Starting /dee2/code/volunteer_pipeline.sh SRR12897256 current disk space = 1543170428928 free memory = 1598955352 SRR12897256 SRAfilesize f20c78bf85e9b3a33152c696940658fb SRR12897256.sra SRR12897256.sra file validated SRR12897256 is single end SRR12897256 is conventional basespace SRR12897256 read1 length is 52-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12897256_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52-101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6335 37.0 37.0 37.0 37.0 37.0 2 36.6075 37.0 37.0 37.0 37.0 37.0 3 36.7245 37.0 37.0 37.0 37.0 37.0 4 36.7235 37.0 37.0 37.0 37.0 37.0 5 36.708 37.0 37.0 37.0 37.0 37.0 6 36.7175 37.0 37.0 37.0 37.0 37.0 7 36.7745 37.0 37.0 37.0 37.0 37.0 8 36.704 37.0 37.0 37.0 37.0 37.0 9 36.691 37.0 37.0 37.0 37.0 37.0 10-11 36.7535 37.0 37.0 37.0 37.0 37.0 12-13 36.699 37.0 37.0 37.0 37.0 37.0 14-15 36.68825 37.0 37.0 37.0 37.0 37.0 16-17 36.706 37.0 37.0 37.0 37.0 37.0 18-19 36.741249999999994 37.0 37.0 37.0 37.0 37.0 20-21 36.745000000000005 37.0 37.0 37.0 37.0 37.0 22-23 36.67575 37.0 37.0 37.0 37.0 37.0 24-25 36.67375 37.0 37.0 37.0 37.0 37.0 26-27 36.69075 37.0 37.0 37.0 37.0 37.0 28-29 36.679249999999996 37.0 37.0 37.0 37.0 37.0 30-31 36.67275 37.0 37.0 37.0 37.0 37.0 32-33 36.64149999999999 37.0 37.0 37.0 37.0 37.0 34-35 36.68375 37.0 37.0 37.0 37.0 37.0 36-37 36.608000000000004 37.0 37.0 37.0 37.0 37.0 38-39 36.6735 37.0 37.0 37.0 37.0 37.0 40-41 36.6555 37.0 37.0 37.0 37.0 37.0 42-43 36.617 37.0 37.0 37.0 37.0 37.0 44-45 36.6365 37.0 37.0 37.0 37.0 37.0 46-47 36.6425 37.0 37.0 37.0 37.0 37.0 48-49 36.64025 37.0 37.0 37.0 37.0 37.0 50-51 36.62949999999999 37.0 37.0 37.0 37.0 37.0 52-53 36.63845342585647 37.0 37.0 37.0 37.0 37.0 54-55 36.634908727181795 37.0 37.0 37.0 37.0 37.0 56-57 36.62140535133783 37.0 37.0 37.0 37.0 37.0 58-59 36.59839959989998 37.0 37.0 37.0 37.0 37.0 60-61 36.599399849962495 37.0 37.0 37.0 37.0 37.0 62-63 36.6029007251813 37.0 37.0 37.0 37.0 37.0 64-65 36.607401850462615 37.0 37.0 37.0 37.0 37.0 66-67 36.64916229057265 37.0 37.0 37.0 37.0 37.0 68-69 36.58104052026013 37.0 37.0 37.0 37.0 37.0 70-71 36.62952160343369 37.0 37.0 37.0 37.0 37.0 72-73 36.585038355000805 37.0 37.0 37.0 37.0 37.0 74-75 36.577060243508264 37.0 37.0 37.0 37.0 37.0 76-77 36.645158938438556 37.0 37.0 37.0 37.0 37.0 78-79 36.564083270629546 37.0 37.0 37.0 37.0 37.0 80-81 36.55239090296476 37.0 37.0 37.0 37.0 37.0 82-83 36.5457025566394 37.0 37.0 37.0 37.0 37.0 84-85 36.584018459911015 37.0 37.0 37.0 37.0 37.0 86-87 36.52094007538815 37.0 37.0 37.0 37.0 37.0 88-89 36.57942820460232 37.0 37.0 37.0 37.0 37.0 90-91 36.567852363464 37.0 37.0 37.0 37.0 37.0 92-93 36.58812535634918 37.0 37.0 37.0 37.0 37.0 94-95 36.50426080439638 37.0 37.0 37.0 37.0 37.0 96-97 36.53651725870712 37.0 37.0 37.0 37.0 37.0 98-99 36.55416027533826 37.0 37.0 37.0 37.0 37.0 100-101 36.44817083560523 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 3.0 25 0.0 26 1.0 27 6.0 28 9.0 29 7.0 30 12.0 31 20.0 32 28.0 33 31.0 34 48.0 35 96.0 36 2066.0 37 1672.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.1415707853927 9.37968984492246 4.977488744372186 52.50125062531266 2 17.349999999999998 13.15 42.25 27.250000000000004 3 17.775 15.575 26.950000000000003 39.7 4 24.575 23.724999999999998 22.7 28.999999999999996 5 25.6 29.2 24.375 20.825 6 21.975 32.725 24.2 21.099999999999998 7 17.5 22.275 40.45 19.775000000000002 8 20.3 22.1 31.874999999999996 25.724999999999998 9 19.0 20.8 35.575 24.625 10-11 23.200000000000003 29.25 23.4125 24.1375 12-13 21.7375 23.7125 27.437499999999996 27.1125 14-15 21.987499999999997 24.375 26.825 26.8125 16-17 23.2625 25.7125 25.912499999999998 25.112499999999997 18-19 21.762500000000003 25.5125 26.2875 26.437500000000004 20-21 23.0875 25.8 25.412499999999998 25.7 22-23 22.425 25.424999999999997 27.1 25.05 24-25 21.9 26.1625 25.637500000000003 26.3 26-27 22.1875 25.5625 26.1 26.150000000000002 28-29 23.2125 25.7875 26.174999999999997 24.825 30-31 22.0875 26.125 25.575 26.2125 32-33 22.4875 25.25 26.637499999999996 25.624999999999996 34-35 21.975 26.887499999999996 25.35 25.7875 36-37 23.1 25.35 25.624999999999996 25.924999999999997 38-39 22.787499999999998 26.450000000000003 25.5 25.2625 40-41 22.5125 26.8125 25.587500000000002 25.087500000000002 42-43 22.6 25.775 25.7 25.924999999999997 44-45 22.5625 25.5 26.55 25.387500000000003 46-47 22.1 26.0 26.7625 25.137500000000003 48-49 21.95 25.837500000000002 26.224999999999998 25.9875 50-51 23.025000000000002 25.2875 26.0125 25.674999999999997 52-53 23.702962870358796 25.390673834229275 26.340792599074884 24.56557069633704 54-55 22.455613903475868 25.71892973243311 25.418854713678417 26.406601650412604 56-57 21.6929232308077 25.881470367591895 25.668917229307326 26.756689172293076 58-59 23.20580145036259 26.356589147286826 25.09377344336084 25.343835958989747 60-61 22.093023255813954 25.618904726181547 26.144036009002253 26.144036009002253 62-63 22.305576394098527 24.981245311327832 26.544136034008503 26.16904226056514 64-65 23.15578894723681 26.669167291822955 25.543885971492873 24.63115778944736 66-67 22.53063265816454 26.156539134783696 24.3935983995999 26.91922980745186 68-69 21.885942971485743 26.413206603301653 26.750875437718857 24.949974987493746 70-71 22.789243277048154 26.00375234521576 25.453408380237647 25.753595997498437 72-73 23.000875985483667 26.21699411838318 24.94055812789388 25.84157176823927 74-75 22.51158131964442 26.09240015024415 25.97971704019031 25.41630148992112 76-77 22.866808670592658 25.422879338428768 26.751033705049494 24.95927828592908 78-79 22.87434161023326 25.332330072736394 25.470278404815648 26.323049912214696 80-81 23.108769288671436 25.341864257935015 25.831137874796134 25.71822857859741 82-83 23.32998493219488 25.904068307383227 25.41436464088398 25.35158211953792 84-85 22.734699007163503 25.524695236898324 25.135101168782203 26.605504587155966 86-87 22.20405082400302 25.6132846898981 26.997106554283555 25.18555793181532 88-89 22.36361345596573 25.22363613455966 27.000125992188483 25.41262441728613 90-91 22.47729566094854 24.646821392532793 26.034308779011102 26.84157416750757 92-93 22.752525252525253 25.189393939393938 26.212121212121215 25.845959595959595 94-95 23.798076923076923 25.69585020242915 25.126518218623485 25.379554655870447 96-97 23.55708110856852 25.514874141876433 25.438596491228072 25.489448258326973 98-99 23.87654958677686 24.62551652892562 26.291322314049587 25.206611570247933 100-101 24.46808510638298 11.686009026434558 32.09219858156028 31.75370728562218 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.5 27 2.0 28 1.5 29 3.5 30 5.5 31 7.0 32 11.0 33 17.0 34 22.5 35 33.5 36 46.5 37 70.0 38 92.0 39 95.5 40 117.0 41 143.0 42 158.5 43 187.5 44 202.0 45 220.0 46 235.5 47 230.0 48 204.5 49 180.5 50 173.5 51 158.5 52 147.5 53 136.5 54 127.0 55 121.5 56 117.5 57 101.5 58 86.0 59 81.5 60 73.0 61 63.5 62 56.5 63 61.0 64 55.0 65 43.0 66 38.0 67 23.0 68 17.5 69 15.5 70 11.0 71 7.0 72 2.0 73 1.5 74 2.0 75 1.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 52-53 1.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 1.0 68-69 0.0 70-71 2.0 72-73 2.0 74-75 3.0 76-77 4.0 78-79 0.0 80-81 4.0 82-83 4.0 84-85 3.0 86-87 6.0 88-89 4.0 90-91 5.0 92-93 6.0 94-95 16.0 96-97 30.0 98-99 325.0 100-101 3584.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.75 #Duplication Level Percentage of deduplicated Percentage of total 1 94.77572559366754 89.8 2 4.907651715039578 9.3 3 0.31662269129287596 0.8999999999999999 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 861327 READS because READLEN < 1 Read 861327 spots for SRR12897256.sra Written 861327 spots for SRR12897256.sra Rejected 861327 READS because READLEN < 1 Read 861327 spots for SRR12897256.sra Written 861327 spots for SRR12897256.sra Rejected 861327 READS because READLEN < 1 Read 861327 spots for SRR12897256.sra Written 861327 spots for SRR12897256.sra Rejected 861338 READS because READLEN < 1 Read 861338 spots for SRR12897256.sra Written 861338 spots for SRR12897256.sra Rejected 861327 READS because READLEN < 1 Read 861327 spots for SRR12897256.sra Written 861327 spots for SRR12897256.sra Rejected 861327 READS because READLEN < 1 Read 861327 spots for SRR12897256.sra Written 861327 spots for SRR12897256.sra Rejected 861327 READS because READLEN < 1 Read 861327 spots for SRR12897256.sra Written 861327 spots for SRR12897256.sra Rejected 861327 READS because READLEN < 1 Read 861327 spots for SRR12897256.sra Written 861327 spots for SRR12897256.sra Rejected 861327 READS because READLEN < 1 Read 861327 spots for SRR12897256.sra Written 861327 spots for SRR12897256.sra Rejected 861327 READS because READLEN < 1 Read 861327 spots for SRR12897256.sra Written 861327 spots for SRR12897256.sra Rejected 861327 READS because READLEN < 1 Read 861327 spots for SRR12897256.sra Written 861327 spots for SRR12897256.sra Rejected 861327 READS because READLEN < 1 Read 861327 spots for SRR12897256.sra Written 861327 spots for SRR12897256.sra Rejected 861327 READS because READLEN < 1 Read 861327 spots for SRR12897256.sra Written 861327 spots for SRR12897256.sra Rejected 861327 READS because READLEN < 1 Read 861327 spots for SRR12897256.sra Written 861327 spots for SRR12897256.sra Rejected 861327 READS because READLEN < 1 Read 861327 spots for SRR12897256.sra Written 861327 spots for SRR12897256.sra Rejected 861327 READS because READLEN < 1 Read 861327 spots for SRR12897256.sra Written 861327 spots for SRR12897256.sra Rejected 861327 READS because READLEN < 1 Read 861327 spots for SRR12897256.sra Written 861327 spots for SRR12897256.sra Rejected 861327 READS because READLEN < 1 Read 861327 spots for SRR12897256.sra Written 861327 spots for SRR12897256.sra Rejected 861327 READS because READLEN < 1 Read 861327 spots for SRR12897256.sra Written 861327 spots for SRR12897256.sra Rejected 861327 READS because READLEN < 1 Read 861327 spots for SRR12897256.sra Written 861327 spots for SRR12897256.sra SRR ids: ['SRR12897256.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xfh5dn7r SRR12897256.sra spots: 17226551 blocks: [[1, 861327], [861328, 1722654], [1722655, 2583981], [2583982, 3445308], [3445309, 4306635], [4306636, 5167962], [5167963, 6029289], [6029290, 6890616], [6890617, 7751943], [7751944, 8613270], [8613271, 9474597], [9474598, 10335924], [10335925, 11197251], [11197252, 12058578], [12058579, 12919905], [12919906, 13781232], [13781233, 14642559], [14642560, 15503886], [15503887, 16365213], [16365214, 17226551]] SRR12897256 file size 4125752 SRR12897256 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12897256 SRR12897256_1.fastq Input file: SRR12897256_1.fastq trimmed: SRR12897256-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:21:40 2024 >> started Sat Dec 7 12:21:49 2024 >> done (9.189s) 17226551 reads processed; of these: 6 ( 0.00%) short reads filtered out after trimming by size control 1197 ( 0.01%) empty reads filtered out after trimming by size control 17225348 (99.99%) reads available; of these: 197 ( 0.00%) trimmed reads available after processing 17225151 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 1 0.00% 21 1 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 2 0.00% 28 1 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 1 0.00% 34 2 0.00% 35 31 0.00% 36 35 0.00% 37 34 0.00% 38 42 0.00% 39 36 0.00% 40 55 0.00% 41 61 0.00% 42 73 0.00% 43 55 0.00% 44 65 0.00% 45 73 0.00% 46 98 0.00% 47 98 0.00% 48 102 0.00% 49 158 0.00% 50 145 0.00% 51 152 0.00% 52 195 0.00% 53 199 0.00% 54 214 0.00% 55 233 0.00% 56 260 0.00% 57 315 0.00% 58 353 0.00% 59 432 0.00% 60 526 0.00% 61 517 0.00% 62 611 0.00% 63 691 0.00% 64 816 0.00% 65 857 0.00% 66 961 0.01% 67 1117 0.01% 68 1141 0.01% 69 1384 0.01% 70 1552 0.01% 71 1640 0.01% 72 1974 0.01% 73 2324 0.01% 74 2658 0.02% 75 2839 0.02% 76 3350 0.02% 77 3695 0.02% 78 4045 0.02% 79 4658 0.03% 80 5001 0.03% 81 5725 0.03% 82 6568 0.04% 83 7295 0.04% 84 8217 0.05% 85 9509 0.06% 86 9989 0.06% 87 10918 0.06% 88 12310 0.07% 89 13378 0.08% 90 14674 0.09% 91 16656 0.10% 92 17042 0.10% 93 18452 0.11% 94 21520 0.12% 95 24860 0.14% 96 46273 0.27% 97 103692 0.60% 98 339427 1.97% 99 1161989 6.75% 100 4071115 23.63% 101 11259859 65.37% 17225348 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=3.43 fanout-score-rank=26 prefix-density=0.22 prefix-fanout=3.1 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.08 sequence-density-rank=11 fanout-score=355.23 fanout-score-rank=1 prefix-density=0.81 prefix-fanout=33.6 sequence=CTTCTTCTTGTC Started job on | Dec 07 12:22:04 Started mapping on | Dec 07 12:22:04 Finished on | Dec 07 12:22:21 Mapping speed, Million of reads per hour | 3647.72 Number of input reads | 17225348 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 16755182 Uniquely mapped reads % | 97.27% Average mapped length | 100.13 Number of splices: Total | 6075929 Number of splices: Annotated (sjdb) | 5773245 Number of splices: GT/AG | 5990943 Number of splices: GC/AG | 73030 Number of splices: AT/AC | 3455 Number of splices: Non-canonical | 8501 Mismatch rate per base, % | 0.17% Deletion rate per base | 0.01% Deletion average length | 2.29 Insertion rate per base | 0.01% Insertion average length | 1.74 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 291013 % of reads mapped to multiple loci | 1.69% Number of reads mapped to too many loci | 81417 % of reads mapped to too many loci | 0.47% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.55% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 179153 179153 179153 N_multimapping 291013 291013 291013 N_noFeature 713539 16386057 824887 N_ambiguous 289044 1262 32622 UnstrandedReadsAssigned:15752599 PositiveStrandReadsAssigned:367863 NegativeStrandReadsAssigned:15897673 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR12897256 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR12897256-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,225,348 reads, 16,058,794 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,153 rounds 52973 SRR12897256.ke.tsv 35125 SRR12897256.se.tsv 88098 total ==> SRR12897256.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 116.969 15.4375 PNS24247 1044 945 31.7103 3.70681 PNS24249 1928 1829 3.64726 0.220285 PNS24246 1044 945 31.7103 3.70681 PNS24248 1044 945 31.7103 3.70681 PNS24244 1471 1372 154.253 12.4197 PNS24243 293 194 0 0 KQK14069 1603 1504 2234.66 164.133 KQK14071 474 375 227.758 67.0925 ==> SRR12897256.se.tsv <== BRADI_1g14170v3 2997 BRADI_1g53295v3 86 BRADI_1g59795v3 508 BRADI_1g07683v3 0 BRADI_1g00485v3 46 BRADI_1g20270v3 2333 BRADI_1g74790v3 100 BRADI_1g09890v3 2 BRADI_1g77505v3 298 BRADI_1g48960v3 0 SRR12897256 completed mapping pipeline successfully