Starting /dee2/code/volunteer_pipeline.sh SRR12897255 current disk space = 1543142903808 free memory = 1479034920 SRR12897255 SRAfilesize f04a782c59f0bd838fd5c977ddb4bcb5 SRR12897255.sra SRR12897255.sra file validated SRR12897255 is single end SRR12897255 is conventional basespace SRR12897255 read1 length is 62-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12897255_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 62-101 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6825 37.0 37.0 37.0 37.0 37.0 2 36.6775 37.0 37.0 37.0 37.0 37.0 3 36.743 37.0 37.0 37.0 37.0 37.0 4 36.748 37.0 37.0 37.0 37.0 37.0 5 36.7255 37.0 37.0 37.0 37.0 37.0 6 36.7075 37.0 37.0 37.0 37.0 37.0 7 36.702 37.0 37.0 37.0 37.0 37.0 8 36.7655 37.0 37.0 37.0 37.0 37.0 9 36.6735 37.0 37.0 37.0 37.0 37.0 10-11 36.75625 37.0 37.0 37.0 37.0 37.0 12-13 36.724500000000006 37.0 37.0 37.0 37.0 37.0 14-15 36.7525 37.0 37.0 37.0 37.0 37.0 16-17 36.762 37.0 37.0 37.0 37.0 37.0 18-19 36.7695 37.0 37.0 37.0 37.0 37.0 20-21 36.742 37.0 37.0 37.0 37.0 37.0 22-23 36.79575 37.0 37.0 37.0 37.0 37.0 24-25 36.72475 37.0 37.0 37.0 37.0 37.0 26-27 36.67425 37.0 37.0 37.0 37.0 37.0 28-29 36.7355 37.0 37.0 37.0 37.0 37.0 30-31 36.7155 37.0 37.0 37.0 37.0 37.0 32-33 36.6385 37.0 37.0 37.0 37.0 37.0 34-35 36.770250000000004 37.0 37.0 37.0 37.0 37.0 36-37 36.68875 37.0 37.0 37.0 37.0 37.0 38-39 36.68375 37.0 37.0 37.0 37.0 37.0 40-41 36.6885 37.0 37.0 37.0 37.0 37.0 42-43 36.6875 37.0 37.0 37.0 37.0 37.0 44-45 36.67075 37.0 37.0 37.0 37.0 37.0 46-47 36.67775 37.0 37.0 37.0 37.0 37.0 48-49 36.7425 37.0 37.0 37.0 37.0 37.0 50-51 36.66775 37.0 37.0 37.0 37.0 37.0 52-53 36.6635 37.0 37.0 37.0 37.0 37.0 54-55 36.68875 37.0 37.0 37.0 37.0 37.0 56-57 36.66775 37.0 37.0 37.0 37.0 37.0 58-59 36.653999999999996 37.0 37.0 37.0 37.0 37.0 60-61 36.658 37.0 37.0 37.0 37.0 37.0 62-63 36.64820948987247 37.0 37.0 37.0 37.0 37.0 64-65 36.673168292073015 37.0 37.0 37.0 37.0 37.0 66-67 36.61715428857214 37.0 37.0 37.0 37.0 37.0 68-69 36.66591647911978 37.0 37.0 37.0 37.0 37.0 70-71 36.6514128532133 37.0 37.0 37.0 37.0 37.0 72-73 36.60815203800951 37.0 37.0 37.0 37.0 37.0 74-75 36.632887682031864 37.0 37.0 37.0 37.0 37.0 76-77 36.59989984977466 37.0 37.0 37.0 37.0 37.0 78-79 36.5782015445868 37.0 37.0 37.0 37.0 37.0 80-81 36.55098972688549 37.0 37.0 37.0 37.0 37.0 82-83 36.57689064727499 37.0 37.0 37.0 37.0 37.0 84-85 36.621622731001416 37.0 37.0 37.0 37.0 37.0 86-87 36.594480597597624 37.0 37.0 37.0 37.0 37.0 88-89 36.62187108577578 37.0 37.0 37.0 37.0 37.0 90-91 36.61117475282887 37.0 37.0 37.0 37.0 37.0 92-93 36.56166620822445 37.0 37.0 37.0 37.0 37.0 94-95 36.55751841706338 37.0 37.0 37.0 37.0 37.0 96-97 36.57980892768266 37.0 37.0 37.0 37.0 37.0 98-99 36.62494371883518 37.0 37.0 37.0 37.0 37.0 100-101 36.56724504136564 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 1.0 26 3.0 27 8.0 28 4.0 29 8.0 30 11.0 31 13.0 32 22.0 33 23.0 34 46.0 35 91.0 36 2074.0 37 1696.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.57836755132699 10.515773660490737 5.057586379569353 48.84827240861292 2 18.5 12.825000000000001 39.375 29.299999999999997 3 18.925 15.975 25.374999999999996 39.725 4 24.75 22.7 22.650000000000002 29.9 5 25.724999999999998 28.325 24.075 21.875 6 21.7 31.65 23.425 23.225 7 18.099999999999998 24.25 37.8 19.85 8 19.475 22.45 32.25 25.825 9 19.35 19.475 36.075 25.1 10-11 22.375 30.6875 23.799999999999997 23.1375 12-13 21.95 24.5125 27.474999999999998 26.0625 14-15 22.0 25.025 27.4125 25.5625 16-17 23.0 24.725 26.900000000000002 25.374999999999996 18-19 22.0 26.0625 26.237500000000004 25.7 20-21 23.05 24.6875 26.424999999999997 25.837500000000002 22-23 22.85 25.412499999999998 26.924999999999997 24.8125 24-25 23.225 26.1125 25.424999999999997 25.2375 26-27 22.6125 24.762500000000003 27.0625 25.5625 28-29 22.775000000000002 24.575 26.8125 25.837500000000002 30-31 23.025000000000002 24.474999999999998 26.224999999999998 26.275 32-33 23.400000000000002 24.875 26.3625 25.362499999999997 34-35 22.925 25.1875 26.05 25.837500000000002 36-37 23.3625 25.162499999999998 25.35 26.125 38-39 22.9375 25.7125 26.1 25.25 40-41 23.3375 25.775 24.8625 26.025 42-43 22.8125 26.5375 24.875 25.775 44-45 21.9625 25.362499999999997 26.825 25.85 46-47 23.2625 25.412499999999998 26.275 25.05 48-49 22.3125 26.025 25.0375 26.625 50-51 23.4875 24.95 26.275 25.2875 52-53 23.05 25.224999999999998 25.525 26.200000000000003 54-55 22.7125 25.337500000000002 26.5 25.45 56-57 22.525000000000002 24.65 26.674999999999997 26.150000000000002 58-59 22.025 24.525 27.0 26.450000000000003 60-61 22.975 24.75 26.087500000000002 26.187500000000004 62-63 23.002875359419928 25.315664458057256 26.16577072134017 25.51568946118265 64-65 23.243310827706924 24.968742185546386 26.644161040260066 25.143785946486624 66-67 23.25581395348837 25.618904726181547 25.693923480870218 25.431357839459867 68-69 23.868467116779193 25.168792198049513 24.918729682420604 26.04401100275069 70-71 22.780695173793447 26.16904226056514 25.818954738684667 25.23130782695674 72-73 23.50587646911728 25.44386096524131 25.131282820705174 25.918979744936234 74-75 23.823823823823822 24.81231231231231 25.775775775775777 25.58808808808809 76-77 23.647971957936907 26.4021031547321 24.42413620430646 25.525788683024537 78-79 22.76768941765811 25.30995616781465 25.38509705698184 26.537257357545396 80-81 23.37759959909797 26.87296416938111 24.693059383613132 25.056376847907792 82-83 23.398922170698082 25.02819902243389 26.419350795839076 25.153528011028953 84-85 23.66077029230962 24.99059089198344 25.969138125705683 25.379500690001255 86-87 23.666038920276208 25.14752040175769 25.072190834902695 26.1142498430634 88-89 22.489000628535514 25.845380263984914 25.405405405405407 26.26021370207417 90-91 23.734575673633845 25.044069503903298 25.673633845378994 25.54772097708386 92-93 23.580620741862226 25.082008579359073 25.359576078728235 25.97779460005047 94-95 23.438685208596713 26.10619469026549 25.777496839443742 24.67762326169406 96-97 23.735260555344237 24.711550652973248 24.470647901610246 27.08254089007227 98-99 23.698824744930906 24.331654397520342 26.979207025700635 24.99031383184812 100-101 24.37041759642971 11.444054829454894 32.59483583041122 31.590691743704173 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.5 25 2.5 26 1.5 27 1.5 28 4.0 29 5.0 30 5.5 31 12.0 32 16.5 33 22.0 34 26.5 35 30.0 36 45.5 37 67.0 38 80.0 39 85.0 40 107.5 41 146.5 42 180.0 43 196.5 44 210.0 45 204.5 46 194.0 47 219.5 48 207.0 49 171.0 50 150.5 51 140.0 52 134.0 53 126.5 54 126.0 55 128.5 56 123.0 57 105.0 58 85.0 59 78.5 60 85.5 61 82.0 62 69.0 63 52.0 64 48.5 65 52.0 66 52.5 67 38.5 68 29.0 69 25.0 70 17.5 71 12.0 72 7.0 73 5.0 74 1.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 62 1.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 2.0 74 2.0 75 1.0 76 0.0 77 1.0 78 1.0 79 1.0 80 0.0 81 1.0 82 1.0 83 3.0 84 1.0 85 1.0 86 3.0 87 2.0 88 3.0 89 2.0 90 6.0 91 2.0 92 6.0 93 2.0 94 6.0 95 5.0 96 7.0 97 33.0 98 71.0 99 255.0 100 888.0 101 2693.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.45 #Duplication Level Percentage of deduplicated Percentage of total 1 94.67972472207518 89.425 2 4.817363684489147 9.1 3 0.4499735309687666 1.275 4 0.05293806246691372 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 972934 READS because READLEN < 1 Read 972934 spots for SRR12897255.sra Written 972934 spots for SRR12897255.sra Rejected 972934 READS because READLEN < 1 Read 972934 spots for SRR12897255.sra Written 972934 spots for SRR12897255.sra Rejected 972934 READS because READLEN < 1 Read 972934 spots for SRR12897255.sra Written 972934 spots for SRR12897255.sra Rejected 972934 READS because READLEN < 1 Read 972934 spots for SRR12897255.sra Written 972934 spots for SRR12897255.sra Rejected 972934 READS because READLEN < 1 Read 972934 spots for SRR12897255.sra Written 972934 spots for SRR12897255.sra Rejected 972937 READS because READLEN < 1 Read 972937 spots for SRR12897255.sra Written 972937 spots for SRR12897255.sra Rejected 972934 READS because READLEN < 1 Read 972934 spots for SRR12897255.sra Written 972934 spots for SRR12897255.sra Rejected 972934 READS because READLEN < 1 Read 972934 spots for SRR12897255.sra Written 972934 spots for SRR12897255.sra Rejected 972934 READS because READLEN < 1 Read 972934 spots for SRR12897255.sra Written 972934 spots for SRR12897255.sra Rejected 972934 READS because READLEN < 1 Read 972934 spots for SRR12897255.sra Written 972934 spots for SRR12897255.sra Rejected 972934 READS because READLEN < 1 Read 972934 spots for SRR12897255.sra Written 972934 spots for SRR12897255.sra Rejected 972934 READS because READLEN < 1 Read 972934 spots for SRR12897255.sra Written 972934 spots for SRR12897255.sra Rejected 972934 READS because READLEN < 1 Read 972934 spots for SRR12897255.sra Written 972934 spots for SRR12897255.sra Rejected 972934 READS because READLEN < 1 Read 972934 spots for SRR12897255.sra Written 972934 spots for SRR12897255.sra Rejected 972934 READS because READLEN < 1 Read 972934 spots for SRR12897255.sra Written 972934 spots for SRR12897255.sra Rejected 972934 READS because READLEN < 1 Read 972934 spots for SRR12897255.sra Written 972934 spots for SRR12897255.sra Rejected 972934 READS because READLEN < 1 Read 972934 spots for SRR12897255.sra Written 972934 spots for SRR12897255.sra Rejected 972934 READS because READLEN < 1 Read 972934 spots for SRR12897255.sra Written 972934 spots for SRR12897255.sra Rejected 972934 READS because READLEN < 1 Read 972934 spots for SRR12897255.sra Written 972934 spots for SRR12897255.sra Rejected 972934 READS because READLEN < 1 Read 972934 spots for SRR12897255.sra Written 972934 spots for SRR12897255.sra SRR ids: ['SRR12897255.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_40mfyin9 SRR12897255.sra spots: 19458683 blocks: [[1, 972934], [972935, 1945868], [1945869, 2918802], [2918803, 3891736], [3891737, 4864670], [4864671, 5837604], [5837605, 6810538], [6810539, 7783472], [7783473, 8756406], [8756407, 9729340], [9729341, 10702274], [10702275, 11675208], [11675209, 12648142], [12648143, 13621076], [13621077, 14594010], [14594011, 15566944], [15566945, 16539878], [16539879, 17512812], [17512813, 18485746], [18485747, 19458683]] SRR12897255 file size 4662529 SRR12897255 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12897255 SRR12897255_1.fastq Input file: SRR12897255_1.fastq trimmed: SRR12897255-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:21:53 2024 >> started Sat Dec 7 12:22:52 2024 >> done (58.600s) 19458683 reads processed; of these: 3 ( 0.00%) short reads filtered out after trimming by size control 1851 ( 0.01%) empty reads filtered out after trimming by size control 19456829 (99.99%) reads available; of these: 193 ( 0.00%) trimmed reads available after processing 19456636 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 21 1 0.00% 22 0 0.00% 23 1 0.00% 24 0 0.00% 25 2 0.00% 26 0 0.00% 27 0 0.00% 28 1 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 1 0.00% 33 1 0.00% 34 0 0.00% 35 44 0.00% 36 37 0.00% 37 45 0.00% 38 49 0.00% 39 59 0.00% 40 82 0.00% 41 70 0.00% 42 72 0.00% 43 88 0.00% 44 71 0.00% 45 89 0.00% 46 122 0.00% 47 144 0.00% 48 165 0.00% 49 180 0.00% 50 206 0.00% 51 253 0.00% 52 233 0.00% 53 289 0.00% 54 311 0.00% 55 307 0.00% 56 321 0.00% 57 417 0.00% 58 441 0.00% 59 528 0.00% 60 668 0.00% 61 764 0.00% 62 834 0.00% 63 983 0.01% 64 987 0.01% 65 1089 0.01% 66 1177 0.01% 67 1328 0.01% 68 1521 0.01% 69 1704 0.01% 70 1887 0.01% 71 2206 0.01% 72 2552 0.01% 73 2900 0.01% 74 3263 0.02% 75 3684 0.02% 76 4064 0.02% 77 4401 0.02% 78 5026 0.03% 79 5522 0.03% 80 6218 0.03% 81 7169 0.04% 82 8060 0.04% 83 9058 0.05% 84 10362 0.05% 85 11541 0.06% 86 12561 0.06% 87 13647 0.07% 88 15327 0.08% 89 16087 0.08% 90 17897 0.09% 91 20391 0.10% 92 20539 0.11% 93 23589 0.12% 94 26764 0.14% 95 31181 0.16% 96 54875 0.28% 97 116604 0.60% 98 379084 1.95% 99 1303326 6.70% 100 4527714 23.27% 101 12773645 65.65% 19456829 reads passed initial QC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=2.68 fanout-score-rank=16 prefix-density=0.57 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=24.54 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.5 sequence=GAAGAACAAAGATGCCCGGATTCATCTCACAAATAACCGAGGGATATTACACAAACACCATCTTTAGTGTACAACACCAACTCCTCATCTCTGACTTTCACATGCAACATCTATCAGTCCTGACTCCTGACTCAATCTCGACACATGCAGCAGCATCCATCATCAACAATGACGTCGTCGGCCAAGCGCCTCAGCATAGAGCAGGCGCTGGAGCTTGCTAACTAAGCTCACTTGCCGGGG Started job on | Dec 07 12:24:53 Started mapping on | Dec 07 12:24:54 Finished on | Dec 07 12:27:02 Mapping speed, Million of reads per hour | 547.22 Number of input reads | 19456829 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 18962451 Uniquely mapped reads % | 97.46% Average mapped length | 100.10 Number of splices: Total | 6621945 Number of splices: Annotated (sjdb) | 6283877 Number of splices: GT/AG | 6529858 Number of splices: GC/AG | 79910 Number of splices: AT/AC | 2462 Number of splices: Non-canonical | 9715 Mismatch rate per base, % | 0.17% Deletion rate per base | 0.01% Deletion average length | 2.39 Insertion rate per base | 0.01% Insertion average length | 1.79 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 302347 % of reads mapped to multiple loci | 1.55% Number of reads mapped to too many loci | 97587 % of reads mapped to too many loci | 0.50% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.47% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 192031 192031 192031 N_multimapping 302347 302347 302347 N_noFeature 766012 18515243 891760 N_ambiguous 360236 1303 40231 UnstrandedReadsAssigned:17836203 PositiveStrandReadsAssigned:445905 NegativeStrandReadsAssigned:18030460 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR12897255 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR12897255-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,456,829 reads, 18,141,803 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,263 rounds 52973 SRR12897255.ke.tsv 35125 SRR12897255.se.tsv 88098 total ==> SRR12897255.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 57.0179 6.44092 PNS24247 1044 945 55.5339 5.55633 PNS24249 1928 1829 18.3579 0.949011 PNS24246 1044 945 55.5339 5.55633 PNS24248 1044 945 55.5339 5.55633 PNS24244 1471 1372 100.023 6.89297 PNS24243 293 194 0 0 KQK14069 1603 1504 2995.76 188.331 KQK14071 474 375 283.459 71.4696 ==> SRR12897255.se.tsv <== BRADI_1g14170v3 3835 BRADI_1g53295v3 91 BRADI_1g59795v3 457 BRADI_1g07683v3 0 BRADI_1g00485v3 20 BRADI_1g20270v3 1141 BRADI_1g74790v3 176 BRADI_1g09890v3 0 BRADI_1g77505v3 230 BRADI_1g48960v3 0 SRR12897255 completed mapping pipeline successfully