Starting /dee2/code/volunteer_pipeline.sh SRR12897257 current disk space = 1543168565248 free memory = 1606245744 SRR12897257 SRAfilesize 155eb700eeb6282365f959e4a4acad46 SRR12897257.sra SRR12897257.sra file validated SRR12897257 is single end SRR12897257 is conventional basespace SRR12897257 read1 length is 41-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12897257_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 41-101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6935 37.0 37.0 37.0 37.0 37.0 2 36.683 37.0 37.0 37.0 37.0 37.0 3 36.839 37.0 37.0 37.0 37.0 37.0 4 36.768 37.0 37.0 37.0 37.0 37.0 5 36.828 37.0 37.0 37.0 37.0 37.0 6 36.7895 37.0 37.0 37.0 37.0 37.0 7 36.747 37.0 37.0 37.0 37.0 37.0 8 36.7975 37.0 37.0 37.0 37.0 37.0 9 36.7425 37.0 37.0 37.0 37.0 37.0 10-11 36.79725 37.0 37.0 37.0 37.0 37.0 12-13 36.79575 37.0 37.0 37.0 37.0 37.0 14-15 36.78675 37.0 37.0 37.0 37.0 37.0 16-17 36.784499999999994 37.0 37.0 37.0 37.0 37.0 18-19 36.775999999999996 37.0 37.0 37.0 37.0 37.0 20-21 36.803 37.0 37.0 37.0 37.0 37.0 22-23 36.74725 37.0 37.0 37.0 37.0 37.0 24-25 36.79925 37.0 37.0 37.0 37.0 37.0 26-27 36.741 37.0 37.0 37.0 37.0 37.0 28-29 36.71425 37.0 37.0 37.0 37.0 37.0 30-31 36.726 37.0 37.0 37.0 37.0 37.0 32-33 36.71925 37.0 37.0 37.0 37.0 37.0 34-35 36.791 37.0 37.0 37.0 37.0 37.0 36-37 36.71825 37.0 37.0 37.0 37.0 37.0 38-39 36.75325 37.0 37.0 37.0 37.0 37.0 40-41 36.75975 37.0 37.0 37.0 37.0 37.0 42-43 36.72293073268317 37.0 37.0 37.0 37.0 37.0 44-45 36.71067766941735 37.0 37.0 37.0 37.0 37.0 46-47 36.68367091772943 37.0 37.0 37.0 37.0 37.0 48-49 36.78644661165291 37.0 37.0 37.0 37.0 37.0 50-51 36.759879939969984 37.0 37.0 37.0 37.0 37.0 52-53 36.72711355677839 37.0 37.0 37.0 37.0 37.0 54-55 36.72736368184092 37.0 37.0 37.0 37.0 37.0 56-57 36.71010505252626 37.0 37.0 37.0 37.0 37.0 58-59 36.70735367683842 37.0 37.0 37.0 37.0 37.0 60-61 36.71710855427714 37.0 37.0 37.0 37.0 37.0 62-63 36.6855927963982 37.0 37.0 37.0 37.0 37.0 64-65 36.68434217108555 37.0 37.0 37.0 37.0 37.0 66-67 36.74362181090545 37.0 37.0 37.0 37.0 37.0 68-69 36.68359179589795 37.0 37.0 37.0 37.0 37.0 70-71 36.68309154577289 37.0 37.0 37.0 37.0 37.0 72-73 36.68129605207908 37.0 37.0 37.0 37.0 37.0 74-75 36.711172123312295 37.0 37.0 37.0 37.0 37.0 76-77 36.70576870815866 37.0 37.0 37.0 37.0 37.0 78-79 36.64389833265197 37.0 37.0 37.0 37.0 37.0 80-81 36.6284344384369 37.0 37.0 37.0 37.0 37.0 82-83 36.6485214966206 37.0 37.0 37.0 37.0 37.0 84-85 36.64875721817725 37.0 37.0 37.0 37.0 37.0 86-87 36.68287668551352 37.0 37.0 37.0 37.0 37.0 88-89 36.66792362189652 37.0 37.0 37.0 37.0 37.0 90-91 36.69458038966126 37.0 37.0 37.0 37.0 37.0 92-93 36.65478651874265 37.0 37.0 37.0 37.0 37.0 94-95 36.68290684831575 37.0 37.0 37.0 37.0 37.0 96-97 36.59617665924758 37.0 37.0 37.0 37.0 37.0 98-99 36.70058780851362 37.0 37.0 37.0 37.0 37.0 100-101 36.63136327014438 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 1.0 26 0.0 27 5.0 28 3.0 29 2.0 30 6.0 31 10.0 32 15.0 33 24.0 34 32.0 35 93.0 36 2112.0 37 1697.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.35 11.25 4.25 51.15 2 17.299999999999997 11.774999999999999 42.975 27.950000000000003 3 19.0 14.025000000000002 26.424999999999997 40.550000000000004 4 25.275 22.625 22.8 29.299999999999997 5 25.55 29.225 24.425 20.8 6 22.1 30.65 24.125 23.125 7 17.875 24.15 39.125 18.85 8 19.6 22.15 33.050000000000004 25.2 9 19.0 20.525 36.0 24.474999999999998 10-11 22.8625 29.75 24.4 22.9875 12-13 21.9625 24.0375 27.425 26.575 14-15 21.275 24.4875 28.1625 26.075 16-17 22.900000000000002 25.5375 25.924999999999997 25.637500000000003 18-19 23.0625 24.45 26.025 26.4625 20-21 22.175 24.3 27.762500000000003 25.7625 22-23 22.775000000000002 25.525 25.4375 26.2625 24-25 22.1375 24.762500000000003 26.987499999999997 26.1125 26-27 21.6 25.4375 27.175 25.7875 28-29 22.75 24.875 26.4125 25.9625 30-31 22.75 25.825 25.55 25.874999999999996 32-33 22.8875 25.224999999999998 26.775 25.112499999999997 34-35 23.2875 24.825 26.174999999999997 25.7125 36-37 22.575 25.825 26.25 25.35 38-39 22.375 25.3125 26.125 26.187500000000004 40-41 21.8625 26.625 25.887500000000003 25.624999999999996 42-43 22.768192048012004 24.618654663665918 25.64391097774444 26.969242310577645 44-45 22.61815453863466 26.281570392598148 25.98149537384346 25.11877969492373 46-47 23.293323330832706 25.431357839459867 25.481370342585645 25.79394848712178 48-49 22.61815453863466 25.243810952738183 26.144036009002253 25.993998499624904 50-51 22.36118059029515 25.400200100050025 26.425712856428213 25.812906453226613 52-53 22.811405702851424 26.25062531265633 25.775387693846923 25.162581290645324 54-55 22.56128064032016 24.81240620310155 25.887943971985994 26.738369184592298 56-57 22.861430715357677 25.887943971985994 25.6128064032016 25.63781890945473 58-59 22.07353676838419 26.050525262631314 25.50025012506253 26.375687843921963 60-61 22.548774387193596 26.18809404702351 25.387693846923458 25.87543771885943 62-63 22.486243121560783 26.125562781390695 26.25062531265633 25.137568784392194 64-65 24.174587293646823 25.63781890945473 25.737868934467233 24.449724862431214 66-67 22.573786893446723 25.925462731365684 25.662831415707853 25.83791895947974 68-69 22.18609304652326 25.775387693846923 26.075537768884445 25.962981490745374 70-71 22.723861930965484 26.675837918959477 25.237618809404704 25.362681340670335 72-73 22.25140712945591 25.71607254534084 25.59099437148218 26.441525953721072 74-75 22.900763358778626 25.566262044800403 26.21699411838318 25.31598047803779 76-77 22.699386503067483 26.26768498810567 25.791911856767246 25.241016652059596 78-79 23.60606440295702 24.696153364240068 25.560706678361107 26.137075554441797 80-81 22.640090259496052 25.899460950231916 26.46358280055159 24.996865989720447 82-83 23.256397390868038 25.526843953838434 25.288509784244855 25.92824887104867 84-85 23.512427818227465 25.24479035902586 25.30755711775044 25.935224704996234 86-87 22.892323156175397 24.663902500314112 26.837542404824728 25.606231938685763 88-89 22.875816993464053 26.31975867269985 25.82956259426848 24.974861739567622 90-91 23.413897280966765 23.72860020140987 26.397280966767372 26.460221550855994 92-93 22.520817562452688 24.867524602573805 26.507696189755237 26.10396164521827 94-95 23.83360728284233 24.908332279681375 25.704893159691487 25.553167277784798 96-97 22.750919934018526 25.07296028422789 25.656642558051008 26.519477223702577 98-99 22.868567006320134 24.519540822907263 27.228169740745518 25.383722430027085 100-101 24.501701507049102 11.554043104845244 32.668935342732134 31.275320045373523 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 0.0 26 0.5 27 0.5 28 1.0 29 2.0 30 5.0 31 7.0 32 9.5 33 17.5 34 27.5 35 39.0 36 54.5 37 64.5 38 74.0 39 100.0 40 137.0 41 150.5 42 151.5 43 183.0 44 218.0 45 223.5 46 215.5 47 210.0 48 202.0 49 188.0 50 168.0 51 159.5 52 149.5 53 136.0 54 119.5 55 113.0 56 107.0 57 86.0 58 92.0 59 87.0 60 71.5 61 68.5 62 66.5 63 63.5 64 56.0 65 49.0 66 37.0 67 25.5 68 21.0 69 19.5 70 12.5 71 8.5 72 6.5 73 2.5 74 3.5 75 2.5 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 40-41 1.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 1.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 2.0 74-75 2.0 76-77 3.0 78-79 2.0 80-81 2.0 82-83 4.0 84-85 3.0 86-87 1.0 88-89 5.0 90-91 8.0 92-93 9.0 94-95 12.0 96-97 38.0 98-99 338.0 100-101 3569.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.22500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 94.26903687980897 88.825 2 5.386044043512868 10.15 3 0.29185460334306185 0.8250000000000001 4 0.05306447333510214 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 900209 READS because READLEN < 1 Read 900209 spots for SRR12897257.sra Written 900209 spots for SRR12897257.sra Rejected 900209 READS because READLEN < 1 Read 900209 spots for SRR12897257.sra Written 900209 spots for SRR12897257.sra Rejected 900209 READS because READLEN < 1 Read 900209 spots for SRR12897257.sra Written 900209 spots for SRR12897257.sra Rejected 900209 READS because READLEN < 1 Read 900209 spots for SRR12897257.sra Written 900209 spots for SRR12897257.sra Rejected 900209 READS because READLEN < 1 Read 900209 spots for SRR12897257.sra Written 900209 spots for SRR12897257.sra Rejected 900209 READS because READLEN < 1 Read 900209 spots for SRR12897257.sra Written 900209 spots for SRR12897257.sra Rejected 900212 READS because READLEN < 1 Read 900212 spots for SRR12897257.sra Written 900212 spots for SRR12897257.sra Rejected 900209 READS because READLEN < 1 Read 900209 spots for SRR12897257.sra Written 900209 spots for SRR12897257.sra Rejected 900209 READS because READLEN < 1 Read 900209 spots for SRR12897257.sra Written 900209 spots for SRR12897257.sra Rejected 900209 READS because READLEN < 1 Read 900209 spots for SRR12897257.sra Written 900209 spots for SRR12897257.sra Rejected 900209 READS because READLEN < 1 Read 900209 spots for SRR12897257.sra Written 900209 spots for SRR12897257.sra Rejected 900209 READS because READLEN < 1 Read 900209 spots for SRR12897257.sra Written 900209 spots for SRR12897257.sra Rejected 900209 READS because READLEN < 1 Read 900209 spots for SRR12897257.sra Written 900209 spots for SRR12897257.sra Rejected 900209 READS because READLEN < 1 Read 900209 spots for SRR12897257.sra Written 900209 spots for SRR12897257.sra Rejected 900209 READS because READLEN < 1 Read 900209 spots for SRR12897257.sra Written 900209 spots for SRR12897257.sra Rejected 900209 READS because READLEN < 1 Read 900209 spots for SRR12897257.sra Written 900209 spots for SRR12897257.sra Rejected 900209 READS because READLEN < 1 Read 900209 spots for SRR12897257.sra Written 900209 spots for SRR12897257.sra Rejected 900209 READS because READLEN < 1 Read 900209 spots for SRR12897257.sra Written 900209 spots for SRR12897257.sra Rejected 900209 READS because READLEN < 1 Read 900209 spots for SRR12897257.sra Written 900209 spots for SRR12897257.sra Rejected 900209 READS because READLEN < 1 Read 900209 spots for SRR12897257.sra Written 900209 spots for SRR12897257.sra SRR ids: ['SRR12897257.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rg33kvod SRR12897257.sra spots: 18004183 blocks: [[1, 900209], [900210, 1800418], [1800419, 2700627], [2700628, 3600836], [3600837, 4501045], [4501046, 5401254], [5401255, 6301463], [6301464, 7201672], [7201673, 8101881], [8101882, 9002090], [9002091, 9902299], [9902300, 10802508], [10802509, 11702717], [11702718, 12602926], [12602927, 13503135], [13503136, 14403344], [14403345, 15303553], [15303554, 16203762], [16203763, 17103971], [17103972, 18004183]] SRR12897257 file size 4312488 SRR12897257 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12897257 SRR12897257_1.fastq Input file: SRR12897257_1.fastq trimmed: SRR12897257-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:23:11 2024 >> started Sat Dec 7 12:23:19 2024 >> done (8.785s) 18004183 reads processed; of these: 4 ( 0.00%) short reads filtered out after trimming by size control 1195 ( 0.01%) empty reads filtered out after trimming by size control 18002984 (99.99%) reads available; of these: 240 ( 0.00%) trimmed reads available after processing 18002744 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 1 0.00% 25 0 0.00% 26 0 0.00% 27 1 0.00% 28 1 0.00% 29 2 0.00% 30 0 0.00% 31 0 0.00% 32 1 0.00% 33 0 0.00% 34 0 0.00% 35 36 0.00% 36 29 0.00% 37 42 0.00% 38 50 0.00% 39 47 0.00% 40 59 0.00% 41 62 0.00% 42 73 0.00% 43 81 0.00% 44 77 0.00% 45 74 0.00% 46 104 0.00% 47 126 0.00% 48 131 0.00% 49 191 0.00% 50 196 0.00% 51 220 0.00% 52 249 0.00% 53 280 0.00% 54 296 0.00% 55 273 0.00% 56 298 0.00% 57 371 0.00% 58 442 0.00% 59 507 0.00% 60 600 0.00% 61 654 0.00% 62 751 0.00% 63 820 0.00% 64 952 0.01% 65 1011 0.01% 66 1116 0.01% 67 1292 0.01% 68 1367 0.01% 69 1575 0.01% 70 1745 0.01% 71 1982 0.01% 72 2325 0.01% 73 2789 0.02% 74 2895 0.02% 75 3313 0.02% 76 3842 0.02% 77 4153 0.02% 78 4591 0.03% 79 5228 0.03% 80 5557 0.03% 81 6230 0.03% 82 7320 0.04% 83 7994 0.04% 84 8975 0.05% 85 10175 0.06% 86 11168 0.06% 87 12393 0.07% 88 13484 0.07% 89 14754 0.08% 90 16033 0.09% 91 18109 0.10% 92 18716 0.10% 93 20916 0.12% 94 23886 0.13% 95 27704 0.15% 96 50256 0.28% 97 109602 0.61% 98 353853 1.97% 99 1209679 6.72% 100 4229051 23.49% 101 11779806 65.43% 18002984 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.84 fanout-score-rank=26 prefix-density=0.31 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.08 sequence-density-rank=14 fanout-score=304.48 fanout-score-rank=1 prefix-density=0.78 prefix-fanout=31.7 sequence=CTTCTTCTTGTC Started job on | Dec 07 12:23:35 Started mapping on | Dec 07 12:23:35 Finished on | Dec 07 12:23:51 Mapping speed, Million of reads per hour | 4050.67 Number of input reads | 18002984 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 17494625 Uniquely mapped reads % | 97.18% Average mapped length | 100.10 Number of splices: Total | 6337954 Number of splices: Annotated (sjdb) | 6014935 Number of splices: GT/AG | 6248026 Number of splices: GC/AG | 77911 Number of splices: AT/AC | 3132 Number of splices: Non-canonical | 8885 Mismatch rate per base, % | 0.17% Deletion rate per base | 0.01% Deletion average length | 2.32 Insertion rate per base | 0.01% Insertion average length | 1.73 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 307366 % of reads mapped to multiple loci | 1.71% Number of reads mapped to too many loci | 110752 % of reads mapped to too many loci | 0.62% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.48% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 200993 200993 200993 N_multimapping 307366 307366 307366 N_noFeature 750925 17089123 873522 N_ambiguous 317731 1343 36269 UnstrandedReadsAssigned:16425969 PositiveStrandReadsAssigned:404159 NegativeStrandReadsAssigned:16584834 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR12897257 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR12897257-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,002,984 reads, 16,738,160 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,162 rounds 52973 SRR12897257.ke.tsv 35125 SRR12897257.se.tsv 88098 total ==> SRR12897257.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 166.797 20.9199 PNS24247 1044 945 21.5727 2.39646 PNS24249 1928 1829 29.1624 1.67381 PNS24246 1044 945 21.5727 2.39646 PNS24248 1044 945 21.5727 2.39646 PNS24244 1471 1372 153.322 11.7314 PNS24243 293 194 0 0 KQK14069 1603 1504 2411.4 168.314 KQK14071 474 375 295.732 82.7873 ==> SRR12897257.se.tsv <== BRADI_1g14170v3 3181 BRADI_1g53295v3 114 BRADI_1g59795v3 468 BRADI_1g07683v3 0 BRADI_1g00485v3 30 BRADI_1g20270v3 1403 BRADI_1g74790v3 177 BRADI_1g09890v3 1 BRADI_1g77505v3 322 BRADI_1g48960v3 0 SRR12897257 completed mapping pipeline successfully