.0 37.0 100-101 36.57763484933811 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 1.0 26 3.0 27 4.0 28 3.0 29 7.0 30 11.0 31 15.0 32 14.0 33 23.0 34 42.0 35 103.0 36 2083.0 37 1690.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.0778083562672 10.157618213660244 4.778583937953465 47.98598949211909 2 19.125 13.700000000000001 38.800000000000004 28.375 3 18.25 15.775 25.4 40.575 4 23.95 23.35 22.8 29.9 5 24.675 28.9 25.074999999999996 21.349999999999998 6 22.85 30.525000000000002 23.95 22.675 7 17.5 24.675 40.1 17.724999999999998 8 19.875 22.400000000000002 32.95 24.775 9 18.85 21.85 33.900000000000006 25.4 10-11 22.375 30.412499999999998 23.3 23.9125 12-13 21.4875 24.3 27.6875 26.525 14-15 21.925 25.374999999999996 27.4125 25.2875 16-17 22.5625 26.2875 26.2625 24.887500000000003 18-19 21.925 26.3125 25.324999999999996 26.437500000000004 20-21 23.599999999999998 26.1625 25.637500000000003 24.6 22-23 22.625 26.1 26.3625 24.9125 24-25 22.650000000000002 25.9625 24.975 26.4125 26-27 22.8 25.874999999999996 26.525 24.8 28-29 23.275000000000002 25.937500000000004 26.025 24.762500000000003 30-31 21.8125 26.150000000000002 26.1625 25.874999999999996 32-33 22.0625 25.7625 26.0375 26.137500000000003 34-35 21.975 25.15 27.125 25.75 36-37 23.1375 24.725 25.9875 26.150000000000002 38-39 22.4625 25.2 26.174999999999997 26.1625 40-41 22.7375 25.8625 25.874999999999996 25.525 42-43 22.95 26.0 26.2625 24.7875 44-45 22.2625 26.025 25.95 25.7625 46-47 22.675 24.775 27.175 25.374999999999996 48-49 21.0625 25.9625 27.2625 25.7125 50-51 22.787499999999998 26.087500000000002 25.825 25.3 52-53 22.5875 25.924999999999997 25.5625 25.924999999999997 54-55 22.777847230903863 25.403175396924617 26.503312914114264 25.315664458057256 56-57 22.818204551137786 25.531382845711427 26.731682920730183 24.918729682420604 58-59 22.36809202300575 26.094023505876468 26.506626656664167 25.03125781445361 60-61 22.768192048012004 25.656414103525883 26.59414853713428 24.981245311327832 62-63 22.53063265816454 25.18129532383096 26.894223555888974 25.393848462115532 64-65 23.59929964982491 25.850425212606304 24.92496248124062 25.625312656328163 66-67 22.016512384288216 26.207155366524894 25.606705028771582 26.169627220415308 68-69 22.206931064681594 26.448142124358814 25.622419617165022 25.72250719379457 70-71 23.369633245712855 26.436349981224183 25.234697709350357 24.959319063712606 72-73 23.25319308790383 25.25669922364137 26.321061858251944 25.169045830202858 74-75 22.49091592532264 24.984337802280415 26.989099110387173 25.535647162009774 76-77 22.987208427389014 26.297968397291193 26.00953097567093 24.70529219964886 78-79 22.623979912115505 25.687382297551792 25.687382297551792 26.001255492780917 80-81 22.399497487437188 26.030150753768844 26.256281407035175 25.314070351758794 82-83 23.752670604499183 26.027397260273972 26.34158602488375 23.87834611034309 84-85 23.364368394564668 25.56618017111223 25.616507297433316 25.452944136889784 86-87 23.144765024568475 25.51341816807358 25.236235353408087 26.105581453949856 88-89 23.445579518224243 26.119308866187414 26.018413419094465 24.416698196493883 90-91 23.084690142622744 25.21772056039379 25.962387984349363 25.735201312634103 92-93 23.58442871587462 25.12639029322548 25.59403437815976 25.695146612740142 94-95 23.866227514568024 25.449708639473016 25.690397770458578 24.99366607550038 96-97 22.822631913541006 24.500953591862682 26.24284806102988 26.433566433566437 98-99 22.368079022615024 23.732778788666494 26.69612685209254 27.203015336625942 100-101 23.812611444318364 11.233587291295185 32.22564435078618 32.72815691360026 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 0.0 25 0.5 26 1.5 27 4.0 28 4.5 29 5.0 30 8.5 31 9.0 32 11.5 33 20.5 34 26.0 35 38.0 36 50.5 37 55.0 38 75.5 39 103.0 40 126.0 41 153.0 42 175.0 43 189.5 44 199.5 45 209.0 46 235.5 47 229.0 48 201.5 49 193.5 50 173.5 51 149.0 52 142.5 53 134.5 54 126.0 55 116.0 56 108.0 57 104.0 58 92.5 59 76.0 60 65.0 61 61.5 62 57.0 63 58.0 64 53.0 65 43.5 66 35.0 67 27.0 68 18.0 69 15.0 70 11.5 71 8.5 72 8.0 73 4.5 74 2.0 75 1.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 54 1.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 1.0 64 0.0 65 1.0 66 0.0 67 0.0 68 1.0 69 1.0 70 1.0 71 0.0 72 2.0 73 0.0 74 3.0 75 1.0 76 2.0 77 2.0 78 3.0 79 1.0 80 0.0 81 0.0 82 3.0 83 2.0 84 2.0 85 4.0 86 1.0 87 1.0 88 5.0 89 0.0 90 1.0 91 2.0 92 6.0 93 2.0 94 8.0 95 5.0 96 11.0 97 32.0 98 96.0 99 253.0 100 923.0 101 2623.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.975 #Duplication Level Percentage of deduplicated Percentage of total 1 94.06757116254323 88.4 2 5.480180899175313 10.299999999999999 3 0.4256451183825486 1.2 4 0.026602819898909287 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 947781 READS because READLEN < 1 Read 947781 spots for SRR12897254.sra Written 947781 spots for SRR12897254.sra Rejected 947781 READS because READLEN < 1 Read 947781 spots for SRR12897254.sra Written 947781 spots for SRR12897254.sra Rejected 947781 READS because READLEN < 1 Read 947781 spots for SRR12897254.sra Written 947781 spots for SRR12897254.sra Rejected 947781 READS because READLEN < 1 Read 947781 spots for SRR12897254.sra Written 947781 spots for SRR12897254.sra Rejected 947781 READS because READLEN < 1 Read 947781 spots for SRR12897254.sra Written 947781 spots for SRR12897254.sra Rejected 947781 READS because READLEN < 1 Read 947781 spots for SRR12897254.sra Written 947781 spots for SRR12897254.sra Rejected 947781 READS because READLEN < 1 Read 947781 spots for SRR12897254.sra Written 947781 spots for SRR12897254.sra Rejected 947781 READS because READLEN < 1 Read 947781 spots for SRR12897254.sra Written 947781 spots for SRR12897254.sra Rejected 947781 READS because READLEN < 1 Read 947781 spots for SRR12897254.sra Written 947781 spots for SRR12897254.sra Rejected 947793 READS because READLEN < 1 Read 947793 spots for SRR12897254.sra Written 947793 spots for SRR12897254.sra Rejected 947781 READS because READLEN < 1 Read 947781 spots for SRR12897254.sra Written 947781 spots for SRR12897254.sra Rejected 947781 READS because READLEN < 1 Read 947781 spots for SRR12897254.sra Written 947781 spots for SRR12897254.sra Rejected 947781 READS because READLEN < 1 Read 947781 spots for SRR12897254.sra Written 947781 spots for SRR12897254.sra Rejected 947781 READS because READLEN < 1 Read 947781 spots for SRR12897254.sra Written 947781 spots for SRR12897254.sra Rejected 947781 READS because READLEN < 1 Read 947781 spots for SRR12897254.sra Written 947781 spots for SRR12897254.sra Rejected 947781 READS because READLEN < 1 Read 947781 spots for SRR12897254.sra Written 947781 spots for SRR12897254.sra Rejected 947781 READS because READLEN < 1 Read 947781 spots for SRR12897254.sra Written 947781 spots for SRR12897254.sra Rejected 947781 READS because READLEN < 1 Read 947781 spots for SRR12897254.sra Written 947781 spots for SRR12897254.sra Rejected 947781 READS because READLEN < 1 Read 947781 spots for SRR12897254.sra Written 947781 spots for SRR12897254.sra Rejected 947781 READS because READLEN < 1 Read 947781 spots for SRR12897254.sra Written 947781 spots for SRR12897254.sra SRR ids: ['SRR12897254.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_d4vyyv8g SRR12897254.sra spots: 18955632 blocks: [[1, 947781], [947782, 1895562], [1895563, 2843343], [2843344, 3791124], [3791125, 4738905], [4738906, 5686686], [5686687, 6634467], [6634468, 7582248], [7582249, 8530029], [8530030, 9477810], [9477811, 10425591], [10425592, 11373372], [11373373, 12321153], [12321154, 13268934], [13268935, 14216715], [14216716, 15164496], [15164497, 16112277], [16112278, 17060058], [17060059, 18007839], [18007840, 18955632]] SRR12897254 file size 4541011 SRR12897254 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12897254 SRR12897254_1.fastq Input file: SRR12897254_1.fastq trimmed: SRR12897254-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:19:09 2024 >> started Sat Dec 7 12:19:19 2024 >> done (9.329s) 18955632 reads processed; of these: 5 ( 0.00%) short reads filtered out after trimming by size control 1676 ( 0.01%) empty reads filtered out after trimming by size control 18953951 (99.99%) reads available; of these: 241 ( 0.00%) trimmed reads available after processing 18953710 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 1 0.00% 23 1 0.00% 24 0 0.00% 25 0 0.00% 26 1 0.00% 27 0 0.00% 28 1 0.00% 29 0 0.00% 30 0 0.00% 31 2 0.00% 32 1 0.00% 33 0 0.00% 34 0 0.00% 35 39 0.00% 36 37 0.00% 37 44 0.00% 38 50 0.00% 39 58 0.00% 40 70 0.00% 41 86 0.00% 42 95 0.00% 43 71 0.00% 44 95 0.00% 45 95 0.00% 46 125 0.00% 47 120 0.00% 48 192 0.00% 49 189 0.00% 50 209 0.00% 51 247 0.00% 52 277 0.00% 53 298 0.00% 54 283 0.00% 55 331 0.00% 56 320 0.00% 57 424 0.00% 58 456 0.00% 59 566 0.00% 60 670 0.00% 61 760 0.00% 62 834 0.00% 63 903 0.00% 64 1039 0.01% 65 1046 0.01% 66 1191 0.01% 67 1345 0.01% 68 1558 0.01% 69 1714 0.01% 70 1956 0.01% 71 2303 0.01% 72 2499 0.01% 73 2830 0.01% 74 3186 0.02% 75 3656 0.02% 76 4051 0.02% 77 4574 0.02% 78 4982 0.03% 79 5635 0.03% 80 6222 0.03% 81 6893 0.04% 82 8012 0.04% 83 8821 0.05% 84 10181 0.05% 85 11406 0.06% 86 12338 0.07% 87 13505 0.07% 88 15195 0.08% 89 16129 0.09% 90 17852 0.09% 91 20157 0.11% 92 20540 0.11% 93 23205 0.12% 94 26367 0.14% 95 31061 0.16% 96 54612 0.29% 97 116610 0.62% 98 377665 1.99% 99 1274568 6.72% 100 4469710 23.58% 101 12361385 65.22% 18953951 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.71 fanout-score-rank=15 prefix-density=0.40 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=22 fanout-score=19.58 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=2.0 sequence=TGTTGTCGAAGTCGTACTTCCTTAGGCCCTGGCTGATGTACTCTTGGGAGCTGAGGACGGCCACGTGGGTACCGTCGCCCATGGGCGCCTGGAAGAGCGAGTCGACGATACCCTTCCCCCTGGTGATGTCCTGCTGGTCGTCGGAGATATCGTAGGCGAGGCCCTTCCACCTGTCCTGGTCAGTCTGCTTTGACTCGTCCACCTCCTTGGCCATGACTGTGAATCTGTTGGCCTTGGTGCTCTTGCCATGGTAGTTCACGGCCGAGGTCACCTGCTTCTTGAGCTTCTTCCCAAGGAAGCTGGTTGGCGTAGAAGCCGGAGCTCCGACGGTGGACGAGAAGGTAGCAGACATCTCTGCTCTGC Started job on | Dec 07 12:19:38 Started mapping on | Dec 07 12:19:38 Finished on | Dec 07 12:19:55 Mapping speed, Million of reads per hour | 4013.78 Number of input reads | 18953951 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 18480329 Uniquely mapped reads % | 97.50% Average mapped length | 100.09 Number of splices: Total | 6584737 Number of splices: Annotated (sjdb) | 6258844 Number of splices: GT/AG | 6493012 Number of splices: GC/AG | 79357 Number of splices: AT/AC | 3137 Number of splices: Non-canonical | 9231 Mismatch rate per base, % | 0.17% Deletion rate per base | 0.01% Deletion average length | 2.33 Insertion rate per base | 0.01% Insertion average length | 1.75 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 301687 % of reads mapped to multiple loci | 1.59% Number of reads mapped to too many loci | 79680 % of reads mapped to too many loci | 0.42% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.47% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 171935 171935 171935 N_multimapping 301687 301687 301687 N_noFeature 765533 18065412 885180 N_ambiguous 330910 1400 36797 UnstrandedReadsAssigned:17383886 PositiveStrandReadsAssigned:413517 NegativeStrandReadsAssigned:17558352 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR12897254 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR12897254-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,953,951 reads, 17,702,986 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,205 rounds 52973 SRR12897254.ke.tsv 35125 SRR12897254.se.tsv 88098 total ==> SRR12897254.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 94.8852 11.2047 PNS24247 1044 945 45.9968 4.81086 PNS24249 1928 1829 23.8768 1.2903 PNS24246 1044 945 45.9968 4.81086 PNS24248 1044 945 45.9968 4.81086 PNS24244 1471 1372 121.248 8.73467 PNS24243 293 194 0 0 KQK14069 1603 1504 1862.74 122.414 KQK14071 474 375 135.808 35.7949 ==> SRR12897254.se.tsv <== BRADI_1g14170v3 2309 BRADI_1g53295v3 85 BRADI_1g59795v3 484 BRADI_1g07683v3 0 BRADI_1g00485v3 46 BRADI_1g20270v3 2529 BRADI_1g74790v3 124 BRADI_1g09890v3 0 BRADI_1g77505v3 334 BRADI_1g48960v3 0 SRR12897254 completed mapping pipeline successfully