Starting /dee2/code/volunteer_pipeline.sh SRR12897258 current disk space = 1543168565248 free memory = 1602961496 SRR12897258 SRAfilesize 77966ed815f509974427d762fb19e0cf SRR12897258.sra SRR12897258.sra file validated SRR12897258 is single end SRR12897258 is conventional basespace SRR12897258 read1 length is 46-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12897258_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 46-101 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.612 37.0 37.0 37.0 37.0 37.0 2 36.591 37.0 37.0 37.0 37.0 37.0 3 36.6915 37.0 37.0 37.0 37.0 37.0 4 36.768 37.0 37.0 37.0 37.0 37.0 5 36.7485 37.0 37.0 37.0 37.0 37.0 6 36.7315 37.0 37.0 37.0 37.0 37.0 7 36.7435 37.0 37.0 37.0 37.0 37.0 8 36.704 37.0 37.0 37.0 37.0 37.0 9 36.7125 37.0 37.0 37.0 37.0 37.0 10-11 36.7425 37.0 37.0 37.0 37.0 37.0 12-13 36.732749999999996 37.0 37.0 37.0 37.0 37.0 14-15 36.713750000000005 37.0 37.0 37.0 37.0 37.0 16-17 36.706 37.0 37.0 37.0 37.0 37.0 18-19 36.742999999999995 37.0 37.0 37.0 37.0 37.0 20-21 36.7515 37.0 37.0 37.0 37.0 37.0 22-23 36.72525 37.0 37.0 37.0 37.0 37.0 24-25 36.723 37.0 37.0 37.0 37.0 37.0 26-27 36.7075 37.0 37.0 37.0 37.0 37.0 28-29 36.683 37.0 37.0 37.0 37.0 37.0 30-31 36.65875 37.0 37.0 37.0 37.0 37.0 32-33 36.70525 37.0 37.0 37.0 37.0 37.0 34-35 36.672250000000005 37.0 37.0 37.0 37.0 37.0 36-37 36.648250000000004 37.0 37.0 37.0 37.0 37.0 38-39 36.645250000000004 37.0 37.0 37.0 37.0 37.0 40-41 36.69725 37.0 37.0 37.0 37.0 37.0 42-43 36.65774999999999 37.0 37.0 37.0 37.0 37.0 44-45 36.66025 37.0 37.0 37.0 37.0 37.0 46-47 36.64595105026257 37.0 37.0 37.0 37.0 37.0 48-49 36.66966741685421 37.0 37.0 37.0 37.0 37.0 50-51 36.695423855963995 37.0 37.0 37.0 37.0 37.0 52-53 36.685171292823206 37.0 37.0 37.0 37.0 37.0 54-55 36.66341585396349 37.0 37.0 37.0 37.0 37.0 56-57 36.65212032122588 37.0 37.0 37.0 37.0 37.0 58-59 36.60180090045023 37.0 37.0 37.0 37.0 37.0 60-61 36.632316158079036 37.0 37.0 37.0 37.0 37.0 62-63 36.6495747873937 37.0 37.0 37.0 37.0 37.0 64-65 36.628314157078535 37.0 37.0 37.0 37.0 37.0 66-67 36.64282141070535 37.0 37.0 37.0 37.0 37.0 68-69 36.63256628314157 37.0 37.0 37.0 37.0 37.0 70-71 36.62331165582791 37.0 37.0 37.0 37.0 37.0 72-73 36.61586586586587 37.0 37.0 37.0 37.0 37.0 74-75 36.664171356766744 37.0 37.0 37.0 37.0 37.0 76-77 36.61513405161614 37.0 37.0 37.0 37.0 37.0 78-79 36.628843657740674 37.0 37.0 37.0 37.0 37.0 80-81 36.60476061294853 37.0 37.0 37.0 37.0 37.0 82-83 36.6252197940216 37.0 37.0 37.0 37.0 37.0 84-85 36.59039631431851 37.0 37.0 37.0 37.0 37.0 86-87 36.63677690505004 37.0 37.0 37.0 37.0 37.0 88-89 36.62315886513929 37.0 37.0 37.0 37.0 37.0 90-91 36.588208032468415 37.0 37.0 37.0 37.0 37.0 92-93 36.58173551411124 37.0 37.0 37.0 37.0 37.0 94-95 36.63814312531127 37.0 37.0 37.0 37.0 37.0 96-97 36.618019032227394 37.0 37.0 37.0 37.0 37.0 98-99 36.640080396941556 37.0 37.0 37.0 37.0 37.0 100-101 36.52075351459414 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 1.0 26 2.0 27 2.0 28 4.0 29 8.0 30 12.0 31 20.0 32 27.0 33 20.0 34 51.0 35 104.0 36 2033.0 37 1716.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.43743743743744 11.186186186186188 4.654654654654655 46.72172172172172 2 19.75 13.275 39.0 27.975 3 19.15 15.85 25.85 39.15 4 24.85 23.45 22.225 29.475 5 25.424999999999997 29.15 23.7 21.725 6 21.725 31.75 23.025000000000002 23.5 7 18.675 22.35 39.15 19.825 8 19.1 22.175 32.125 26.6 9 18.45 19.825 34.4 27.325 10-11 22.8375 29.725 23.9375 23.5 12-13 22.55 23.625 27.650000000000002 26.174999999999997 14-15 22.075 24.5375 27.525 25.8625 16-17 23.2125 24.875 26.4625 25.45 18-19 22.900000000000002 24.9875 26.5 25.6125 20-21 22.912499999999998 25.074999999999996 25.687500000000004 26.325 22-23 23.2375 26.325 25.6 24.837500000000002 24-25 23.5 25.0625 25.3125 26.125 26-27 22.3 25.45 26.487500000000004 25.7625 28-29 23.1125 25.1875 26.1625 25.5375 30-31 23.5875 25.074999999999996 24.637500000000003 26.700000000000003 32-33 23.0875 24.9375 25.2125 26.7625 34-35 23.4375 25.25 25.974999999999998 25.337500000000002 36-37 23.4375 24.775 25.55 26.237500000000004 38-39 23.125 25.8125 25.324999999999996 25.7375 40-41 23.150000000000002 25.650000000000002 25.525 25.674999999999997 42-43 22.912499999999998 26.05 25.525 25.5125 44-45 23.1 25.35 26.2625 25.2875 46-47 22.340292536567073 25.17814726840855 25.678209776222026 26.803350418802353 48-49 23.3183295823956 24.956239059764943 25.806451612903224 25.918979744936234 50-51 22.518129532383096 25.49387346836709 26.469117279319832 25.51887971992998 52-53 24.281070267566893 26.18154538634659 25.28132033008252 24.256064016004 54-55 23.280820205051263 24.793698424606152 25.668917229307326 26.25656414103526 56-57 23.62135800925347 24.85932224584219 25.609603601350507 25.909716143553833 58-59 23.799399699849925 24.987493746873437 25.162581290645324 26.050525262631314 60-61 23.3991995997999 24.73736868434217 25.925462731365684 25.937968984492244 62-63 23.88694347173587 24.562281140570285 25.625312656328163 25.925462731365684 64-65 23.036518259129565 25.987993996998497 25.325162581290645 25.65032516258129 66-67 23.21160580290145 25.80040020010005 25.07503751875938 25.912956478239117 68-69 22.22361180590295 25.52526263131566 25.48774387193597 26.76338169084542 70-71 23.611805902951478 25.137568784392194 25.400200100050025 25.850425212606304 72-73 22.27227227227227 25.425425425425423 25.175175175175173 27.127127127127125 74-75 23.478587528174305 25.544703230653642 26.120711244678184 24.855997996493866 76-77 24.292157354046605 24.99373590578802 25.870709095464793 24.843397644700577 78-79 22.63322884012539 24.70219435736677 26.63322884012539 26.031347962382444 80-81 22.672521957340024 25.784190715181932 25.520702634880806 26.02258469259724 82-83 22.90881688018086 26.161768399899522 25.521225822657623 25.408188897261997 84-85 23.068224651338106 25.29212212589521 25.983163714034426 25.656489508732257 86-87 23.795748962394665 23.77059489372406 26.851968305873473 25.5816878380078 88-89 23.02076777847703 25.2863436123348 25.588420390182502 26.104468219005668 90-91 23.979334677419356 25.743447580645164 25.27721774193548 25.0 92-93 23.574672048435925 25.037840565085773 25.946014127144302 25.441473259334007 94-95 22.438408085912823 25.761212886923563 25.45799115603285 26.34238787113076 96-97 23.705583756345177 26.02791878172589 25.12690355329949 25.139593908629443 98-99 23.205061983471072 24.39307851239669 26.84659090909091 25.555268595041326 100-101 23.43901649951472 11.840828210934973 33.176965383371076 31.54318990617923 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.5 26 2.0 27 2.0 28 2.0 29 2.5 30 2.5 31 8.0 32 18.0 33 24.0 34 26.5 35 33.5 36 46.5 37 52.0 38 72.0 39 100.5 40 124.0 41 139.5 42 144.5 43 161.5 44 198.0 45 215.0 46 199.5 47 207.5 48 205.0 49 188.0 50 185.0 51 170.0 52 153.0 53 138.5 54 123.0 55 111.0 56 101.5 57 95.5 58 98.0 59 102.5 60 87.0 61 66.5 62 57.5 63 53.5 64 51.0 65 45.5 66 40.5 67 34.0 68 26.5 69 18.5 70 17.0 71 18.0 72 14.0 73 10.0 74 6.5 75 3.0 76 3.0 77 3.5 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 46-47 1.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 1.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 2.0 72-73 1.0 74-75 4.0 76-77 2.0 78-79 3.0 80-81 5.0 82-83 1.0 84-85 3.0 86-87 4.0 88-89 4.0 90-91 3.0 92-93 6.0 94-95 14.0 96-97 32.0 98-99 360.0 100-101 3554.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.975 #Duplication Level Percentage of deduplicated Percentage of total 1 95.23558831271387 90.45 2 4.316925506712293 8.200000000000001 3 0.3948407475651487 1.125 4 0.026322716504343247 0.1 5 0.026322716504343247 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTGGAGGAGCGGCGGCTGAGGGGGAGGCCGGCGGTGGACTTGAGGCCCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTGCC 15 0.0031285281 63.436974 94-95 >>END_MODULE Rejected 864546 READS because READLEN < 1 Read 864546 spots for SRR12897258.sra Written 864546 spots for SRR12897258.sra Rejected 864546 READS because READLEN < 1 Read 864546 spots for SRR12897258.sra Written 864546 spots for SRR12897258.sra Rejected 864546 READS because READLEN < 1 Read 864546 spots for SRR12897258.sra Written 864546 spots for SRR12897258.sra Rejected 864546 READS because READLEN < 1 Read 864546 spots for SRR12897258.sra Written 864546 spots for SRR12897258.sra Rejected 864546 READS because READLEN < 1 Read 864546 spots for SRR12897258.sra Written 864546 spots for SRR12897258.sra Rejected 864546 READS because READLEN < 1 Read 864546 spots for SRR12897258.sra Written 864546 spots for SRR12897258.sra Rejected 864554 READS because READLEN < 1 Read 864554 spots for SRR12897258.sra Written 864554 spots for SRR12897258.sra Rejected 864546 READS because READLEN < 1 Read 864546 spots for SRR12897258.sra Written 864546 spots for SRR12897258.sra Rejected 864546 READS because READLEN < 1 Read 864546 spots for SRR12897258.sra Written 864546 spots for SRR12897258.sra Rejected 864546 READS because READLEN < 1 Read 864546 spots for SRR12897258.sra Written 864546 spots for SRR12897258.sra Rejected 864546 READS because READLEN < 1 Read 864546 spots for SRR12897258.sra Written 864546 spots for SRR12897258.sra Rejected 864546 READS because READLEN < 1 Read 864546 spots for SRR12897258.sra Written 864546 spots for SRR12897258.sra Rejected 864546 READS because READLEN < 1 Read 864546 spots for SRR12897258.sra Written 864546 spots for SRR12897258.sra Rejected 864546 READS because READLEN < 1 Read 864546 spots for SRR12897258.sra Written 864546 spots for SRR12897258.sra Rejected 864546 READS because READLEN < 1 Read 864546 spots for SRR12897258.sra Written 864546 spots for SRR12897258.sra Rejected 864546 READS because READLEN < 1 Read 864546 spots for SRR12897258.sra Written 864546 spots for SRR12897258.sra Rejected 864546 READS because READLEN < 1 Read 864546 spots for SRR12897258.sra Written 864546 spots for SRR12897258.sra Rejected 864546 READS because READLEN < 1 Read 864546 spots for SRR12897258.sra Written 864546 spots for SRR12897258.sra Rejected 864546 READS because READLEN < 1 Read 864546 spots for SRR12897258.sra Written 864546 spots for SRR12897258.sra Rejected 864546 READS because READLEN < 1 Read 864546 spots for SRR12897258.sra Written 864546 spots for SRR12897258.sra SRR ids: ['SRR12897258.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mpxedrg0 SRR12897258.sra spots: 17290928 blocks: [[1, 864546], [864547, 1729092], [1729093, 2593638], [2593639, 3458184], [3458185, 4322730], [4322731, 5187276], [5187277, 6051822], [6051823, 6916368], [6916369, 7780914], [7780915, 8645460], [8645461, 9510006], [9510007, 10374552], [10374553, 11239098], [11239099, 12103644], [12103645, 12968190], [12968191, 13832736], [13832737, 14697282], [14697283, 15561828], [15561829, 16426374], [16426375, 17290928]] SRR12897258 file size 4141666 SRR12897258 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12897258 SRR12897258_1.fastq Input file: SRR12897258_1.fastq trimmed: SRR12897258-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:22:54 2024 >> started Sat Dec 7 12:23:03 2024 >> done (8.978s) 17290928 reads processed; of these: 2 ( 0.00%) short reads filtered out after trimming by size control 1221 ( 0.01%) empty reads filtered out after trimming by size control 17289705 (99.99%) reads available; of these: 176 ( 0.00%) trimmed reads available after processing 17289529 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 0 0.00% 22 0 0.00% 23 1 0.00% 24 0 0.00% 25 0 0.00% 26 1 0.00% 27 1 0.00% 28 1 0.00% 29 1 0.00% 30 0 0.00% 31 1 0.00% 32 3 0.00% 33 1 0.00% 34 2 0.00% 35 39 0.00% 36 50 0.00% 37 46 0.00% 38 58 0.00% 39 53 0.00% 40 66 0.00% 41 68 0.00% 42 82 0.00% 43 74 0.00% 44 79 0.00% 45 76 0.00% 46 94 0.00% 47 129 0.00% 48 123 0.00% 49 160 0.00% 50 199 0.00% 51 219 0.00% 52 188 0.00% 53 214 0.00% 54 223 0.00% 55 282 0.00% 56 302 0.00% 57 320 0.00% 58 387 0.00% 59 457 0.00% 60 484 0.00% 61 562 0.00% 62 632 0.00% 63 682 0.00% 64 768 0.00% 65 903 0.01% 66 942 0.01% 67 1037 0.01% 68 1132 0.01% 69 1369 0.01% 70 1479 0.01% 71 1818 0.01% 72 1926 0.01% 73 2283 0.01% 74 2572 0.01% 75 2854 0.02% 76 3122 0.02% 77 3472 0.02% 78 3846 0.02% 79 4278 0.02% 80 4794 0.03% 81 5567 0.03% 82 6387 0.04% 83 6946 0.04% 84 7947 0.05% 85 8956 0.05% 86 9700 0.06% 87 10633 0.06% 88 11768 0.07% 89 12847 0.07% 90 13997 0.08% 91 15872 0.09% 92 16399 0.09% 93 18410 0.11% 94 21004 0.12% 95 24450 0.14% 96 46096 0.27% 97 102419 0.59% 98 335220 1.94% 99 1162850 6.73% 100 4027935 23.30% 101 11379346 65.82% 17289705 reads passed initial QC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.99 fanout-score-rank=23 prefix-density=0.33 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.07 sequence-density-rank=19 fanout-score=352.46 fanout-score-rank=1 prefix-density=0.78 prefix-fanout=32.6 sequence=CTTCTTCTTGTC Started job on | Dec 07 12:23:18 Started mapping on | Dec 07 12:23:18 Finished on | Dec 07 12:23:43 Mapping speed, Million of reads per hour | 2489.72 Number of input reads | 17289705 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 16787618 Uniquely mapped reads % | 97.10% Average mapped length | 100.13 Number of splices: Total | 6022706 Number of splices: Annotated (sjdb) | 5721206 Number of splices: GT/AG | 5938232 Number of splices: GC/AG | 72887 Number of splices: AT/AC | 3122 Number of splices: Non-canonical | 8465 Mismatch rate per base, % | 0.17% Deletion rate per base | 0.01% Deletion average length | 2.30 Insertion rate per base | 0.01% Insertion average length | 1.74 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 299610 % of reads mapped to multiple loci | 1.73% Number of reads mapped to too many loci | 114700 % of reads mapped to too many loci | 0.66% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.48% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 202477 202477 202477 N_multimapping 299610 299610 299610 N_noFeature 680168 16407258 793317 N_ambiguous 299485 1234 33659 UnstrandedReadsAssigned:15807965 PositiveStrandReadsAssigned:379126 NegativeStrandReadsAssigned:15960642 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR12897258 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR12897258-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,289,705 reads, 16,104,490 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,142 rounds 52973 SRR12897258.ke.tsv 35125 SRR12897258.se.tsv 88098 total ==> SRR12897258.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 90.9285 11.6608 PNS24247 1044 945 30.5233 3.46699 PNS24249 1928 1829 24.914 1.46212 PNS24246 1044 945 30.5233 3.46699 PNS24248 1044 945 30.5233 3.46699 PNS24244 1471 1372 120.588 9.43416 PNS24243 293 194 0 0 KQK14069 1603 1504 1964.19 140.181 KQK14071 474 375 294.854 84.3977 ==> SRR12897258.se.tsv <== BRADI_1g14170v3 2755 BRADI_1g53295v3 82 BRADI_1g59795v3 428 BRADI_1g07683v3 0 BRADI_1g00485v3 34 BRADI_1g20270v3 1847 BRADI_1g74790v3 167 BRADI_1g09890v3 1 BRADI_1g77505v3 300 BRADI_1g48960v3 0 SRR12897258 completed mapping pipeline successfully