Starting /dee2/code/volunteer_pipeline.sh SRR12897261 current disk space = 1543160098816 free memory = 1601885612 SRR12897261 SRAfilesize 77bc446b582774a915b48a8849c76bbb SRR12897261.sra SRR12897261.sra file validated SRR12897261 is single end SRR12897261 is conventional basespace SRR12897261 read1 length is 35-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12897261_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.71625 37.0 37.0 37.0 37.0 37.0 2 36.69375 37.0 37.0 37.0 37.0 37.0 3 36.77925 37.0 37.0 37.0 37.0 37.0 4 36.72025 37.0 37.0 37.0 37.0 37.0 5 36.82175 37.0 37.0 37.0 37.0 37.0 6 36.77325 37.0 37.0 37.0 37.0 37.0 7 36.67475 37.0 37.0 37.0 37.0 37.0 8 36.74425 37.0 37.0 37.0 37.0 37.0 9 36.76425 37.0 37.0 37.0 37.0 37.0 10-11 36.786500000000004 37.0 37.0 37.0 37.0 37.0 12-13 36.793 37.0 37.0 37.0 37.0 37.0 14-15 36.74925 37.0 37.0 37.0 37.0 37.0 16-17 36.7595 37.0 37.0 37.0 37.0 37.0 18-19 36.798 37.0 37.0 37.0 37.0 37.0 20-21 36.7765 37.0 37.0 37.0 37.0 37.0 22-23 36.76075 37.0 37.0 37.0 37.0 37.0 24-25 36.721000000000004 37.0 37.0 37.0 37.0 37.0 26-27 36.7465 37.0 37.0 37.0 37.0 37.0 28-29 36.714 37.0 37.0 37.0 37.0 37.0 30-31 36.72225 37.0 37.0 37.0 37.0 37.0 32-33 36.734750000000005 37.0 37.0 37.0 37.0 37.0 34-35 36.7265 37.0 37.0 37.0 37.0 37.0 36-37 36.688422105526385 37.0 37.0 37.0 37.0 37.0 38-39 36.709427356839214 37.0 37.0 37.0 37.0 37.0 40-41 36.6929232308077 37.0 37.0 37.0 37.0 37.0 42-43 36.7214303575894 37.0 37.0 37.0 37.0 37.0 44-45 36.68742185546387 37.0 37.0 37.0 37.0 37.0 46-47 36.65416354088522 37.0 37.0 37.0 37.0 37.0 48-49 36.720144268183105 37.0 37.0 37.0 37.0 37.0 50-51 36.721860930465226 37.0 37.0 37.0 37.0 37.0 52-53 36.67158579289645 37.0 37.0 37.0 37.0 37.0 54-55 36.71785892946473 37.0 37.0 37.0 37.0 37.0 56-57 36.62781390695348 37.0 37.0 37.0 37.0 37.0 58-59 36.65782891445723 37.0 37.0 37.0 37.0 37.0 60-61 36.69434717358679 37.0 37.0 37.0 37.0 37.0 62-63 36.716608304152075 37.0 37.0 37.0 37.0 37.0 64-65 36.66058029014508 37.0 37.0 37.0 37.0 37.0 66-67 36.6648324162081 37.0 37.0 37.0 37.0 37.0 68-69 36.6584938704028 37.0 37.0 37.0 37.0 37.0 70-71 36.63453438415882 37.0 37.0 37.0 37.0 37.0 72-73 36.62956800708338 37.0 37.0 37.0 37.0 37.0 74-75 36.625774464770345 37.0 37.0 37.0 37.0 37.0 76-77 36.669466075663706 37.0 37.0 37.0 37.0 37.0 78-79 36.5862676056338 37.0 37.0 37.0 37.0 37.0 80-81 36.600048350532234 37.0 37.0 37.0 37.0 37.0 82-83 36.60242253454797 37.0 37.0 37.0 37.0 37.0 84-85 36.58102067961005 37.0 37.0 37.0 37.0 37.0 86-87 36.5688646709891 37.0 37.0 37.0 37.0 37.0 88-89 36.55476256602515 37.0 37.0 37.0 37.0 37.0 90-91 36.55980969748747 37.0 37.0 37.0 37.0 37.0 92-93 36.56691969600139 37.0 37.0 37.0 37.0 37.0 94-95 36.53858221005116 37.0 37.0 37.0 37.0 37.0 96-97 36.614622003746106 37.0 37.0 37.0 37.0 37.0 98-99 36.55674476352516 37.0 37.0 37.0 37.0 37.0 100-101 36.55229631341288 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.0 25 0.0 26 2.0 27 3.0 28 6.0 29 5.0 30 9.0 31 12.0 32 16.0 33 31.0 34 38.0 35 92.0 36 2126.0 37 1657.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.78236914600551 10.693713999499122 4.357625845229151 52.16629100926622 2 18.229557389347338 12.153038259564891 40.76019004751188 28.857214303575894 3 18.30457614403601 14.87871967991998 25.6064016004001 41.21030257564391 4 24.031007751937985 24.281070267566893 21.80545136284071 29.882470617654416 5 24.831207801950487 29.80745186296574 24.831207801950487 20.530132533133283 6 22.680670167541887 31.532883220805203 22.85571392848212 22.930732683170792 7 17.67941985496374 24.381095273818453 39.45986496624156 18.479619904976243 8 18.0545136284071 24.20605151287822 32.13303325831458 25.6064016004001 9 18.554638659664917 20.78019504876219 33.85846461615404 26.806701675418854 10-11 21.680420105026258 31.182795698924732 24.656164041010253 22.48062015503876 12-13 21.467866966741685 25.49387346836709 27.106776694173547 25.93148287071768 14-15 20.367591897974492 25.693923480870218 28.069517379344838 25.868967241810452 16-17 22.20555138784696 25.11877969492373 26.63165791447862 26.04401100275069 18-19 22.630657664416105 25.381345336334082 26.419104776194047 25.568892223055762 20-21 21.555388847211805 26.219054763690924 26.531632908227053 25.693923480870218 22-23 21.9679919979995 26.59414853713428 26.36909227306827 25.068767191797946 24-25 22.380595148787197 25.44386096524131 26.59414853713428 25.581395348837212 26-27 21.405351337834457 26.019004751187797 26.831707926981746 25.743935983995996 28-29 21.905476369092273 25.76894223555889 26.206551637909474 26.11902975743936 30-31 22.1055263815954 26.056514128532132 26.331582895723933 25.506376594148538 32-33 22.74318579644911 25.29382345586397 27.231807951987996 24.731182795698924 34-35 22.405601400350086 25.431357839459867 27.26931732933233 24.893723430857715 36-37 23.280820205051263 25.35633908477119 25.818954738684667 25.543885971492873 38-39 21.85546386596649 26.494123530882717 26.619154788697173 25.03125781445361 40-41 21.392848212053014 27.131782945736433 25.756439109777446 25.71892973243311 42-43 22.118029507376843 25.36884221055264 26.544136034008503 25.968992248062015 44-45 22.780695173793447 25.731432858214554 26.831707926981746 24.656164041010253 46-47 21.955488872218055 26.094023505876468 26.79419854963741 25.156289072268066 48-49 21.30799049643616 26.259847442791045 26.034763036138553 26.39739902463424 50-51 22.586293146573286 25.475237618809405 27.4512256128064 24.487243621810904 52-53 22.698849424712357 26.388194097048522 26.663331665832917 24.249624812406203 54-55 22.123561780890444 26.21310655327664 26.28814407203602 25.3751875937969 56-57 21.83591795897949 25.250125062531264 27.51375687843922 25.400200100050025 58-59 21.68584292146073 26.21310655327664 27.063531765882942 25.03751875937969 60-61 22.273636818409205 25.78789394697349 25.900450225112557 26.038019009504755 62-63 23.036518259129565 25.212606303151574 26.32566283141571 25.42521260630315 64-65 22.661330665332667 25.07503751875938 26.713356678339167 25.550275137568786 66-67 21.91095547773887 25.812906453226613 27.238619309654826 25.03751875937969 68-69 21.916437327995997 26.8951713785339 26.56992744558419 24.618463847885916 70-71 22.202753441802255 27.033792240300375 25.982478097622025 24.780976220275345 72-73 23.533834586466167 24.887218045112782 26.604010025062657 24.9749373433584 74-75 22.954317269076306 26.229919678714857 25.941265060240966 24.87449799196787 76-77 22.420510242553725 26.266180721377403 25.901721754430064 25.41158728163881 78-79 22.459758551307846 25.741951710261567 26.006036217303823 25.792253521126764 80-81 21.822300528567833 26.151522778756608 26.453561540397686 25.572615152277876 82-83 23.41069626639758 25.668516649848637 25.605449041372353 25.315338042381434 84-85 22.91771832407875 25.214538112064616 26.28722867238768 25.58051489146895 86-87 22.453879201415212 26.105635582512004 26.333080616628756 25.10740459944402 88-89 23.312650373559578 25.743953400025326 26.83297454729644 24.11042167911865 90-91 22.288544577089155 25.666751333502667 26.46685293370587 25.577851155702312 92-93 22.570373200866133 25.678257546809323 25.831104317921284 25.92026493440326 94-95 22.98160449667859 27.056719468574347 25.37046499744507 24.591211037301992 96-97 21.976893453145056 26.046213093709884 26.251604621309372 25.725288831835684 98-99 22.53465864504316 23.72482343709129 28.106199319905834 25.634318597959716 100-101 23.905835543766578 11.289787798408488 33.007294429708224 31.797082228116714 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 0.0 27 1.5 28 3.0 29 4.0 30 4.0 31 10.0 32 16.0 33 25.0 34 35.5 35 36.0 36 47.5 37 71.0 38 81.0 39 102.5 40 140.5 41 168.0 42 185.5 43 203.5 44 218.5 45 232.0 46 231.0 47 225.5 48 221.5 49 196.5 50 178.5 51 161.5 52 148.0 53 131.0 54 107.0 55 90.0 56 83.5 57 79.5 58 70.0 59 69.0 60 66.5 61 56.5 62 54.0 63 57.5 64 48.0 65 38.0 66 31.5 67 23.5 68 18.5 69 14.0 70 10.5 71 7.0 72 5.0 73 2.5 74 2.0 75 2.5 76 1.5 77 0.5 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.025 3 0.025 4 0.025 5 0.025 6 0.025 7 0.025 8 0.025 9 0.025 10-11 0.025 12-13 0.025 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.025 24-25 0.025 26-27 0.025 28-29 0.025 30-31 0.025 32-33 0.025 34-35 0.025 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 34-35 1.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 1.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 1.0 68-69 1.0 70-71 5.0 72-73 5.0 74-75 6.0 76-77 4.0 78-79 2.0 80-81 9.0 82-83 2.0 84-85 3.0 86-87 10.0 88-89 9.0 90-91 13.0 92-93 12.0 94-95 12.0 96-97 40.0 98-99 365.0 100-101 3499.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.85 #Duplication Level Percentage of deduplicated Percentage of total 1 94.8603057459146 89.97500000000001 2 4.849762783342119 9.2 3 0.28993147074327885 0.8250000000000001 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTTCTC 25 0.004767658 56.685 5 >>END_MODULE Rejected 736171 READS because READLEN < 1 Read 736171 spots for SRR12897261.sra Written 736171 spots for SRR12897261.sra Rejected 736171 READS because READLEN < 1 Read 736171 spots for SRR12897261.sra Written 736171 spots for SRR12897261.sra Rejected 736171 READS because READLEN < 1 Read 736171 spots for SRR12897261.sra Written 736171 spots for SRR12897261.sra Rejected 736171 READS because READLEN < 1 Read 736171 spots for SRR12897261.sra Written 736171 spots for SRR12897261.sra Rejected 736171 READS because READLEN < 1 Read 736171 spots for SRR12897261.sra Written 736171 spots for SRR12897261.sra Rejected 736171 READS because READLEN < 1 Read 736171 spots for SRR12897261.sra Written 736171 spots for SRR12897261.sra Rejected 736171 READS because READLEN < 1 Read 736171 spots for SRR12897261.sra Written 736171 spots for SRR12897261.sra Rejected 736171 READS because READLEN < 1 Read 736171 spots for SRR12897261.sra Written 736171 spots for SRR12897261.sra Rejected 736173 READS because READLEN < 1 Read 736173 spots for SRR12897261.sra Written 736173 spots for SRR12897261.sra Rejected 736171 READS because READLEN < 1 Read 736171 spots for SRR12897261.sra Written 736171 spots for SRR12897261.sra Rejected 736171 READS because READLEN < 1 Read 736171 spots for SRR12897261.sra Written 736171 spots for SRR12897261.sra Rejected 736171 READS because READLEN < 1 Read 736171 spots for SRR12897261.sra Written 736171 spots for SRR12897261.sra Rejected 736171 READS because READLEN < 1 Read 736171 spots for SRR12897261.sra Written 736171 spots for SRR12897261.sra Rejected 736171 READS because READLEN < 1 Read 736171 spots for SRR12897261.sra Written 736171 spots for SRR12897261.sra Rejected 736171 READS because READLEN < 1 Read 736171 spots for SRR12897261.sra Written 736171 spots for SRR12897261.sra Rejected 736171 READS because READLEN < 1 Read 736171 spots for SRR12897261.sra Written 736171 spots for SRR12897261.sra Rejected 736171 READS because READLEN < 1 Read 736171 spots for SRR12897261.sra Written 736171 spots for SRR12897261.sra Rejected 736171 READS because READLEN < 1 Read 736171 spots for SRR12897261.sra Written 736171 spots for SRR12897261.sra Rejected 736171 READS because READLEN < 1 Read 736171 spots for SRR12897261.sra Written 736171 spots for SRR12897261.sra Rejected 736171 READS because READLEN < 1 Read 736171 spots for SRR12897261.sra Written 736171 spots for SRR12897261.sra SRR ids: ['SRR12897261.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_q_v5quxu SRR12897261.sra spots: 14723422 blocks: [[1, 736171], [736172, 1472342], [1472343, 2208513], [2208514, 2944684], [2944685, 3680855], [3680856, 4417026], [4417027, 5153197], [5153198, 5889368], [5889369, 6625539], [6625540, 7361710], [7361711, 8097881], [8097882, 8834052], [8834053, 9570223], [9570224, 10306394], [10306395, 11042565], [11042566, 11778736], [11778737, 12514907], [12514908, 13251078], [13251079, 13987249], [13987250, 14723422]] SRR12897261 file size 3517885 SRR12897261 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12897261 SRR12897261_1.fastq Input file: SRR12897261_1.fastq trimmed: SRR12897261-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:26:06 2024 >> started Sat Dec 7 12:26:14 2024 >> done (7.913s) 14723422 reads processed; of these: 11 ( 0.00%) short reads filtered out after trimming by size control 1506 ( 0.01%) empty reads filtered out after trimming by size control 14721905 (99.99%) reads available; of these: 257 ( 0.00%) trimmed reads available after processing 14721648 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 1 0.00% 31 3 0.00% 32 1 0.00% 33 1 0.00% 34 0 0.00% 35 35 0.00% 36 36 0.00% 37 58 0.00% 38 73 0.00% 39 71 0.00% 40 73 0.00% 41 90 0.00% 42 107 0.00% 43 107 0.00% 44 105 0.00% 45 117 0.00% 46 146 0.00% 47 162 0.00% 48 206 0.00% 49 224 0.00% 50 269 0.00% 51 316 0.00% 52 346 0.00% 53 391 0.00% 54 404 0.00% 55 389 0.00% 56 483 0.00% 57 579 0.00% 58 687 0.00% 59 759 0.01% 60 854 0.01% 61 1015 0.01% 62 1104 0.01% 63 1191 0.01% 64 1293 0.01% 65 1439 0.01% 66 1613 0.01% 67 1833 0.01% 68 1943 0.01% 69 2272 0.02% 70 2559 0.02% 71 3000 0.02% 72 3382 0.02% 73 3956 0.03% 74 4305 0.03% 75 4779 0.03% 76 5461 0.04% 77 5748 0.04% 78 6347 0.04% 79 7102 0.05% 80 7913 0.05% 81 8891 0.06% 82 10070 0.07% 83 11132 0.08% 84 12407 0.08% 85 14194 0.10% 86 15527 0.11% 87 16707 0.11% 88 17920 0.12% 89 19248 0.13% 90 21401 0.15% 91 23293 0.16% 92 24227 0.16% 93 27019 0.18% 94 30213 0.21% 95 34405 0.23% 96 52826 0.36% 97 103622 0.70% 98 304630 2.07% 99 997651 6.78% 100 3453605 23.46% 101 9447568 64.17% 14721905 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=3.15 fanout-score-rank=27 prefix-density=0.19 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.05 sequence-density-rank=25 fanout-score=517.46 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=34.3 sequence=CTTCTTCTTGTGCTCCTCATCCTC Started job on | Dec 07 12:26:34 Started mapping on | Dec 07 12:26:34 Finished on | Dec 07 12:26:47 Mapping speed, Million of reads per hour | 4076.84 Number of input reads | 14721905 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 14228005 Uniquely mapped reads % | 96.65% Average mapped length | 99.93 Number of splices: Total | 5029599 Number of splices: Annotated (sjdb) | 4745585 Number of splices: GT/AG | 4955697 Number of splices: GC/AG | 63557 Number of splices: AT/AC | 2745 Number of splices: Non-canonical | 7600 Mismatch rate per base, % | 0.17% Deletion rate per base | 0.01% Deletion average length | 2.23 Insertion rate per base | 0.01% Insertion average length | 1.72 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 276615 % of reads mapped to multiple loci | 1.88% Number of reads mapped to too many loci | 135892 % of reads mapped to too many loci | 0.92% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.52% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 217285 217285 217285 N_multimapping 276615 276615 276615 N_noFeature 710671 13887247 825491 N_ambiguous 256972 1055 32067 UnstrandedReadsAssigned:13260362 PositiveStrandReadsAssigned:339703 NegativeStrandReadsAssigned:13370447 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR12897261 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR12897261-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,721,905 reads, 13,510,387 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,156 rounds 52973 SRR12897261.ke.tsv 35125 SRR12897261.se.tsv 88098 total ==> SRR12897261.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 145.479 23.052 PNS24247 1044 945 36.376 5.10524 PNS24249 1928 1829 25.3545 1.83855 PNS24246 1044 945 36.376 5.10524 PNS24248 1044 945 36.376 5.10524 PNS24244 1471 1372 143.038 13.8271 PNS24243 293 194 0 0 KQK14069 1603 1504 3741.64 329.949 KQK14071 474 375 211.46 74.7876 ==> SRR12897261.se.tsv <== BRADI_1g14170v3 4502 BRADI_1g53295v3 205 BRADI_1g59795v3 403 BRADI_1g07683v3 0 BRADI_1g00485v3 29 BRADI_1g20270v3 1066 BRADI_1g74790v3 197 BRADI_1g09890v3 2 BRADI_1g77505v3 279 BRADI_1g48960v3 0 SRR12897261 completed mapping pipeline successfully