Starting /dee2/code/volunteer_pipeline.sh SRR12897260 current disk space = 1516101713920 free memory = 1607792068 SRR12897260 SRAfilesize 53c354711467e2d6a9a14ac6154bfd62 SRR12897260.sra SRR12897260.sra file validated SRR12897260 is single end SRR12897260 is conventional basespace SRR12897260 read1 length is 65-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12897260_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 65-101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5935 37.0 37.0 37.0 37.0 37.0 2 36.726 37.0 37.0 37.0 37.0 37.0 3 36.762 37.0 37.0 37.0 37.0 37.0 4 36.6935 37.0 37.0 37.0 37.0 37.0 5 36.7715 37.0 37.0 37.0 37.0 37.0 6 36.7265 37.0 37.0 37.0 37.0 37.0 7 36.7515 37.0 37.0 37.0 37.0 37.0 8 36.737 37.0 37.0 37.0 37.0 37.0 9 36.729 37.0 37.0 37.0 37.0 37.0 10-11 36.724 37.0 37.0 37.0 37.0 37.0 12-13 36.7495 37.0 37.0 37.0 37.0 37.0 14-15 36.7645 37.0 37.0 37.0 37.0 37.0 16-17 36.73950000000001 37.0 37.0 37.0 37.0 37.0 18-19 36.788250000000005 37.0 37.0 37.0 37.0 37.0 20-21 36.7695 37.0 37.0 37.0 37.0 37.0 22-23 36.745 37.0 37.0 37.0 37.0 37.0 24-25 36.71825 37.0 37.0 37.0 37.0 37.0 26-27 36.72225 37.0 37.0 37.0 37.0 37.0 28-29 36.714749999999995 37.0 37.0 37.0 37.0 37.0 30-31 36.66575 37.0 37.0 37.0 37.0 37.0 32-33 36.7005 37.0 37.0 37.0 37.0 37.0 34-35 36.6955 37.0 37.0 37.0 37.0 37.0 36-37 36.684 37.0 37.0 37.0 37.0 37.0 38-39 36.691 37.0 37.0 37.0 37.0 37.0 40-41 36.653999999999996 37.0 37.0 37.0 37.0 37.0 42-43 36.69 37.0 37.0 37.0 37.0 37.0 44-45 36.650000000000006 37.0 37.0 37.0 37.0 37.0 46-47 36.681 37.0 37.0 37.0 37.0 37.0 48-49 36.693 37.0 37.0 37.0 37.0 37.0 50-51 36.66375 37.0 37.0 37.0 37.0 37.0 52-53 36.699 37.0 37.0 37.0 37.0 37.0 54-55 36.66475 37.0 37.0 37.0 37.0 37.0 56-57 36.6365 37.0 37.0 37.0 37.0 37.0 58-59 36.62975 37.0 37.0 37.0 37.0 37.0 60-61 36.669 37.0 37.0 37.0 37.0 37.0 62-63 36.66375 37.0 37.0 37.0 37.0 37.0 64-65 36.70025 37.0 37.0 37.0 37.0 37.0 66-67 36.67341835458865 37.0 37.0 37.0 37.0 37.0 68-69 36.61790447611903 37.0 37.0 37.0 37.0 37.0 70-71 36.55871818821595 37.0 37.0 37.0 37.0 37.0 72-73 36.653316645807266 37.0 37.0 37.0 37.0 37.0 74-75 36.62093124795676 37.0 37.0 37.0 37.0 37.0 76-77 36.61829766259619 37.0 37.0 37.0 37.0 37.0 78-79 36.569995207133346 37.0 37.0 37.0 37.0 37.0 80-81 36.56554812213679 37.0 37.0 37.0 37.0 37.0 82-83 36.64563617763831 37.0 37.0 37.0 37.0 37.0 84-85 36.61457334830749 37.0 37.0 37.0 37.0 37.0 86-87 36.57889972011248 37.0 37.0 37.0 37.0 37.0 88-89 36.590941818566954 37.0 37.0 37.0 37.0 37.0 90-91 36.56961814444236 37.0 37.0 37.0 37.0 37.0 92-93 36.57856420671527 37.0 37.0 37.0 37.0 37.0 94-95 36.596387802767524 37.0 37.0 37.0 37.0 37.0 96-97 36.614857265731565 37.0 37.0 37.0 37.0 37.0 98-99 36.58628290160652 37.0 37.0 37.0 37.0 37.0 100-101 36.53723281646249 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 1.0 26 3.0 27 7.0 28 4.0 29 7.0 30 10.0 31 13.0 32 14.0 33 27.0 34 38.0 35 116.0 36 2161.0 37 1599.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.055055055055057 10.91091091091091 5.655655655655655 53.37837837837838 2 19.1 12.45 39.425 29.025000000000002 3 17.8 14.374999999999998 25.874999999999996 41.949999999999996 4 25.15 23.674999999999997 21.25 29.925 5 26.125 29.5 22.6 21.775 6 21.3 31.775 24.325 22.6 7 17.150000000000002 23.875 40.849999999999994 18.125 8 19.175 22.425 32.300000000000004 26.1 9 20.474999999999998 20.674999999999997 35.375 23.474999999999998 10-11 22.95 30.125 23.65 23.275000000000002 12-13 22.4625 23.849999999999998 27.775 25.912499999999998 14-15 21.712500000000002 25.025 26.924999999999997 26.337500000000002 16-17 22.8 25.8125 26.3625 25.025 18-19 22.025 26.0625 26.0 25.912499999999998 20-21 22.3 25.5375 26.7625 25.4 22-23 22.225 27.4125 26.1125 24.25 24-25 22.287499999999998 24.5 26.924999999999997 26.2875 26-27 23.1 25.124999999999996 26.75 25.025 28-29 22.175 25.8625 26.2875 25.674999999999997 30-31 22.325 24.45 27.487499999999997 25.7375 32-33 23.1625 24.887500000000003 26.375 25.575 34-35 23.1875 25.0375 26.1125 25.662499999999998 36-37 21.762500000000003 26.1 25.624999999999996 26.5125 38-39 22.6125 25.887500000000003 26.05 25.45 40-41 22.6875 25.474999999999998 26.375 25.4625 42-43 22.625 24.85 26.787499999999998 25.7375 44-45 22.662499999999998 24.8625 26.35 26.125 46-47 22.5125 26.650000000000002 25.2875 25.55 48-49 22.0875 24.9875 26.375 26.55 50-51 22.625 25.0125 26.3625 26.0 52-53 21.95 25.974999999999998 26.487500000000004 25.587500000000002 54-55 23.474999999999998 25.6 25.424999999999997 25.5 56-57 21.6625 25.5625 26.6125 26.1625 58-59 21.9375 26.0125 26.2625 25.7875 60-61 22.8375 25.474999999999998 25.624999999999996 26.0625 62-63 21.45 25.162499999999998 26.8 26.5875 64-65 22.8875 25.95 25.4875 25.674999999999997 66-67 23.218304576144035 25.84396099024756 25.006251562890725 25.93148287071768 68-69 22.943235808952238 25.268817204301076 26.206551637909474 25.581395348837212 70-71 22.601626016260163 25.8036272670419 25.50343964978111 26.091307066916826 72-73 23.028785982478098 24.755944931163956 26.72090112640801 25.494367959949937 74-75 22.646469704556836 25.162744116174263 26.41462193289935 25.776164246369554 76-77 22.982456140350877 26.240601503759397 25.651629072681704 25.125313283208023 78-79 23.406924234821876 25.401404917210236 25.23833416959358 25.95333667837431 80-81 24.510296333500754 25.150678051230535 25.213460572576597 25.125565042692116 82-83 23.390342052313883 26.395875251509054 25.06287726358149 25.15090543259557 84-85 24.146617961959947 25.053533190578158 26.653230885501955 24.146617961959947 86-87 22.746781115879827 25.877303711184048 25.927796011108306 25.44811916182782 88-89 22.780166961801164 25.183405008854038 26.625347837085755 25.411080192259046 90-91 22.711133654577733 25.66573674866853 25.678417448643167 25.944712148110575 92-93 23.235668789808916 24.40764331210191 27.15923566878981 25.197452229299362 94-95 22.941176470588236 25.60102301790281 26.0230179028133 25.43478260869565 96-97 23.41438312106008 25.151164286633215 26.25755821433166 25.17689437797504 98-99 23.604757548032936 23.552476800418244 26.59783034897399 26.244935302574827 100-101 23.39937776322253 12.035369248403471 32.814802685442935 31.75045030293106 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 0.5 28 0.0 29 2.5 30 6.0 31 11.0 32 17.5 33 19.5 34 26.0 35 33.5 36 48.5 37 62.5 38 69.5 39 91.0 40 133.5 41 165.5 42 170.5 43 174.5 44 205.5 45 226.5 46 216.5 47 206.0 48 202.0 49 200.5 50 187.5 51 160.5 52 150.0 53 142.5 54 125.5 55 117.0 56 102.5 57 91.0 58 83.5 59 73.5 60 68.5 61 68.5 62 57.0 63 55.0 64 50.5 65 42.0 66 40.0 67 34.0 68 28.0 69 20.0 70 11.5 71 6.5 72 6.0 73 3.5 74 1.0 75 0.5 76 0.5 77 1.0 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 65 1.0 66 0.0 67 0.0 68 0.0 69 1.0 70 1.0 71 2.0 72 0.0 73 0.0 74 2.0 75 2.0 76 2.0 77 2.0 78 2.0 79 1.0 80 4.0 81 2.0 82 4.0 83 3.0 84 3.0 85 5.0 86 4.0 87 4.0 88 4.0 89 5.0 90 6.0 91 12.0 92 6.0 93 9.0 94 6.0 95 15.0 96 11.0 97 22.0 98 67.0 99 286.0 100 905.0 101 2601.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.175 #Duplication Level Percentage of deduplicated Percentage of total 1 94.29254048314309 88.8 2 5.282718343509424 9.950000000000001 3 0.37164852667905496 1.05 4 0.053092646668436425 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 801025 READS because READLEN < 1 Read 801025 spots for SRR12897260.sra Written 801025 spots for SRR12897260.sra Rejected 801025 READS because READLEN < 1 Read 801025 spots for SRR12897260.sra Written 801025 spots for SRR12897260.sra Rejected 801025 READS because READLEN < 1 Read 801025 spots for SRR12897260.sra Written 801025 spots for SRR12897260.sra Rejected 801025 READS because READLEN < 1 Read 801025 spots for SRR12897260.sra Written 801025 spots for SRR12897260.sra Rejected 801025 READS because READLEN < 1 Read 801025 spots for SRR12897260.sra Written 801025 spots for SRR12897260.sra Rejected 801025 READS because READLEN < 1 Read 801025 spots for SRR12897260.sra Written 801025 spots for SRR12897260.sra Rejected 801030 READS because READLEN < 1 Read 801030 spots for SRR12897260.sra Written 801030 spots for SRR12897260.sra Rejected 801025 READS because READLEN < 1 Read 801025 spots for SRR12897260.sra Written 801025 spots for SRR12897260.sra Rejected 801025 READS because READLEN < 1 Read 801025 spots for SRR12897260.sra Written 801025 spots for SRR12897260.sra Rejected 801025 READS because READLEN < 1 Read 801025 spots for SRR12897260.sra Written 801025 spots for SRR12897260.sra Rejected 801025 READS because READLEN < 1 Read 801025 spots for SRR12897260.sra Written 801025 spots for SRR12897260.sra Rejected 801025 READS because READLEN < 1 Read 801025 spots for SRR12897260.sra Written 801025 spots for SRR12897260.sra Rejected 801025 READS because READLEN < 1 Read 801025 spots for SRR12897260.sra Written 801025 spots for SRR12897260.sra Rejected 801025 READS because READLEN < 1 Read 801025 spots for SRR12897260.sra Written 801025 spots for SRR12897260.sra Rejected 801025 READS because READLEN < 1 Read 801025 spots for SRR12897260.sra Written 801025 spots for SRR12897260.sra Rejected 801025 READS because READLEN < 1 Read 801025 spots for SRR12897260.sra Written 801025 spots for SRR12897260.sra Rejected 801025 READS because READLEN < 1 Read 801025 spots for SRR12897260.sra Written 801025 spots for SRR12897260.sra Rejected 801025 READS because READLEN < 1 Read 801025 spots for SRR12897260.sra Written 801025 spots for SRR12897260.sra Rejected 801025 READS because READLEN < 1 Read 801025 spots for SRR12897260.sra Written 801025 spots for SRR12897260.sra Rejected 801025 READS because READLEN < 1 Read 801025 spots for SRR12897260.sra Written 801025 spots for SRR12897260.sra SRR ids: ['SRR12897260.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_59805wf1 SRR12897260.sra spots: 16020505 blocks: [[1, 801025], [801026, 1602050], [1602051, 2403075], [2403076, 3204100], [3204101, 4005125], [4005126, 4806150], [4806151, 5607175], [5607176, 6408200], [6408201, 7209225], [7209226, 8010250], [8010251, 8811275], [8811276, 9612300], [9612301, 10413325], [10413326, 11214350], [11214351, 12015375], [12015376, 12816400], [12816401, 13617425], [13617426, 14418450], [14418451, 15219475], [15219476, 16020505]] SRR12897260 file size 3829523 SRR12897260 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12897260 SRR12897260_1.fastq Input file: SRR12897260_1.fastq trimmed: SRR12897260-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Dec 12 02:06:45 2024 >> started Thu Dec 12 02:06:53 2024 >> done (8.119s) 16020505 reads processed; of these: 5 ( 0.00%) short reads filtered out after trimming by size control 1229 ( 0.01%) empty reads filtered out after trimming by size control 16019271 (99.99%) reads available; of these: 295 ( 0.00%) trimmed reads available after processing 16018976 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 1 0.00% 21 0 0.00% 22 1 0.00% 23 1 0.00% 24 0 0.00% 25 0 0.00% 26 1 0.00% 27 1 0.00% 28 1 0.00% 29 1 0.00% 30 2 0.00% 31 1 0.00% 32 0 0.00% 33 1 0.00% 34 2 0.00% 35 49 0.00% 36 50 0.00% 37 68 0.00% 38 72 0.00% 39 92 0.00% 40 118 0.00% 41 112 0.00% 42 128 0.00% 43 131 0.00% 44 130 0.00% 45 108 0.00% 46 164 0.00% 47 164 0.00% 48 241 0.00% 49 281 0.00% 50 381 0.00% 51 376 0.00% 52 413 0.00% 53 422 0.00% 54 431 0.00% 55 527 0.00% 56 525 0.00% 57 645 0.00% 58 729 0.00% 59 843 0.01% 60 1012 0.01% 61 1196 0.01% 62 1269 0.01% 63 1315 0.01% 64 1475 0.01% 65 1719 0.01% 66 1838 0.01% 67 2177 0.01% 68 2375 0.01% 69 2501 0.02% 70 2924 0.02% 71 3314 0.02% 72 3777 0.02% 73 4365 0.03% 74 4926 0.03% 75 5274 0.03% 76 5969 0.04% 77 6438 0.04% 78 6936 0.04% 79 8090 0.05% 80 8514 0.05% 81 9815 0.06% 82 11123 0.07% 83 12307 0.08% 84 13730 0.09% 85 15486 0.10% 86 17072 0.11% 87 18319 0.11% 88 20155 0.13% 89 21401 0.13% 90 23116 0.14% 91 25752 0.16% 92 26545 0.17% 93 29946 0.19% 94 33443 0.21% 95 37204 0.23% 96 57834 0.36% 97 112062 0.70% 98 331088 2.07% 99 1081631 6.75% 100 3740324 23.35% 101 10296300 64.27% 16019271 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=31 prefix-density=0.10 prefix-fanout=2.0 sequence=TAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTT criterion=fanout-score sequence-density=0.06 sequence-density-rank=25 fanout-score=469.22 fanout-score-rank=1 prefix-density=0.81 prefix-fanout=34.0 sequence=CTTCTTCTTCCT Started job on | Dec 12 02:07:31 Started mapping on | Dec 12 02:07:31 Finished on | Dec 12 02:07:46 Mapping speed, Million of reads per hour | 3844.63 Number of input reads | 16019271 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 15489402 Uniquely mapped reads % | 96.69% Average mapped length | 99.93 Number of splices: Total | 5500711 Number of splices: Annotated (sjdb) | 5195634 Number of splices: GT/AG | 5421242 Number of splices: GC/AG | 68179 Number of splices: AT/AC | 3039 Number of splices: Non-canonical | 8251 Mismatch rate per base, % | 0.17% Deletion rate per base | 0.01% Deletion average length | 2.22 Insertion rate per base | 0.01% Insertion average length | 1.74 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 305681 % of reads mapped to multiple loci | 1.91% Number of reads mapped to too many loci | 134071 % of reads mapped to too many loci | 0.84% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.53% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 224188 224188 224188 N_multimapping 305681 305681 305681 N_noFeature 729647 15132930 846583 N_ambiguous 272566 1205 33989 UnstrandedReadsAssigned:14487189 PositiveStrandReadsAssigned:355267 NegativeStrandReadsAssigned:14608830 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR12897260 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR12897260-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,019,271 reads, 14,771,141 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,163 rounds 52973 SRR12897260.ke.tsv 35125 SRR12897260.se.tsv 88098 total ==> SRR12897260.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 160.985 23.201 PNS24247 1044 945 47.3193 6.04024 PNS24249 1928 1829 30.5608 2.01557 PNS24246 1044 945 47.3193 6.04024 PNS24248 1044 945 47.3193 6.04024 PNS24244 1471 1372 218.496 19.2104 PNS24243 293 194 0 0 KQK14069 1603 1504 4131.74 331.384 KQK14071 474 375 270.92 87.1479 ==> SRR12897260.se.tsv <== BRADI_1g14170v3 4914 BRADI_1g53295v3 176 BRADI_1g59795v3 457 BRADI_1g07683v3 0 BRADI_1g00485v3 20 BRADI_1g20270v3 1263 BRADI_1g74790v3 227 BRADI_1g09890v3 1 BRADI_1g77505v3 311 BRADI_1g48960v3 0 SRR12897260 completed mapping pipeline successfully