Starting /dee2/code/volunteer_pipeline.sh SRR12897259 current disk space = 1543143071744 free memory = 1605830064 SRR12897259 SRAfilesize 4d4d93207fa903d4a59c734ca2cf5761 SRR12897259.sra SRR12897259.sra file validated SRR12897259 is single end SRR12897259 is conventional basespace SRR12897259 read1 length is 64-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12897259_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 64-101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.74925 37.0 37.0 37.0 37.0 37.0 2 36.6215 37.0 37.0 37.0 37.0 37.0 3 36.658 37.0 37.0 37.0 37.0 37.0 4 36.6815 37.0 37.0 37.0 37.0 37.0 5 36.7675 37.0 37.0 37.0 37.0 37.0 6 36.6845 37.0 37.0 37.0 37.0 37.0 7 36.6685 37.0 37.0 37.0 37.0 37.0 8 36.7235 37.0 37.0 37.0 37.0 37.0 9 36.722 37.0 37.0 37.0 37.0 37.0 10-11 36.724500000000006 37.0 37.0 37.0 37.0 37.0 12-13 36.67675 37.0 37.0 37.0 37.0 37.0 14-15 36.73675 37.0 37.0 37.0 37.0 37.0 16-17 36.74075 37.0 37.0 37.0 37.0 37.0 18-19 36.71425 37.0 37.0 37.0 37.0 37.0 20-21 36.7225 37.0 37.0 37.0 37.0 37.0 22-23 36.698750000000004 37.0 37.0 37.0 37.0 37.0 24-25 36.6965 37.0 37.0 37.0 37.0 37.0 26-27 36.643249999999995 37.0 37.0 37.0 37.0 37.0 28-29 36.678 37.0 37.0 37.0 37.0 37.0 30-31 36.682 37.0 37.0 37.0 37.0 37.0 32-33 36.669 37.0 37.0 37.0 37.0 37.0 34-35 36.616 37.0 37.0 37.0 37.0 37.0 36-37 36.62425 37.0 37.0 37.0 37.0 37.0 38-39 36.6285 37.0 37.0 37.0 37.0 37.0 40-41 36.66 37.0 37.0 37.0 37.0 37.0 42-43 36.6595 37.0 37.0 37.0 37.0 37.0 44-45 36.655 37.0 37.0 37.0 37.0 37.0 46-47 36.60425 37.0 37.0 37.0 37.0 37.0 48-49 36.61525 37.0 37.0 37.0 37.0 37.0 50-51 36.649 37.0 37.0 37.0 37.0 37.0 52-53 36.62225 37.0 37.0 37.0 37.0 37.0 54-55 36.61525 37.0 37.0 37.0 37.0 37.0 56-57 36.618 37.0 37.0 37.0 37.0 37.0 58-59 36.592 37.0 37.0 37.0 37.0 37.0 60-61 36.60325 37.0 37.0 37.0 37.0 37.0 62-63 36.604749999999996 37.0 37.0 37.0 37.0 37.0 64-65 36.63820561390348 37.0 37.0 37.0 37.0 37.0 66-67 36.60265066266567 37.0 37.0 37.0 37.0 37.0 68-69 36.611555777888945 37.0 37.0 37.0 37.0 37.0 70-71 36.560280140070034 37.0 37.0 37.0 37.0 37.0 72-73 36.613806903451724 37.0 37.0 37.0 37.0 37.0 74-75 36.605055744104554 37.0 37.0 37.0 37.0 37.0 76-77 36.58948685857322 37.0 37.0 37.0 37.0 37.0 78-79 36.559198998748435 37.0 37.0 37.0 37.0 37.0 80-81 36.54856963390564 37.0 37.0 37.0 37.0 37.0 82-83 36.50942146792913 37.0 37.0 37.0 37.0 37.0 84-85 36.56820428439899 37.0 37.0 37.0 37.0 37.0 86-87 36.55662584273823 37.0 37.0 37.0 37.0 37.0 88-89 36.56281861772125 37.0 37.0 37.0 37.0 37.0 90-91 36.52258014819587 37.0 37.0 37.0 37.0 37.0 92-93 36.544706417052225 37.0 37.0 37.0 37.0 37.0 94-95 36.600631804549074 37.0 37.0 37.0 37.0 37.0 96-97 36.53786198149578 37.0 37.0 37.0 37.0 37.0 98-99 36.538762903323935 37.0 37.0 37.0 37.0 37.0 100-101 36.50346483510833 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 3.0 26 1.0 27 6.0 28 4.0 29 12.0 30 18.0 31 17.0 32 20.0 33 27.0 34 50.0 35 101.0 36 2109.0 37 1631.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.45986496624156 11.302825706426606 5.126281570392599 44.11102775693924 2 19.400000000000002 12.65 36.725 31.225 3 19.3 16.175 26.3 38.224999999999994 4 23.799999999999997 24.224999999999998 23.275000000000002 28.7 5 26.35 28.749999999999996 22.5 22.400000000000002 6 21.5 31.45 22.675 24.375 7 17.525 23.849999999999998 39.675 18.95 8 18.85 23.3 31.275 26.575 9 18.575 21.0 35.3 25.124999999999996 10-11 22.475 30.362499999999997 24.1375 23.025000000000002 12-13 22.15 24.1625 27.800000000000004 25.887500000000003 14-15 21.987499999999997 24.7875 27.0125 26.2125 16-17 23.375 25.8625 26.075 24.6875 18-19 22.6125 25.0125 26.474999999999998 25.900000000000002 20-21 23.9375 25.4375 25.887500000000003 24.7375 22-23 22.6 26.087500000000002 26.75 24.5625 24-25 22.475 25.687500000000004 25.974999999999998 25.8625 26-27 23.400000000000002 25.0 26.5125 25.087500000000002 28-29 22.537499999999998 25.7 25.637500000000003 26.125 30-31 22.8125 25.974999999999998 25.775 25.4375 32-33 23.0625 26.4125 25.7625 24.762500000000003 34-35 22.8125 26.075 25.8625 25.25 36-37 22.8125 26.575 24.6875 25.924999999999997 38-39 23.549999999999997 25.3125 25.387500000000003 25.75 40-41 22.775000000000002 26.5875 25.174999999999997 25.4625 42-43 23.474999999999998 25.474999999999998 25.112499999999997 25.937500000000004 44-45 22.55 26.075 26.650000000000002 24.725 46-47 22.3125 25.2125 26.85 25.624999999999996 48-49 22.325 25.650000000000002 25.8625 26.1625 50-51 22.787499999999998 25.2125 25.900000000000002 26.1 52-53 23.5 25.587500000000002 25.937500000000004 24.975 54-55 22.3 26.2125 25.55 25.937500000000004 56-57 22.6125 25.387500000000003 26.787499999999998 25.2125 58-59 22.15 25.337500000000002 26.424999999999997 26.087500000000002 60-61 22.475 26.237500000000004 25.75 25.5375 62-63 23.275000000000002 24.175 26.8625 25.687500000000004 64-65 22.540317539692463 26.578322290286287 26.140767595949495 24.74059257407176 66-67 22.643160790197552 26.03150787696924 25.906476619154787 25.418854713678417 68-69 23.06153076538269 26.313156578289142 24.7623811905953 25.86293146573287 70-71 22.998999499749875 26.88844422211106 25.025012506253123 25.087543771885944 72-73 23.299149574787396 25.312656328164078 26.075537768884445 25.312656328164078 74-75 23.488925040670754 25.653860593167316 26.204480040045052 24.65273432611688 76-77 23.642052565707132 26.65832290362954 25.043804755944933 24.6558197747184 78-79 22.74092615769712 24.430538172715895 27.359198998748436 25.46933667083855 80-81 22.934401602403607 25.926389584376565 26.20180270405608 24.937406109163746 82-83 22.662321383805466 25.933817999498622 25.670594133868136 25.733266482827776 84-85 23.421614158403415 25.367139450232205 25.291828793774318 25.919417597590062 86-87 22.68442880482594 25.977127057936407 26.065099912027144 25.273344225210508 88-89 23.305244623317822 25.82065149037857 25.732612250031444 25.141491636272168 90-91 22.900378310214375 25.245901639344265 26.216897856242117 25.636822194199244 92-93 22.7766548762001 24.974734714502276 27.34967155128853 24.898938858009096 94-95 22.74340770791075 25.874746450304258 26.217038539553755 25.164807302231235 96-97 23.16995544239338 25.41056651814131 25.270528325907065 26.148949713558245 98-99 23.943845053945147 24.35980761731444 26.387625113739766 25.30872221500065 100-101 24.049180327868854 12.295081967213115 31.278688524590166 32.37704918032787 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.5 6 0.5 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.0 26 0.5 27 1.0 28 2.0 29 3.5 30 4.5 31 10.5 32 11.5 33 16.5 34 29.0 35 36.0 36 41.0 37 54.5 38 81.0 39 110.0 40 130.5 41 146.5 42 179.5 43 181.0 44 182.0 45 225.5 46 223.5 47 198.0 48 198.5 49 200.5 50 198.5 51 176.0 52 153.0 53 139.0 54 117.5 55 103.5 56 98.5 57 92.5 58 89.0 59 82.0 60 76.0 61 63.5 62 53.0 63 54.5 64 49.5 65 49.5 66 45.0 67 33.0 68 22.5 69 18.5 70 13.5 71 7.5 72 4.0 73 2.0 74 2.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 64 1.0 65 0.0 66 0.0 67 1.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 2.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 2.0 81 2.0 82 4.0 83 2.0 84 3.0 85 3.0 86 1.0 87 1.0 88 3.0 89 7.0 90 4.0 91 3.0 92 4.0 93 9.0 94 6.0 95 9.0 96 9.0 97 23.0 98 107.0 99 274.0 100 938.0 101 2581.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.1 #Duplication Level Percentage of deduplicated Percentage of total 1 94.15515409139213 88.6 2 5.419766206163656 10.2 3 0.4250797024442083 1.2 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCCATT 15 6.412888E-4 93.975 1 >>END_MODULE Rejected 794999 READS because READLEN < 1 Read 794999 spots for SRR12897259.sra Written 794999 spots for SRR12897259.sra Rejected 794999 READS because READLEN < 1 Read 794999 spots for SRR12897259.sra Written 794999 spots for SRR12897259.sra Rejected 794999 READS because READLEN < 1 Read 794999 spots for SRR12897259.sra Written 794999 spots for SRR12897259.sra Rejected 794999 READS because READLEN < 1 Read 794999 spots for SRR12897259.sra Written 794999 spots for SRR12897259.sra Rejected 794999 READS because READLEN < 1 Read 794999 spots for SRR12897259.sra Written 794999 spots for SRR12897259.sra Rejected 794999 READS because READLEN < 1 Read 794999 spots for SRR12897259.sra Written 794999 spots for SRR12897259.sra Rejected 795002 READS because READLEN < 1 Read 795002 spots for SRR12897259.sra Written 795002 spots for SRR12897259.sra Rejected 794999 READS because READLEN < 1 Read 794999 spots for SRR12897259.sra Written 794999 spots for SRR12897259.sra Rejected 794999 READS because READLEN < 1 Read 794999 spots for SRR12897259.sra Written 794999 spots for SRR12897259.sra Rejected 794999 READS because READLEN < 1 Read 794999 spots for SRR12897259.sra Written 794999 spots for SRR12897259.sra Rejected 794999 READS because READLEN < 1 Read 794999 spots for SRR12897259.sra Written 794999 spots for SRR12897259.sra Rejected 794999 READS because READLEN < 1 Read 794999 spots for SRR12897259.sra Written 794999 spots for SRR12897259.sra Rejected 794999 READS because READLEN < 1 Read 794999 spots for SRR12897259.sra Written 794999 spots for SRR12897259.sra Rejected 794999 READS because READLEN < 1 Read 794999 spots for SRR12897259.sra Written 794999 spots for SRR12897259.sra Rejected 794999 READS because READLEN < 1 Read 794999 spots for SRR12897259.sra Written 794999 spots for SRR12897259.sra Rejected 794999 READS because READLEN < 1 Read 794999 spots for SRR12897259.sra Written 794999 spots for SRR12897259.sra Rejected 794999 READS because READLEN < 1 Read 794999 spots for SRR12897259.sra Written 794999 spots for SRR12897259.sra Rejected 794999 READS because READLEN < 1 Read 794999 spots for SRR12897259.sra Written 794999 spots for SRR12897259.sra Rejected 794999 READS because READLEN < 1 Read 794999 spots for SRR12897259.sra Written 794999 spots for SRR12897259.sra Rejected 794999 READS because READLEN < 1 Read 794999 spots for SRR12897259.sra Written 794999 spots for SRR12897259.sra SRR ids: ['SRR12897259.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_afifhlgw SRR12897259.sra spots: 15899983 blocks: [[1, 794999], [795000, 1589998], [1589999, 2384997], [2384998, 3179996], [3179997, 3974995], [3974996, 4769994], [4769995, 5564993], [5564994, 6359992], [6359993, 7154991], [7154992, 7949990], [7949991, 8744989], [8744990, 9539988], [9539989, 10334987], [10334988, 11129986], [11129987, 11924985], [11924986, 12719984], [12719985, 13514983], [13514984, 14309982], [14309983, 15104981], [15104982, 15899983]] SRR12897259 file size 3804101 SRR12897259 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12897259 SRR12897259_1.fastq Input file: SRR12897259_1.fastq trimmed: SRR12897259-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:24:36 2024 >> started Sat Dec 7 12:24:44 2024 >> done (8.230s) 15899983 reads processed; of these: 3 ( 0.00%) short reads filtered out after trimming by size control 1626 ( 0.01%) empty reads filtered out after trimming by size control 15898354 (99.99%) reads available; of these: 180 ( 0.00%) trimmed reads available after processing 15898174 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 3 0.00% 26 3 0.00% 27 2 0.00% 28 1 0.00% 29 1 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 28 0.00% 36 21 0.00% 37 31 0.00% 38 49 0.00% 39 45 0.00% 40 43 0.00% 41 54 0.00% 42 67 0.00% 43 50 0.00% 44 59 0.00% 45 94 0.00% 46 78 0.00% 47 114 0.00% 48 141 0.00% 49 169 0.00% 50 212 0.00% 51 209 0.00% 52 253 0.00% 53 245 0.00% 54 286 0.00% 55 291 0.00% 56 313 0.00% 57 365 0.00% 58 436 0.00% 59 535 0.00% 60 595 0.00% 61 682 0.00% 62 775 0.00% 63 834 0.01% 64 974 0.01% 65 1064 0.01% 66 1199 0.01% 67 1321 0.01% 68 1427 0.01% 69 1599 0.01% 70 1969 0.01% 71 2070 0.01% 72 2622 0.02% 73 2902 0.02% 74 3210 0.02% 75 3556 0.02% 76 3906 0.02% 77 4351 0.03% 78 4953 0.03% 79 5575 0.04% 80 6081 0.04% 81 6966 0.04% 82 7884 0.05% 83 8921 0.06% 84 10095 0.06% 85 11461 0.07% 86 12255 0.08% 87 13759 0.09% 88 14967 0.09% 89 15930 0.10% 90 17790 0.11% 91 19891 0.13% 92 19710 0.12% 93 21984 0.14% 94 25614 0.16% 95 29105 0.18% 96 49121 0.31% 97 105540 0.66% 98 323813 2.04% 99 1080197 6.79% 100 3761890 23.66% 101 10285597 64.70% 15898354 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.53 fanout-score-rank=32 prefix-density=0.27 prefix-fanout=2.2 sequence=GATCCACAGCTGCAAGACATC criterion=fanout-score sequence-density=0.09 sequence-density-rank=9 fanout-score=89.73 fanout-score-rank=1 prefix-density=0.56 prefix-fanout=15.1 sequence=TTCTTCTTCTTCCCTGCCTCAATCGCCATCTTCTTCGTCTTCCCCAGCTGCT Started job on | Dec 07 12:25:02 Started mapping on | Dec 07 12:25:02 Finished on | Dec 07 12:25:27 Mapping speed, Million of reads per hour | 2289.36 Number of input reads | 15898354 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 14965910 Uniquely mapped reads % | 94.13% Average mapped length | 100.01 Number of splices: Total | 5062782 Number of splices: Annotated (sjdb) | 4815906 Number of splices: GT/AG | 4985649 Number of splices: GC/AG | 66766 Number of splices: AT/AC | 2957 Number of splices: Non-canonical | 7410 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 2.39 Insertion rate per base | 0.01% Insertion average length | 1.73 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 207555 % of reads mapped to multiple loci | 1.31% Number of reads mapped to too many loci | 293167 % of reads mapped to too many loci | 1.84% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.64% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 724889 724889 724889 N_multimapping 207555 207555 207555 N_noFeature 585429 14562599 692473 N_ambiguous 317346 1025 22529 UnstrandedReadsAssigned:14063135 PositiveStrandReadsAssigned:402286 NegativeStrandReadsAssigned:14250908 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR12897259 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR12897259-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,898,354 reads, 14,354,795 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,210 rounds 52973 SRR12897259.ke.tsv 35125 SRR12897259.se.tsv 88098 total ==> SRR12897259.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 108.14 15.2828 PNS24247 1044 945 34.1672 4.27682 PNS24249 1928 1829 15.1041 0.976846 PNS24246 1044 945 34.1672 4.27682 PNS24248 1044 945 34.1672 4.27682 PNS24244 1471 1372 100.255 8.64358 PNS24243 293 194 0 0 KQK14069 1603 1504 6606.97 519.635 KQK14071 474 375 179.75 56.6998 ==> SRR12897259.se.tsv <== BRADI_1g14170v3 7167 BRADI_1g53295v3 41 BRADI_1g59795v3 210 BRADI_1g07683v3 0 BRADI_1g00485v3 30 BRADI_1g20270v3 443 BRADI_1g74790v3 56 BRADI_1g09890v3 0 BRADI_1g77505v3 148 BRADI_1g48960v3 0 SRR12897259 completed mapping pipeline successfully